HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria flavescens (GCA_014596365.2)

Select a Genome:
BAKTA Annotations for GCA_014596365.2
Genome Selected: Neisseria flavescens
ContigsBases CDSrRNA tmRNAtRNA
4 2376255 2213 12 1 60
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4601 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4601 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 MAYX02000001.1 GCA014596365_02055 gene open 2108147-2108509 ssrA
2 MAYX02000001.1 GCA014596365_02055 tmRNA open 2108147-2108509 ssrA transfer-messenger RNA%2C SsrA
3 MAYX02000001.1 rep_origin open 1235512-1236159
4 MAYX02000001.1 rep_origin open 2080317-2082793
5 MAYX02000001.1 GCA014596365_00525 gene open 529564-529654 NmsRb
6 MAYX02000001.1 GCA014596365_00526 gene open 529762-529848 NmsRb
7 MAYX02000001.1 GCA014596365_00619 gene open 634603-634716 rrf
8 MAYX02000001.1 GCA014596365_00620 gene open 634812-637700 rrl
9 MAYX02000001.1 GCA014596365_00623 gene open 638312-639852 rrs
10 MAYX02000001.1 GCA014596365_00658 gene open 680515-680572 porB
11 MAYX02000001.1 GCA014596365_00725 gene open 744255-744417 sRNA_0030
12 MAYX02000001.1 GCA014596365_00891 gene open 923262-923442 6S
13 MAYX02000001.1 GCA014596365_00967 gene open 1000399-1000573 nrrF
14 MAYX02000001.1 GCA014596365_01000 gene open 1035350-1035463 rrf
15 MAYX02000001.1 GCA014596365_01001 gene open 1035559-1038447 rrl
16 MAYX02000001.1 GCA014596365_01004 gene open 1039059-1040599 rrs
17 MAYX02000001.1 GCA014596365_01160 gene open 1182551-1182664 rrf
18 MAYX02000001.1 GCA014596365_01161 gene open 1182760-1185648 rrl
19 MAYX02000001.1 GCA014596365_01164 gene open 1186260-1187800 rrs
20 MAYX02000001.1 GCA014596365_01198 gene open 1220431-1220792 RNaseP_bact_a
21 MAYX02000001.1 GCA014596365_01462 gene open 1494423-1494616 IR_84
22 MAYX02000001.1 GCA014596365_01610 gene open 1659483-1661023 rrs
23 MAYX02000001.1 GCA014596365_01613 gene open 1661635-1664523 rrl
24 MAYX02000001.1 GCA014596365_01614 gene open 1664619-1664732 rrf
25 MAYX02000001.1 GCA014596365_02247 gene open 2307023-2307119 Bacteria_small_SRP
26 MAYX02000001.1 GCA014596365_00525 ncRNA open 529564-529654 Neisseria metabolic switch regulator b (RcoF1/NgncR163)
27 MAYX02000001.1 GCA014596365_00526 ncRNA open 529762-529848 Neisseria metabolic switch regulator b (RcoF1/NgncR163)
28 MAYX02000001.1 GCA014596365_00658 ncRNA open 680515-680572 porB porB RNA
29 MAYX02000001.1 GCA014596365_00725 ncRNA open 744255-744417 Enterococcus sRNA 30
30 MAYX02000001.1 GCA014596365_00891 ncRNA open 923262-923442 6S / SsrS RNA
31 MAYX02000001.1 GCA014596365_00967 ncRNA open 1000399-1000573 nrrF NrrF RNA
32 MAYX02000001.1 GCA014596365_01198 ncRNA open 1220431-1220792 Bacterial RNase P class A
33 MAYX02000001.1 GCA014596365_01462 ncRNA open 1494423-1494616 Neisseria sRNA 84
34 MAYX02000001.1 GCA014596365_02247 ncRNA open 2307023-2307119 Bacterial small signal recognition particle RNA
35 MAYX02000001.1 regulatory_region open 741222-741267 PreQ1 (pre queuosine) riboswitch aptamer
36 MAYX02000001.1 regulatory_region open 839446-839543 Glycine riboswitch aptamer
37 MAYX02000001.1 regulatory_region open 1326831-1326930 TPP riboswitch aptamer (THI element)
38 MAYX02000001.1 regulatory_region open 1631674-1631718 PreQ1 (pre queuosine) riboswitch aptamer
39 MAYX02000001.1 regulatory_region open 1672124-1672234 SAM-I/IV (S-adenosyl methionine) riboswitch aptamer
40 MAYX02000001.1 regulatory_region open 1825636-1825759 Ribosomal S15 leader
41 MAYX02000001.1 GCA014596365_00619 rRNA open 634603-634716 rrf 5S ribosomal RNA
42 MAYX02000001.1 GCA014596365_00620 rRNA open 634812-637700 rrl 23S ribosomal RNA
43 MAYX02000001.1 GCA014596365_00623 rRNA open 638312-639852 rrs 16S ribosomal RNA
44 MAYX02000001.1 GCA014596365_01000 rRNA open 1035350-1035463 rrf 5S ribosomal RNA
45 MAYX02000001.1 GCA014596365_01001 rRNA open 1035559-1038447 rrl 23S ribosomal RNA
46 MAYX02000001.1 GCA014596365_01004 rRNA open 1039059-1040599 rrs 16S ribosomal RNA
47 MAYX02000001.1 GCA014596365_01160 rRNA open 1182551-1182664 rrf 5S ribosomal RNA
48 MAYX02000001.1 GCA014596365_01161 rRNA open 1182760-1185648 rrl 23S ribosomal RNA
49 MAYX02000001.1 GCA014596365_01164 rRNA open 1186260-1187800 rrs 16S ribosomal RNA
50 MAYX02000001.1 GCA014596365_01610 rRNA open 1659483-1661023 rrs 16S ribosomal RNA
51 MAYX02000001.1 GCA014596365_01613 rRNA open 1661635-1664523 rrl 23S ribosomal RNA
52 MAYX02000001.1 GCA014596365_01614 rRNA open 1664619-1664732 rrf 5S ribosomal RNA
53 MAYX02000001.1 repeat_region open 346329-352182 CRISPR array with 88 repeats of length 32%2C consensus sequence GTTTCAACACACAGCCGCCTAAAGGCGGCTGG and spacer length 34
54 MAYX02000001.1 repeat_region open 500332-501802 CRISPR array with 21 repeats of length 36%2C consensus sequence GTCGGAAGACTTGCCCCACTAATCGGGGATTAAGAC and spacer length 34
55 MAYX02000001.1 repeat_region open 506843-507238 CRISPR array with 6 repeats of length 36%2C consensus sequence GTCTTAATCCCCGATTAGTGGGGCAAGTCTTCCGAC and spacer length 34
56 MAYX02000001.1 GCA014596365_00004 CDS open 489-719 _na     76_aa RHS domain-containing protein
57 MAYX02000001.1 GCA014596365_00005 CDS open 763-1185 _na     140_aa YokE-like PH domain-containing protein
58 MAYX02000001.1 GCA014596365_00006 CDS open 1456-1833 _na     125_aa hypothetical protein
59 MAYX02000001.1 GCA014596365_00007 CDS open 2021-2449 _na     142_aa hypothetical protein
60 MAYX02000001.1 GCA014596365_00008 CDS open 2646-2900 _na     84_aa Adenylate cyclase
61 MAYX02000001.1 GCA014596365_00009 CDS open 2846-3010 _na     54_aa hypothetical protein
62 MAYX02000001.1 GCA014596365_00010 CDS open 3020-4801 _na     593_aa RHS repeat-associated core domain-containing protein
63 MAYX02000001.1 GCA014596365_00011 CDS open 5669-5959 _na     96_aa hypothetical protein
64 MAYX02000001.1 GCA014596365_00012 CDS open 5970-10484 _na     1504_aa RHS repeat-associated core domain-containing protein
65 MAYX02000001.1 GCA014596365_00013 CDS open 10545-13352 _na     935_aa Type VI secretion system Vgr family protein
66 MAYX02000001.1 GCA014596365_00014 CDS open 13783-13947 _na     54_aa hypothetical protein
67 MAYX02000001.1 GCA014596365_00015 CDS open 14159-14257 _na     32_aa hypothetical protein
68 MAYX02000001.1 GCA014596365_00016 CDS open 14479-19446 _na     1655_aa Putative DNA helicase
69 MAYX02000001.1 GCA014596365_00017 CDS open 19443-20471 _na     342_aa hypothetical protein
70 MAYX02000001.1 GCA014596365_00018 CDS open 20989-21411 _na     140_aa DUF4113 domain-containing protein
71 MAYX02000001.1 GCA014596365_00019 CDS open 21567-22103 _na     178_aa umuC DNA polymerase V subunit UmuC
72 MAYX02000001.1 GCA014596365_00020 CDS open 22129-23574 _na     481_aa vgrG Type VI secretion system tip protein VgrG
