HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406645.1)

Select a Genome:
BAKTA Annotations for GCA_021406645.1
Genome Selected: Porphyromonas gingivalis
ContigsBases CDSrRNA tmRNAtRNA
85 2265994 1894 6 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3916 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3916 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 JAEMBJ010000001.1 repeat_region open 78256-78830 CRISPR array with 9 repeats of length 36%2C consensus sequence GTTGGATCTACCCTCTATTCGAAGGGTACACACAAC and spacer length 30
2 JAEMBJ010000001.1 GCA021406645_01634 CDS open 694-1575 _na     293_aa fda fructose bisphosphate aldolase
3 JAEMBJ010000001.1 GCA021406645_01635 CDS open 1718-4225 _na     835_aa dAP2 Conserved domain protein
4 JAEMBJ010000001.1 GCA021406645_01636 CDS open 4261-5307 _na     348_aa selD selenide%2C water dikinase SelD
5 JAEMBJ010000001.1 GCA021406645_01