73 MAYX02000001.1 GCA014596365_00021 CDS open 23927-25870 _na     647_aa Phosphoenolpyruvate synthase
74 MAYX02000001.1 GCA014596365_00022 CDS open 25961-26593 _na     210_aa phosphoglycerate mutase (2%2C3-diphosphoglycerate-dependent)
75 MAYX02000001.1 GCA014596365_00023 CDS open 26651-27229 _na     192_aa mdaB NAD(P)H-dependent oxidoreductase
76 MAYX02000001.1 GCA014596365_00024 CDS open 27369-27938 _na     189_aa lysR LysR substrate-binding domain-containing protein
77 MAYX02000001.1 GCA014596365_00025 CDS open 28128-28979 _na     283_aa Metallo-beta-lactamase domain-containing protein
78 MAYX02000001.1 GCA014596365_00026 CDS open 29077-30063 _na     328_aa HTH araC/xylS-type domain-containing protein
79 MAYX02000001.1 GCA014596365_00027 CDS open 30158-30640 _na     160_aa ABC transporter ATP-binding protein
80 MAYX02000001.1 GCA014596365_00028 CDS open 30716-31084 _na     122_aa hypothetical protein
81 MAYX02000001.1 GCA014596365_00029 CDS open 31005-32216 _na     403_aa fadH NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein
82 MAYX02000001.1 GCA014596365_00030 CDS open 32290-32601 _na     103_aa arsR HTH arsR-type domain-containing protein
83 MAYX02000001.1 GCA014596365_00031 CDS open 32869-33204 _na     111_aa Thioredoxin domain-containing protein
84 MAYX02000001.1 GCA014596365_00032 CDS open 33297-33797 _na     166_aa yhfA OsmC-like protein
85 MAYX02000001.1 GCA014596365_00033 CDS open 33844-34149 _na     101_aa Aldo/keto reductase
86 MAYX02000001.1 GCA014596365_00034 CDS open 34735-35976 _na     413_aa DUF3396 domain-containing protein
87 MAYX02000001.1 GCA014596365_00035 CDS open 36005-36283 _na     92_aa hypothetical protein
88 MAYX02000001.1 GCA014596365_00036 CDS open 36451-37695 _na     414_aa DUF3396 domain-containing protein
89 MAYX02000001.1 GCA014596365_00037 CDS open 37724-39205 _na     493_aa VRR-NUC domain-containing protein
90 MAYX02000001.1 GCA014596365_00038 CDS open 39209-40558 _na     449_aa type VI secretion system Vgr family protein
91 MAYX02000001.1 GCA014596365_00039 CDS open 40738-41832 _na     364_aa DUF6396 domain-containing protein
92 MAYX02000001.1 GCA014596365_00040 CDS open 41899-42996 _na     365_aa DUF6396 domain-containing protein
93 MAYX02000001.1 GCA014596365_00041 CDS open 43000-45690 _na     896_aa Phospholipase D-like domain-containing protein
94 MAYX02000001.1 GCA014596365_00042 CDS open 45776-48427 _na     883_aa Type VI secretion system Vgr family protein
95 MAYX02000001.1 GCA014596365_00043 CDS open 49160-49612 _na     150_aa SnoaL-like domain-containing protein
96 MAYX02000001.1 GCA014596365_00044 CDS open 49638-50219 _na     193_aa NAD-dependent dehydratase
97 MAYX02000001.1 GCA014596365_00045 CDS open 50342-51079 _na     245_aa D-malate degradation protein R
98 MAYX02000001.1 GCA014596365_00046 CDS open 51076-51234 _na     52_aa D-malate degradation protein R
99 MAYX02000001.1 GCA014596365_00047 CDS open 51399-51815 _na     138_aa hypothetical protein
100 MAYX02000001.1 GCA014596365_00048 CDS open 51962-54514 _na     850_aa DUF4132 domain-containing protein
101 MAYX02000001.1 GCA014596365_00049 CDS open 54778-55146 _na     122_aa insH Transposase InsH N-terminal domain-containing protein
102 MAYX02000001.1 GCA014596365_00050 CDS open 55089-55784 _na     231_aa tnp IS5 family transposase
103 MAYX02000001.1 GCA014596365_00051 CDS open 55962-56336 _na     124_aa rodA Rod shape-determining protein RodA
104 MAYX02000001.1 GCA014596365_00052 CDS open 56543-57850 _na     435_aa homoserine dehydrogenase
105 MAYX02000001.1 GCA014596365_00053 CDS open 57843-58277 _na     144_aa Lipoprotein
106 MAYX02000001.1 GCA014596365_00054 CDS open 58411-58917 _na     168_aa hypothetical protein
107 MAYX02000001.1 GCA014596365_00055 CDS open 58964-59680 _na     238_aa S-methyl-5'-thioinosine phosphorylase
108 MAYX02000001.1 GCA014596365_00056 CDS open 59747-60817 _na     356_aa ATP synthase F0%2C A subunit
109 MAYX02000001.1 GCA014596365_00057 CDS open 61023-62057 _na     344_aa purM Phosphoribosylformylglycinamidine cyclo-ligase
110 MAYX02000001.1 GCA014596365_00058 CDS open 62148-63344 _na     398_aa Acetate kinase
111 MAYX02000001.1 GCA014596365_00059 CDS open 63558-64727 _na     389_aa prpF 2-methylaconitate cis-trans isomerase PrpF
112 MAYX02000001.1 GCA014596365_00060 CDS open 64845-67451 _na     868_aa acnD Fe/S-dependent 2-methylisocitrate dehydratase AcnD
113 MAYX02000001.1 GCA014596365_00061 CDS open 67854-69008 _na     384_aa prpC 2-methylcitrate synthase
114 MAYX02000001.1 GCA014596365_00062 CDS open 69097-69972 _na     291_aa prpB methylisocitrate lyase
115 MAYX02000001.1 GCA014596365_00063 CDS open 70296-70391 _na     31_aa hypothetical protein
116 MAYX02000001.1 GCA014596365_00064 CDS open 70738-71160 _na     140_aa Secreted protein
117 MAYX02000001.1 GCA014596365_00065 CDS open 71162-71968 _na     268_aa 8-oxo-dGTP diphosphatase
118 MAYX02000001.1 GCA014596365_00066 CDS open 72119-72496 _na     125_aa Holo-[acyl-carrier-protein] synthase
119 MAYX02000001.1 GCA014596365_00067 CDS open 72585-73313 _na     242_aa pdxJ pyridoxine 5'-phosphate synthase
120 MAYX02000001.1 GCA014596365_00068 CDS open 73382-74125 _na     247_aa recO DNA repair protein RecO
121 MAYX02000001.1 GCA014596365_00069 CDS open 74266-75708 _na     480_aa Patatin
122 MAYX02000001.1 GCA014596365_00070 CDS open 75821-76555 _na     244_aa queH Epoxyqueuosine reductase QueH
123 MAYX02000001.1 GCA014596365_00071 CDS open 76607-76975 _na     122_aa Stress response protein
124 MAYX02000001.1 GCA014596365_00072 CDS open 77344-79623 _na     759_aa nrdA class 1a ribonucleoside-diphosphate reductase subunit alpha
125 MAYX02000001.1 GCA014596365_00073 CDS open 79694-80524 _na     276_aa TIR domain-containing protein
126 MAYX02000001.1 GCA014596365_00074 CDS open 80632-81786 _na     384_aa nrdB class Ia ribonucleoside-diphosphate reductase subunit beta
127 MAYX02000001.1 GCA014596365_00075 CDS open 81862-82239 _na     125_aa DUF6979 domain-containing protein
128 MAYX02000001.1 GCA014596365_00076 CDS open 82301-82600 _na     99_aa yfaE class I ribonucleotide reductase maintenance protein YfaE
129 MAYX02000001.1 GCA014596365_00077 CDS open 82678-83247 _na     189_aa acetate uptake transporter
130 MAYX02000001.1 GCA014596365_00078 CDS open 83382-84131 _na     249_aa 3-dehydroquinate dehydratase
131 MAYX02000001.1 GCA014596365_00079 CDS open 84159-86000 _na     613_aa uvrC excinuclease ABC subunit UvrC
132 MAYX02000001.1 GCA014596365_00080 CDS open 86065-88836 _na     923_aa gyrA DNA gyrase subunit A
133 MAYX02000001.1 GCA014596365_00081 CDS open 88964-89446 _na     160_aa Acyl-CoA thioester hydrolase
134 MAYX02000001.1 GCA014596365_00082 CDS open 89561-90631 _na     356_aa corA magnesium/cobalt transporter CorA
135 MAYX02000001.1 GCA014596365_00083 CDS open 90733-92091 _na     452_aa gshA glutamate--cysteine ligase
136 MAYX02000001.1 GCA014596365_00084 CDS open 92356-93765 _na     469_aa leuC 3-isopropylmalate dehydratase large subunit
137 MAYX02000001.1 GCA014596365_00085 CDS open 93895-94149 _na     84_aa Lipoprotein
138 MAYX02000001.1 GCA014596365_00086 CDS open 94253-94618 _na     121_aa Glyoxalase family protein
139 MAYX02000001.1 GCA014596365_00087 CDS open 94664-95305 _na     213_aa leuD 3-isopropylmalate dehydratase small subunit
140 MAYX02000001.1 GCA014596365_00088 CDS open 95374-96042 _na     222_aa DUF2625 domain-containing protein
141 MAYX02000001.1 GCA014596365_00089 CDS open 96140-96601 _na     153_aa YhcH/YjgK/YiaL family protein
142 MAYX02000001.1 GCA014596365_00090 CDS open 96640-97503 _na     287_aa DUF1444 domain-containing protein
143 MAYX02000001.1 GCA014596365_00091 CDS open 97570-98640 _na     356_aa leuB 3-isopropylmalate dehydrogenase
144 MAYX02000001.1 GCA014596365_00092 CDS open 98769-100178 _na     469_aa srmB DEAD/DEAH box helicase
145 MAYX02000001.1 GCA014596365_00093 CDS open 100515-101486 _na     323_aa Putative methyltransferase
146 MAYX02000001.1 GCA014596365_00094 CDS open 101608-101949 _na     113_aa hypothetical protein
147 MAYX02000001.1 GCA014596365_00095 CDS open 102120-103301 _na     393_aa argD Acetylornithine aminotransferase
148 MAYX02000001.1 GCA014596365_00096 CDS open 103528-104463 _na     311_aa pyrD dihydroorotate oxidase
149 MAYX02000001.1 GCA014596365_00097 CDS open 104554-106554 _na     666_aa rep DNA helicase Rep
150 MAYX02000001.1 GCA014596365_00098 CDS open 106863-110759 _na     1298_aa purL phosphoribosylformylglycinamidine synthase
151 MAYX02000001.1 GCA014596365_00099 CDS open 111084-111896 _na     270_aa HNH endonuclease
152 MAYX02000001.1 GCA014596365_00100 CDS open 112082-113167 _na     361_aa DUF4238 domain-containing protein
153 MAYX02000001.1 GCA014596365_00101 CDS open 113191-113940 _na     249_aa gloB hydroxyacylglutathione hydrolase
154 MAYX02000001.1 GCA014596365_00102 CDS open 114010-115575 _na     521_aa guaA glutamine-hydrolyzing GMP synthase
155 MAYX02000001.1 GCA014596365_00103 CDS open 115724-116050 _na     108_aa Integral membrane protein
156 MAYX02000001.1 GCA014596365_00104 CDS open 116237-116689 _na     150_aa dut dUTP diphosphatase
157 MAYX02000001.1 GCA014596365_00105 CDS open 116801-117433 _na     210_aa pdxH pyridoxamine 5'-phosphate oxidase
158 MAYX02000001.1 GCA014596365_00106 CDS open 117593-118651 _na     352_aa rsuA Pseudouridine synthase
159 MAYX02000001.1 GCA014596365_00107 CDS open 119001-119426 _na     141_aa aldo/keto reductase
160 MAYX02000001.1 GCA014596365_00108 CDS open 119617-120366 _na     249_aa Adenylate cyclase
161 MAYX02000001.1 GCA014596365_00109 CDS open 120376-120636 _na     86_aa ABC transmembrane type-1 domain-containing protein
162 MAYX02000001.1 GCA014596365_00110 CDS open 121112-121546 _na     144_aa lysR LysR substrate-binding domain-containing protein
163 MAYX02000001.1 GCA014596365_00111 CDS open 121657-122406 _na     249_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
164 MAYX02000001.1 GCA014596365_00112 CDS open 122469-122777 _na     102_aa Branched-chain amino acid transporter
165 MAYX02000001.1 GCA014596365_00113 CDS open 122774-123484 _na     236_aa ygaZ Inner membrane protein YgaZ
166 MAYX02000001.1 GCA014596365_00114 CDS open 123587-124561 _na     324_aa phoH PhoH-like protein
167 MAYX02000001.1 GCA014596365_00115 CDS open 124683-125669 _na     328_aa mdh malate dehydrogenase
168 MAYX02000001.1 GCA014596365_00116 CDS open 126145-127581 _na     478_aa adhE Putative succinate-semialdehyde dehydrogenase
169 MAYX02000001.1 GCA014596365_00117 CDS open 127762-128769 _na     335_aa tnp IS5 family transposase
170 MAYX02000001.1 GCA014596365_00118 CDS open 129554-130285 _na     243_aa AAA family ATPase
171 MAYX02000001.1 GCA014596365_00119 CDS open 130836-131273 _na     145_aa ClpA/ClpB AAA lid domain-containing protein
172 MAYX02000001.1 GCA014596365_00120 CDS open 131216-132289 _na     357_aa AAA family ATPase
173 MAYX02000001.1 GCA014596365_00121 CDS open 132441-132929 _na     162_aa Secreted protein hcp
174 MAYX02000001.1 GCA014596365_00122 CDS open 133000-133212 _na     70_aa ompA OmpA family protein
175 MAYX02000001.1 GCA014596365_00123 CDS open 133279-133656 _na     125_aa hypothetical protein
176 MAYX02000001.1 GCA014596365_00124 CDS open 133933-134628 _na     231_aa hypothetical protein
177 MAYX02000001.1 GCA014596365_00125 CDS open 134917-135306 _na     129_aa dotU DotU family type IV/VI secretion system protein
178 MAYX02000001.1 GCA014596365_00126 CDS open 135308-136723 _na     471_aa tssK type VI secretion system baseplate subunit TssK
179 MAYX02000001.1 GCA014596365_00127 CDS open 137076-137312 _na     78_aa type VI secretion system contractile sheath small subunit
180 MAYX02000001.1 GCA014596365_00128 CDS open 137299-137553 _na     84_aa hypothetical protein
181 MAYX02000001.1 GCA014596365_00129 CDS open 137558-138214 _na     218_aa tssC type VI secretion system contractile sheath large subunit
182 MAYX02000001.1 GCA014596365_00130 CDS open 138178-138426 _na     82_aa tssC1 TssC1 N-terminal domain-containing protein
183 MAYX02000001.1 GCA014596365_00131 CDS open 138524-138892 _na     122_aa Type VI secretion protein%2C EvpB/ family
184 MAYX02000001.1 GCA014596365_00132 CDS open 139265-141037 _na     590_aa dnaG DNA primase
185 MAYX02000001.1 GCA014596365_00133 CDS open 141232-143184 _na     650_aa rpoD RNA polymerase sigma factor RpoD
186 MAYX02000001.1 GCA014596365_00134 CDS open 143302-144654 _na     450_aa Poly(A) polymerase I
187 MAYX02000001.1 GCA014596365_00135 CDS open 144872-145057 _na     61_aa DUF3460 domain-containing protein
188 MAYX02000001.1 GCA014596365_00136 CDS open 145070-145738 _na     222_aa O-methyltransferase
189 MAYX02000001.1 GCA014596365_00137 CDS open 145753-146508 _na     251_aa Tetratricopeptide repeat protein
190 MAYX02000001.1 GCA014596365_00138 CDS open 146588-147073 _na     161_aa purE N5-carboxyaminoimidazole ribonucleotide mutase
191 MAYX02000001.1 GCA014596365_00139 CDS open 147169-147501 _na     110_aa Inhibitor I9 domain-containing protein
192 MAYX02000001.1 GCA014596365_00140 CDS open 147584-149377 _na     597_aa leuA 2-isopropylmalate synthase
193 MAYX02000001.1 GCA014596365_00141 CDS open 149604-150719 _na     371_aa Methyltransferase small domain-containing protein
194 MAYX02000001.1 GCA014596365_00142 CDS open 150841-151314 _na     157_aa bfr bacterioferritin
195 MAYX02000001.1 GCA014596365_00143 CDS open 151349-151813 _na     154_aa bfr bacterioferritin
196 MAYX02000001.1 GCA014596365_00144 CDS open 152235-154046 _na     603_aa typA translational GTPase TypA
197 MAYX02000001.1 GCA014596365_00145 CDS open 154148-155104 _na     318_aa rclR RCS-specific HTH-type transcriptional activator RclR
198 MAYX02000001.1 GCA014596365_00146 CDS open 155233-155568 _na     111_aa yurZ Carboxymuconolactone decarboxylase-like domain-containing protein
199 MAYX02000001.1 GCA014596365_00147 CDS open 155681-156049 _na     122_aa pspE Thiosulfate sulfurtransferase PspE
200 MAYX02000001.1 GCA014596365_00148 CDS open 156105-156443 _na     112_aa AraC-type arabinose-binding/dimerisation domain-containing protein
201 MAYX02000001.1 GCA014596365_00149 CDS open 156542-157297 _na     251_aa surE 5'/3'-nucleotidase SurE
202 MAYX02000001.1 GCA014596365_00150 CDS open 157343-158302 _na     319_aa lysM LysM domain-containing protein
203 MAYX02000001.1 GCA014596365_00151 CDS open 158381-159904 _na     507_aa Phospholipase D domain protein
204 MAYX02000001.1 GCA014596365_00152 CDS open 159948-160481 _na     177_aa NlpC/P60 domain-containing protein
205 MAYX02000001.1 GCA014596365_00153 CDS open 160679-161587 _na     302_aa hemF oxygen-dependent coproporphyrinogen oxidase
206 MAYX02000001.1 GCA014596365_00154 CDS open 161780-162619 _na     279_aa htpX protease HtpX
207 MAYX02000001.1 GCA014596365_00155 CDS open 162669-163484 _na     271_aa hpnC squalene synthase HpnC
208 MAYX02000001.1 GCA014596365_00156 CDS open 163538-164260 _na     240_aa tadA tRNA adenosine(34) deaminase TadA
209 MAYX02000001.1 GCA014596365_00157 CDS open 164264-165205 _na     313_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
210 MAYX02000001.1 GCA014596365_00158 CDS open 165423-166475 _na     350_aa bioB biotin synthase BioB
211 MAYX02000001.1 GCA014596365_00159 CDS open 166522-167532 _na     336_aa adenosine deaminase
212 MAYX02000001.1 GCA014596365_00160 CDS open 167824-168006 _na     60_aa YcfA-like family protein
213 MAYX02000001.1 GCA014596365_00161 CDS open 168078-168494 _na     138_aa hicB Type II toxin-antitoxin system HicB family antitoxin
214 MAYX02000001.1 GCA014596365_00162 CDS open 168554-169066 _na     170_aa hypothetical protein
215 MAYX02000001.1 GCA014596365_00163 CDS open 169063-169539 _na     158_aa ATP-binding protein
216 MAYX02000001.1 GCA014596365_00164 CDS open 169590-169901 _na     103_aa hypothetical protein
217 MAYX02000001.1 GCA014596365_00165 CDS open 169901-170386 _na     161_aa Phage associated protein
218 MAYX02000001.1 GCA014596365_00166 CDS open 170526-171758 _na     410_aa collagen-like protein
219 MAYX02000001.1 GCA014596365_00167 CDS open 171755-172093 _na     112_aa bppU BppU N-terminal domain-containing protein
220 MAYX02000001.1 GCA014596365_00168 CDS open 172157-172402 _na     81_aa hypothetical protein
221 MAYX02000001.1 GCA014596365_00169 CDS open 172399-174717 _na     772_aa tail fiber domain-containing protein
222 MAYX02000001.1 GCA014596365_00170 CDS open 174780-175379 _na     199_aa DUF2313 domain-containing protein
223 MAYX02000001.1 GCA014596365_00171 CDS open 175367-176425 _na     352_aa Baseplate J/gp47 family protein
224 MAYX02000001.1 GCA014596365_00172 CDS open 176415-176837 _na     140_aa phage GP46 family protein
225 MAYX02000001.1 GCA014596365_00173 CDS open 176848-177399 _na     183_aa phage baseplate assembly protein V
226 MAYX02000001.1 GCA014596365_00174 CDS open 177396-178619 _na     407_aa phage baseplate assembly protein
227 MAYX02000001.1 GCA014596365_00175 CDS open 178622-179923 _na     433_aa DNA circularization protein
228 MAYX02000001.1 GCA014596365_00176 CDS open 179936-181642 _na     568_aa Tape measure protein N-terminal domain-containing protein
229 MAYX02000001.1 GCA014596365_00177 CDS open 181697-182179 _na     160_aa Lipoprotein
230 MAYX02000001.1 GCA014596365_00178 CDS open 182329-182616 _na     95_aa phage tail assembly protein
231 MAYX02000001.1 GCA014596365_00179 CDS open 182677-183045 _na     122_aa Phage tail tube protein
232 MAYX02000001.1 GCA014596365_00180 CDS open 183100-184575 _na     491_aa Phage tail sheath subtilisin-like domain-containing protein
233 MAYX02000001.1 GCA014596365_00181 CDS open 184575-184751 _na     58_aa DUF2635 domain-containing protein
234 MAYX02000001.1 GCA014596365_00182 CDS open 184754-185338 _na     194_aa hypothetical protein
235 MAYX02000001.1 GCA014596365_00183 CDS open 185319-185621 _na     100_aa Phage tail protein
236 MAYX02000001.1 GCA014596365_00184 CDS open 185614-185937 _na     107_aa hypothetical protein
237 MAYX02000001.1 GCA014596365_00185 CDS open 186012-187898 _na     628_aa phage major capsid protein
238 MAYX02000001.1 GCA014596365_00186 CDS open 187882-189432 _na     516_aa phage portal protein
239 MAYX02000001.1 GCA014596365_00187 CDS open 189442-189723 _na     93_aa hypothetical protein
240 MAYX02000001.1 GCA014596365_00188 CDS open 189725-189928 _na     67_aa F-93 winged-helix domain-containing protein
241 MAYX02000001.1 GCA014596365_00189 CDS open 190121-192157 _na     678_aa Phage terminase large subunit (GpA)
242 MAYX02000001.1 GCA014596365_00190 CDS open 192117-192608 _na     163_aa Terminase small subunit
243 MAYX02000001.1 GCA014596365_00191 CDS open 192847-193509 _na     220_aa Phage virion morphogenesis protein
244 MAYX02000001.1 GCA014596365_00192 CDS open 194461-197322 _na     953_aa NrS-1 polymerase-like helicase domain-containing protein
245 MAYX02000001.1 GCA014596365_00193 CDS open 197464-198069 _na     201_aa KilA-N domain-containing protein
246 MAYX02000001.1 GCA014596365_00194 CDS open 198071-198298 _na     75_aa XRE family transcriptional regulator
247 MAYX02000001.1 GCA014596365_00195 CDS open 198413-199114 _na     233_aa Peptidase S24/S26A/S26B/S26C domain-containing protein
248 MAYX02000001.1 GCA014596365_00196 CDS open 199304-199582 _na     92_aa hypothetical protein
249 MAYX02000001.1 GCA014596365_00197 CDS open 199631-200104 _na     157_aa SLATT domain-containing protein
250 MAYX02000001.1 GCA014596365_00198 CDS open 200387-200584 _na     65_aa hypothetical protein
251 MAYX02000001.1 GCA014596365_00199 CDS open 200597-200788 _na     63_aa hypothetical protein
252 MAYX02000001.1 GCA014596365_00200 CDS open 200810-201049 _na     79_aa alpA AlpA family phage regulatory protein
253 MAYX02000001.1 GCA014596365_00201 CDS open 201046-201252 _na     68_aa WGR domain-containing protein
254 MAYX02000001.1 GCA014596365_00202 CDS open 201254-201511 _na     85_aa hypothetical protein
255 MAYX02000001.1 GCA014596365_00203 CDS open 201512-201796 _na     94_aa hypothetical protein
256 MAYX02000001.1 GCA014596365_00204 CDS open 201793-201972 _na     59_aa Lipoprotein
257 MAYX02000001.1 GCA014596365_00205 CDS open 201969-202445 _na     158_aa Methyltransferase domain-containing protein
258 MAYX02000001.1 GCA014596365_00206 CDS open 202485-202628 _na     47_aa hypothetical protein
259 MAYX02000001.1 GCA014596365_00207 CDS open 202591-203187 _na     198_aa hypothetical protein
260 MAYX02000001.1 GCA014596365_00208 CDS open 203192-203434 _na     80_aa Head morphogeneis protein
261 MAYX02000001.1 GCA014596365_00209 CDS open 203445-203756 _na     103_aa hypothetical protein
262 MAYX02000001.1 GCA014596365_00210 CDS open 203783-205108 _na     441_aa site-specific integrase
263 MAYX02000001.1 GCA014596365_00211 CDS open 205279-206058 _na     259_aa fpr ferredoxin--NADP(+) reductase
264 MAYX02000001.1 GCA014596365_00212 CDS open 206157-206600 _na     147_aa DUF306 domain-containing protein
265 MAYX02000001.1 GCA014596365_00213 CDS open 206671-207828 _na     385_aa metC Putative 8-amino-7-oxononanoate synthase
266 MAYX02000001.1 GCA014596365_00214 CDS open 208007-208780 _na     257_aa folE2 GTP cyclohydrolase FolE2
267 MAYX02000001.1 GCA014596365_00215 CDS open 208999-210804 _na     601_aa dsbD Thiol:disulfide interchange protein DsbD
268 MAYX02000001.1 GCA014596365_00216 CDS open 210865-212037 _na     390_aa lldD L-lactate dehydrogenase
269 MAYX02000001.1 GCA014596365_00217 CDS open 212397-212843 _na     148_aa iscR Fe-S cluster assembly transcriptional regulator IscR
270 MAYX02000001.1 GCA014596365_00218 CDS open 212895-214109 _na     404_aa iscS IscS subfamily cysteine desulfurase
271 MAYX02000001.1 GCA014596365_00219 CDS open 214207-214875 _na     222_aa hypothetical protein
272 MAYX02000001.1 GCA014596365_00220 CDS open 215093-215221 _na     42_aa FxLD family lantipeptide
273 MAYX02000001.1 GCA014596365_00221 CDS open 215290-215676 _na     128_aa iscU Iron-sulfur cluster assembly scaffold protein IscU
274 MAYX02000001.1 GCA014596365_00222 CDS open 215784-216032 _na     82_aa recA Recombinase RecA
275 MAYX02000001.1 GCA014596365_00223 CDS open 216099-216419 _na     106_aa iscA iron-sulfur cluster assembly protein IscA
276 MAYX02000001.1 GCA014596365_00224 CDS open 216416-216601 _na     61_aa Alternative ribosome-rescue factor A
277 MAYX02000001.1 GCA014596365_00225 CDS open 216681-217181 _na     166_aa hscB Fe-S protein assembly co-chaperone HscB
278 MAYX02000001.1 GCA014596365_00226 CDS open 217290-217862 _na     190_aa rplY 50S ribosomal protein L25/general stress protein Ctc
279 MAYX02000001.1 GCA014596365_00227 CDS open 217928-218911 _na     327_aa prs Ribose-phosphate pyrophosphokinase
280 MAYX02000001.1 GCA014596365_00231 CDS open 219343-220218 _na     291_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
281 MAYX02000001.1 GCA014596365_00232 CDS open 220200-220784 _na     194_aa lolB lipoprotein insertase outer membrane protein LolB
282 MAYX02000001.1 GCA014596365_00233 CDS open 220841-222703 _na     620_aa Tetratricopeptide repeat protein
283 MAYX02000001.1 GCA014596365_00234 CDS open 222879-223484 _na     201_aa CoA pyrophosphatase
284 MAYX02000001.1 GCA014596365_00235 CDS open 223538-224935 _na     465_aa cysG siroheme synthase CysG
285 MAYX02000001.1 GCA014596365_00236 CDS open 225236-226528 _na     430_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
286 MAYX02000001.1 GCA014596365_00237 CDS open 226676-227722 _na     348_aa recA recombinase RecA
287 MAYX02000001.1 GCA014596365_00238 CDS open 227819-228667 _na     282_aa fghA S-formylglutathione hydrolase
288 MAYX02000001.1 GCA014596365_00239 CDS open 229168-230880 _na     570_aa proS proline--tRNA ligase
289 MAYX02000001.1 GCA014596365_00240 CDS open 230947-231816 _na     289_aa pflA pyruvate formate lyase 1-activating protein
290 MAYX02000001.1 GCA014596365_00241 CDS open 231892-234177 _na     761_aa pflB formate C-acetyltransferase
291 MAYX02000001.1 GCA014596365_00242 CDS open 234481-235779 _na     432_aa purA adenylosuccinate synthase
292 MAYX02000001.1 GCA014596365_00243 CDS open 235823-236980 _na     385_aa ATP phosphoribosyltransferase regulatory subunit
293 MAYX02000001.1 GCA014596365_00244 CDS open 237303-238106 _na     267_aa bamD Outer membrane protein assembly factor BamD
294 MAYX02000001.1 GCA014596365_00245 CDS open 238210-239229 _na     339_aa rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
295 MAYX02000001.1 GCA014596365_00246 CDS open 239310-240080 _na     256_aa pgeF peptidoglycan editing factor PgeF
296 MAYX02000001.1 GCA014596365_00247 CDS open 240201-240680 _na     159_aa lptE LPS-assembly lipoprotein LptE
297 MAYX02000001.1 GCA014596365_00248 CDS open 240680-241681 _na     333_aa holA DNA polymerase III subunit delta
298 MAYX02000001.1 GCA014596365_00249 CDS open 241828-242247 _na     139_aa Magnesium transporter
299 MAYX02000001.1 GCA014596365_00250 CDS open 242339-242863 _na     174_aa RDD family protein
300 MAYX02000001.1 GCA014596365_00251 CDS open 242958-244190 _na     410_aa beta-ketoacyl-ACP synthase
301 MAYX02000001.1 GCA014596365_00252 CDS open 244187-244915 _na     242_aa fabG 3-oxoacyl-ACP reductase FabG
302 MAYX02000001.1 GCA014596365_00253 CDS open 244981-245469 _na     162_aa FabA-like domain protein
303 MAYX02000001.1 GCA014596365_00254 CDS open 245580-246341 _na     253_aa Beta-ketoacyl synthase-like N-terminal domain-containing protein
304 MAYX02000001.1 GCA014596365_00255 CDS open 246338-247096 _na     252_aa Acyltransferase
305 MAYX02000001.1 GCA014596365_00256 CDS open 247093-247353 _na     86_aa Acyl carrier protein
306 MAYX02000001.1 GCA014596365_00257 CDS open 247366-247614 _na     82_aa acyl carrier protein
307 MAYX02000001.1 GCA014596365_00258 CDS open 247687-248226 _na     179_aa Integral membrane protein
308 MAYX02000001.1 GCA014596365_00259 CDS open 248266-249021 _na     251_aa Lipoprotein
309 MAYX02000001.1 GCA014596365_00260 CDS open 249037-250740 _na     567_aa 2-succinylbenzoate--CoA ligase
310 MAYX02000001.1 GCA014596365_00261 CDS open 250777-251865 _na     362_aa L-tyrosine C(3)-methyltransferase
311 MAYX02000001.1 GCA014596365_00262 CDS open 251957-252613 _na     218_aa Cytochrome b561 bacterial/Ni-hydrogenase domain-containing protein
312 MAYX02000001.1 GCA014596365_00263 CDS open 252667-253548 _na     293_aa ADP-dependent (S)-NAD(P)H-hydrate dehydratase
313 MAYX02000001.1 GCA014596365_00264 CDS open 253698-254645 _na     315_aa yfeH Transporter
314 MAYX02000001.1 GCA014596365_00265 CDS open 254743-255306 _na     187_aa Lipid/polyisoprenoid-binding YceI-like domain-containing protein
315 MAYX02000001.1 GCA014596365_00266 CDS open 255585-257444 _na     619_aa ilvD dihydroxy-acid dehydratase
316 MAYX02000001.1 GCA014596365_00267 CDS open 257514-257645 _na     43_aa Phage associated protein
317 MAYX02000001.1 GCA014596365_00268 CDS open 257713-259002 _na     429_aa Serine protease
318 MAYX02000001.1 GCA014596365_00269 CDS open 259079-259312 _na     77_aa Cytochrome b6
319 MAYX02000001.1 GCA014596365_00270 CDS open 259314-259745 _na     143_aa Gamma-butyrobetaine hydroxylase-like N-terminal domain-containing protein
320 MAYX02000001.1 GCA014596365_00271 CDS open 259826-260128 _na     100_aa MBL fold metallo-hydrolase
321 MAYX02000001.1 GCA014596365_00272 CDS open 260158-260895 _na     245_aa ubiE bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1%2C4-benzoquinol methylase UbiE
322 MAYX02000001.1 GCA014596365_00273 CDS open 261062-262192 _na     376_aa Putrescine-binding periplasmic protein
323 MAYX02000001.1 GCA014596365_00274 CDS open 262443-265337 _na     964_aa alaS alanine--tRNA ligase
324 MAYX02000001.1 GCA014596365_00275 CDS open 265898-266941 _na     347_aa parA ParA family protein
325 MAYX02000001.1 GCA014596365_00276 CDS open 266990-267442 _na     150_aa hypothetical protein
326 MAYX02000001.1 GCA014596365_00277 CDS open 267581-268438 _na     285_aa Aminomethyltransferase folate-binding domain-containing protein
327 MAYX02000001.1 GCA014596365_00278 CDS open 268561-269124 _na     187_aa Peptidyl-prolyl cis-trans isomerase
328 MAYX02000001.1 GCA014596365_00279 CDS open 269324-271582 _na     752_aa TonB-dependent receptor-like beta-barrel domain-containing protein
329 MAYX02000001.1 GCA014596365_00280 CDS open 271820-273586 _na     588_aa yddA ABC superfamily ATP binding cassette transporter%2C membrane protein
330 MAYX02000001.1 GCA014596365_00281 CDS open 273733-274458 _na     241_aa Glycosyltransferase 2-like domain-containing protein
331 MAYX02000001.1 GCA014596365_00282 CDS open 274463-275392 _na     309_aa Lipid A biosynthesis (KDO)2-(Lauroyl)-lipid IVA acyltransferase
332 MAYX02000001.1 GCA014596365_00283 CDS open 275419-275856 _na     145_aa Esterase
333 MAYX02000001.1 GCA014596365_00284 CDS open 275960-277339 _na     459_aa Multidrug-efflux transporter
334 MAYX02000001.1 GCA014596365_00285 CDS open 277410-278450 _na     346_aa murB UDP-N-acetylmuramate dehydrogenase
335 MAYX02000001.1 GCA014596365_00286 CDS open 278469-279110 _na     213_aa acrR TetR family transcriptional regulator
336 MAYX02000001.1 GCA014596365_00287 CDS open 279200-279973 _na     257_aa NAD dependent epimerase/dehydratase family protein
337 MAYX02000001.1 GCA014596365_00288 CDS open 280024-280596 _na     190_aa SCP2 domain-containing protein
338 MAYX02000001.1 GCA014596365_00289 CDS open 280624-281514 _na     296_aa NAD(+) kinase
339 MAYX02000001.1 GCA014596365_00290 CDS open 281539-281844 _na     101_aa Phage associated membrane protein
340 MAYX02000001.1 GCA014596365_00291 CDS open 281943-283076 _na     377_aa HD domain-containing protein
341 MAYX02000001.1 GCA014596365_00292 CDS open 283109-283912 _na     267_aa RNA ligase domain-containing protein
342 MAYX02000001.1 GCA014596365_00293 CDS open 283972-285273 _na     433_aa mpfA Polyamine export protein
343 MAYX02000001.1 GCA014596365_00294 CDS open 285375-286682 _na     435_aa rarA Replication-associated recombination protein A
344 MAYX02000001.1 GCA014596365_00295 CDS open 286834-287208 _na     124_aa Lipoprotein
345 MAYX02000001.1 GCA014596365_00296 CDS open 287295-288704 _na     469_aa thrC threonine synthase
346 MAYX02000001.1 GCA014596365_00297 CDS open 288933-290699 _na     588_aa msbA lipid A export permease/ATP-binding protein MsbA
347 MAYX02000001.1 GCA014596365_00298 CDS open 290785-291561 _na     258_aa fpr ferredoxin--NADP(+) reductase
348 MAYX02000001.1 GCA014596365_00299 CDS open 291633-293756 _na     707_aa uroporphyrinogen-III synthase
349 MAYX02000001.1 GCA014596365_00300 CDS open 293753-294976 _na     407_aa hemY HemY N-terminal domain-containing protein
350 MAYX02000001.1 GCA014596365_00301 CDS open 295111-296172 _na     353_aa hemE uroporphyrinogen decarboxylase
351 MAYX02000001.1 GCA014596365_00302 CDS open 296316-297809 _na     497_aa cls cardiolipin synthase
352 MAYX02000001.1 GCA014596365_00303 CDS open 298064-298795 _na     243_aa Outer membrane lipoprotein
353 MAYX02000001.1 GCA014596365_00304 CDS open 299102-299296 _na     64_aa Inner membrane protein YgaP-like transmembrane domain-containing protein
354 MAYX02000001.1 GCA014596365_00305 CDS open 299309-299830 _na     173_aa Rhodanese domain-containing protein
355 MAYX02000001.1 GCA014596365_00306 CDS open 299910-300212 _na     100_aa arsR Transcriptional regulator%2C ArsR family
356 MAYX02000001.1 GCA014596365_00307 CDS open 300304-300645 _na     113_aa Lipoprotein
357 MAYX02000001.1 GCA014596365_00308 CDS open 300737-301399 _na     220_aa IS1106 transposase
358 MAYX02000001.1 GCA014596365_00309 CDS open 301338-301826 _na     162_aa transposase
359 MAYX02000001.1 GCA014596365_00310 CDS open 302368-303021 _na     217_aa hypothetical protein
360 MAYX02000001.1 GCA014596365_00311 CDS open 303014-303442 _na     142_aa Transposase
361 MAYX02000001.1 GCA014596365_00312 CDS open 303414-303758 _na     114_aa hypothetical protein
362 MAYX02000001.1 GCA014596365_00313 CDS open 304002-307406 _na     1134_aa mfd transcription-repair coupling factor
363 MAYX02000001.1 GCA014596365_00314 CDS open 307537-308229 _na     230_aa VIT family protein
364 MAYX02000001.1 GCA014596365_00315 CDS open 308527-308673 _na     48_aa CCGSCS motif protein
365 MAYX02000001.1 GCA014596365_00316 CDS open 308865-309065 _na     66_aa Cytochrome C oxidase Cbb3
366 MAYX02000001.1 GCA014596365_00317 CDS open 309155-310552 _na     465_aa aspA aspartate ammonia-lyase
367 MAYX02000001.1 GCA014596365_00318 CDS open 310809-311471 _na     220_aa Nitroreductase family protein
368 MAYX02000001.1 GCA014596365_00319 CDS open 311651-313852 _na     733_aa Ferrienterobactin receptor
369 MAYX02000001.1 GCA014596365_00320 CDS open 314084-314302 _na     72_aa DUF465 domain-containing protein
370 MAYX02000001.1 GCA014596365_00321 CDS open 314523-314894 _na     123_aa DUF4376 domain-containing protein
371 MAYX02000001.1 GCA014596365_00322 CDS open 315028-316278 _na     416_aa glyA Serine hydroxymethyltransferase
372 MAYX02000001.1 GCA014596365_00323 CDS open 316350-317660 _na     436_aa cysN sulfate adenylyltransferase
373 MAYX02000001.1 GCA014596365_00324 CDS open 317790-318704 _na     304_aa yddG aromatic amino acid DMT transporter YddG
374 MAYX02000001.1 GCA014596365_00325 CDS open 318887-319312 _na     141_aa sarZ HTH-type transcriptional regulator SarZ
375 MAYX02000001.1 GCA014596365_00326 CDS open 319324-319488 _na     54_aa hypothetical protein
376 MAYX02000001.1 GCA014596365_00327 CDS open 319556-319825 _na     89_aa LITAF domain-containing protein
377 MAYX02000001.1 GCA014596365_00328 CDS open 319887-320021 _na     44_aa hypothetical protein
378 MAYX02000001.1 GCA014596365_00329 CDS open 320185-320871 _na     228_aa ABC transporter six-transmembrane domain-containing protein
379 MAYX02000001.1 GCA014596365_00330 CDS open 320899-321222 _na     107_aa Guanidinium exporter
380 MAYX02000001.1 GCA014596365_00331 CDS open 321413-323191 _na     592_aa assimilatory sulfite reductase (NADPH) flavoprotein subunit
381 MAYX02000001.1 GCA014596365_00332 CDS open 323250-323441 _na     63_aa Rubredoxin
382 MAYX02000001.1 GCA014596365_00333 CDS open 323443-324105 _na     220_aa Apea-like HEPN domain-containing protein
383 MAYX02000001.1 GCA014596365_00334 CDS open 324267-326375 _na     702_aa Dynamin N-terminal domain-containing protein
384 MAYX02000001.1 GCA014596365_00335 CDS open 326428-328686 _na     752_aa Dynamin N-terminal domain-containing protein
385 MAYX02000001.1 GCA014596365_00336 CDS open 328764-330443 _na     559_aa Dynamin N-terminal domain-containing protein
386 MAYX02000001.1 GCA014596365_00337 CDS open 330506-330715 _na     69_aa hypothetical protein
387 MAYX02000001.1 GCA014596365_00338 CDS open 330720-331619 _na     299_aa WYL domain-containing transcriptional regulator
388 MAYX02000001.1 GCA014596365_00339 CDS open 331851-332057 _na     68_aa hypothetical protein
389 MAYX02000001.1 GCA014596365_00340 CDS open 332290-332796 _na     168_aa hypothetical protein
390 MAYX02000001.1 GCA014596365_00341 CDS open 332887-333459 _na     190_aa Membrane lipoprotein
391 MAYX02000001.1 GCA014596365_00342 CDS open 333597-335354 _na     585_aa cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
392 MAYX02000001.1 GCA014596365_00343 CDS open 335524-336057 _na     177_aa ppa Inorganic pyrophosphatase
393 MAYX02000001.1 GCA014596365_00344 CDS open 336142-336606 _na     154_aa nudB dihydroneopterin triphosphate diphosphatase
394 MAYX02000001.1 GCA014596365_00345 CDS open 336743-337396 _na     217_aa Phosphoesterase
395 MAYX02000001.1 GCA014596365_00346 CDS open 337483-337926 _na     147_aa Ribose 5-phosphate isomerase B
396 MAYX02000001.1 GCA014596365_00347 CDS open 337959-339437 _na     492_aa T4 RNA ligase 1-like N-terminal domain-containing protein
397 MAYX02000001.1 GCA014596365_00348 CDS open 339526-341100 _na     524_aa 60 kDa SS-A/Ro ribonucleoprotein
398 MAYX02000001.1 GCA014596365_00350 CDS open 342229-343857 _na     542_aa rtcR RNA repair transcriptional activator RtcR
399 MAYX02000001.1 GCA014596365_00351 CDS open 344043-344870 _na     275_aa fghA S-formylglutathione hydrolase
400 MAYX02000001.1 GCA014596365_00352 CDS open 344879-346015 _na     378_aa frmA S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase
401 MAYX02000001.1 GCA014596365_00353 CDS open 352362-352655 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
402 MAYX02000001.1 GCA014596365_00354 CDS open 352730-353743 _na     337_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
403 MAYX02000001.1 GCA014596365_00355 CDS open 354100-355149 _na     349_aa Deacetylase sirtuin-type domain-containing protein
404 MAYX02000001.1 GCA014596365_00356 CDS open 355172-355825 _na     217_aa cas4 CRISPR-associated protein Cas4
405 MAYX02000001.1 GCA014596365_00357 CDS open 355832-356200 _na     122_aa Phage associated protein
406 MAYX02000001.1 GCA014596365_00358 CDS open 356227-357099 _na     290_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
407 MAYX02000001.1 GCA014596365_00359 CDS open 357111-358889 _na     592_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
408 MAYX02000001.1 GCA014596365_00360 CDS open 358886-359560 _na     224_aa cas5c type I-C CRISPR-associated protein Cas5c
409 MAYX02000001.1 GCA014596365_00361 CDS open 359655-360305 _na     216_aa DUF1524 domain-containing protein
410 MAYX02000001.1 GCA014596365_00362 CDS open 360302-360604 _na     100_aa hypothetical protein
411 MAYX02000001.1 GCA014596365_00363 CDS open 360654-361091 _na     145_aa hypothetical protein
412 MAYX02000001.1 GCA014596365_00364 CDS open 361088-361489 _na     133_aa DUF262 domain-containing protein
413 MAYX02000001.1 GCA014596365_00365 CDS open 361572-363860 _na     762_aa CRISPR-associated helicase/endonuclease Cas3
414 MAYX02000001.1 GCA014596365_00366 CDS open 363981-364910 _na     309_aa pip prolyl aminopeptidase
415 MAYX02000001.1 GCA014596365_00367 CDS open 365035-365469 _na     144_aa yciA acyl-CoA thioester hydrolase YciA
416 MAYX02000001.1 GCA014596365_00368 CDS open 365717-366508 _na     263_aa focA Formate/nitrite transporter
417 MAYX02000001.1 GCA014596365_00370 CDS open 366895-368418 _na     507_aa ttdA Fumarate hydratase class I
418 MAYX02000001.1 GCA014596365_00371 CDS open 369275-369913 _na     212_aa forC 2Fe-2S iron-sulfur cluster binding domain protein
419 MAYX02000001.1 GCA014596365_00372 CDS open 369913-371541 _na     542_aa nadB FAD-dependent oxidoreductase 2 FAD binding domain-containing protein
420 MAYX02000001.1 GCA014596365_00373 CDS open 371538-372791 _na     417_aa nuoF NADH dehydrogenase
421 MAYX02000001.1 GCA014596365_00374 CDS open 372882-374333 _na     483_aa citT Integral membrane transport protein
422 MAYX02000001.1 GCA014596365_00375 CDS open 374429-375841 _na     470_aa trkA Trk system potassium transporter TrkA
423 MAYX02000001.1 GCA014596365_00376 CDS open 375919-376779 _na     286_aa lgt prolipoprotein diacylglyceryl transferase
424 MAYX02000001.1 GCA014596365_00377 CDS open 376854-377984 _na     376_aa mpaA Peptidase M14 carboxypeptidase A domain-containing protein
425 MAYX02000001.1 GCA014596365_00378 CDS open 378159-379046 _na     295_aa Acetylglutamate kinase
426 MAYX02000001.1 GCA014596365_00379 CDS open 379109-379267 _na     52_aa hypothetical protein
427 MAYX02000001.1 GCA014596365_00380 CDS open 379308-380594 _na     428_aa eno phosphopyruvate hydratase
428 MAYX02000001.1 GCA014596365_00381 CDS open 380618-380893 _na     91_aa ftsB cell division protein FtsB
429 MAYX02000001.1 GCA014596365_00382 CDS open 380995-381486 _na     163_aa DUF1841 domain-containing protein
430 MAYX02000001.1 GCA014596365_00383 CDS open 381600-382307 _na     235_aa DUF541 domain-containing protein
431 MAYX02000001.1 GCA014596365_00384 CDS open 382396-382887 _na     163_aa greB transcription elongation factor GreB
432 MAYX02000001.1 GCA014596365_00385 CDS open 382962-384506 _na     514_aa purF amidophosphoribosyltransferase
433 MAYX02000001.1 GCA014596365_00386 CDS open 384659-385192 _na     177_aa cvpA CvpA family protein
434 MAYX02000001.1 GCA014596365_00387 CDS open 385185-386333 _na     382_aa ftsN cell division protein FtsN
435 MAYX02000001.1 GCA014596365_00388 CDS open 386347-387630 _na     427_aa folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
436 MAYX02000001.1 GCA014596365_00389 CDS open 387669-388121 _na     150_aa Transcriptional regulator
437 MAYX02000001.1 GCA014596365_00390 CDS open 388126-388485 _na     119_aa VacJ-like protein
438 MAYX02000001.1 GCA014596365_00391 CDS open 388549-389277 _na     242_aa glnQ Glutamine ABC transporter%2C ATP-binding protein GlnQ
439 MAYX02000001.1 GCA014596365_00392 CDS open 389280-389945 _na     221_aa Sel1 repeat family protein
440 MAYX02000001.1 GCA014596365_00393 CDS open 389961-390740 _na     259_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
441 MAYX02000001.1 GCA014596365_00394 CDS open 390829-391428 _na     199_aa dTTP/UTP pyrophosphatase
442 MAYX02000001.1 GCA014596365_00395 CDS open 391443-391982 _na     179_aa Gamma carbonic anhydrase family protein
443 MAYX02000001.1 GCA014596365_00396 CDS open 392221-393099 _na     292_aa eamA EamA domain-containing protein
444 MAYX02000001.1 GCA014596365_00397 CDS open 393577-394677 _na     366_aa surface lipoprotein assembly modifier
445 MAYX02000001.1 GCA014596365_00398 CDS open 394802-395821 _na     339_aa hypothetical protein
446 MAYX02000001.1 GCA014596365_00399 CDS open 396099-397034 _na     311_aa hypothetical protein
447 MAYX02000001.1 GCA014596365_00400 CDS open 397366-398385 _na     339_aa lepB signal peptidase I
448 MAYX02000001.1 GCA014596365_00401 CDS open 398385-400178 _na     597_aa lepA translation elongation factor 4
449 MAYX02000001.1 GCA014596365_00402 CDS open 400311-401012 _na     233_aa 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
450 MAYX02000001.1 GCA014596365_00403 CDS open 401217-402347 _na     376_aa PilT/PilU family type 4a pilus ATPase
451 MAYX02000001.1 GCA014596365_00404 CDS open 402421-403827 _na     468_aa dihydrolipoyl dehydrogenase
452 MAYX02000001.1 GCA014596365_00405 CDS open 404081-404818 _na     245_aa grxC Peroxiredoxin 2 family protein/glutaredoxin
453 MAYX02000001.1 GCA014596365_00406 CDS open 405007-405792 _na     261_aa 1-acyl-sn-glycerol-3-phosphate acyltransferase
454 MAYX02000001.1 GCA014596365_00407 CDS open 405857-406684 _na     275_aa mutM bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase
455 MAYX02000001.1 GCA014596365_00408 CDS open 406728-407387 _na     219_aa Methyltransferase type 11 domain-containing protein
456 MAYX02000001.1 GCA014596365_00409 CDS open 407544-409649 _na     701_aa Membrane-bound lytic murein transglycosylase D
457 MAYX02000001.1 GCA014596365_00410 CDS open 409818-411107 _na     429_aa Ferric reductase domain protein
458 MAYX02000001.1 GCA014596365_00411 CDS open 411483-412487 _na     334_aa CDP-6-deoxy-delta-3%2C4-glucoseen reductase
459 MAYX02000001.1 GCA014596365_00412 CDS open 412567-413997 _na     476_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
460 MAYX02000001.1 GCA014596365_00413 CDS open 414097-414717 _na     206_aa Glycine transporter domain-containing protein
461 MAYX02000001.1 GCA014596365_00414 CDS open 414816-416264 _na     482_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
462 MAYX02000001.1 GCA014596365_00415 CDS open 416415-416705 _na     96_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
463 MAYX02000001.1 GCA014596365_00416 CDS open 416931-417968 _na     345_aa mreB Cell shape-determining protein MreB
464 MAYX02000001.1 GCA014596365_00417 CDS open 417980-418822 _na     280_aa mreC rod shape-determining protein MreC
465 MAYX02000001.1 GCA014596365_00418 CDS open 418827-419327 _na     166_aa mreD rod shape-determining protein MreD
466 MAYX02000001.1 GCA014596365_00419 CDS open 419332-421380 _na     682_aa mrdA penicillin-binding protein 2
467 MAYX02000001.1 GCA014596365_00420 CDS open 421373-422521 _na     382_aa rodA rod shape-determining protein RodA
468 MAYX02000001.1 GCA014596365_00421 CDS open 422523-423182 _na     219_aa UPF0056 membrane protein
469 MAYX02000001.1 GCA014596365_00422 CDS open 423262-424605 _na     447_aa Succinate semialdehyde dehydrogenase [NAD(P)+] Sad
470 MAYX02000001.1 GCA014596365_00423 CDS open 424905-426185 _na     426_aa sfcA Malic enzyme
471 MAYX02000001.1 GCA014596365_00424 CDS open 426449-427075 _na     208_aa tmk dTMP kinase
472 MAYX02000001.1 GCA014596365_00425 CDS open 427143-428138 _na     331_aa Endolytic murein transglycosylase
473 MAYX02000001.1 GCA014596365_00426 CDS open 428254-428820 _na     188_aa ampD 1%2C6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD
474 MAYX02000001.1 GCA014596365_00427 CDS open 428999-430267 _na     422_aa zipA Cell division protein ZipA
475 MAYX02000001.1 GCA014596365_00428 CDS open 430408-432876 _na     822_aa ligA NAD-dependent DNA ligase LigA
476 MAYX02000001.1 GCA014596365_00429 CDS open 432988-433851 _na     287_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
477 MAYX02000001.1 GCA014596365_00430 CDS open 433906-435399 _na     497_aa Trk system potassium uptake protein
478 MAYX02000001.1 GCA014596365_00431 CDS open 435576-435851 _na     91_aa type B 50S ribosomal protein L31
479 MAYX02000001.1 GCA014596365_00432 CDS open 435851-435976 _na     41_aa ykgO type B 50S ribosomal protein L36
480 MAYX02000001.1 GCA014596365_00433 CDS open 436218-436610 _na     130_aa C-type lysozyme inhibitor domain-containing protein
481 MAYX02000001.1 GCA014596365_00434 CDS open 436673-437362 _na     229_aa hypothetical protein
482 MAYX02000001.1 GCA014596365_00435 CDS open 437447-440236 _na     929_aa ileS isoleucine--tRNA ligase
483 MAYX02000001.1 GCA014596365_00436 CDS open 440375-441301 _na     308_aa ribF bifunctional riboflavin kinase/FAD synthetase
484 MAYX02000001.1 GCA014596365_00437 CDS open 441424-441813 _na     129_aa Lipoprotein
485 MAYX02000001.1 GCA014596365_00438 CDS open 441975-442850 _na     291_aa DUF1275 domain-containing protein
486 MAYX02000001.1 GCA014596365_00439 CDS open 443069-443749 _na     226_aa OmpA-like domain-containing protein
487 MAYX02000001.1 GCA014596365_00440 CDS open 444089-445261 _na     390_aa nitronate monooxygenase family protein
488 MAYX02000001.1 GCA014596365_00441 CDS open 445383-446573 _na     396_aa dapC succinyldiaminopimelate transaminase
489 MAYX02000001.1 GCA014596365_00442 CDS open 446621-446791 _na     56_aa norV Rubredoxin
490 MAYX02000001.1 GCA014596365_00443 CDS open 446876-447967 _na     363_aa Acyl-CoA dehydrogenase%2C short-chain specific
491 MAYX02000001.1 GCA014596365_00444 CDS open 448093-448641 _na     182_aa yciW Putative carboxymuconolactone decarboxylase
492 MAYX02000001.1 GCA014596365_00445 CDS open 448791-449213 _na     140_aa Ribosomal protein P2
493 MAYX02000001.1 GCA014596365_00446 CDS open 449377-449832 _na     151_aa ruvX Holliday junction resolvase RuvX
494 MAYX02000001.1 GCA014596365_00447 CDS open 449825-450373 _na     182_aa YqgE/AlgH family protein
495 MAYX02000001.1 GCA014596365_00448 CDS open 450401-450946 _na     181_aa creA Protein CreA
496 MAYX02000001.1 GCA014596365_00449 CDS open 451121-452971 _na     616_aa Peptidase M23 domain-containing protein
497 MAYX02000001.1 GCA014596365_00450 CDS open 453187-454659 _na     490_aa Peptidase%2C S41 family
498 MAYX02000001.1 GCA014596365_00451 CDS open 454727-455206 _na     159_aa hypothetical protein
499 MAYX02000001.1 GCA014596365_00452 CDS open 455203-456615 _na     470_aa Z1 domain-containing protein
500 MAYX02000001.1 GCA014596365_00453 CDS open 456616-457656 _na     346_aa NgoFVII restriction endonuclease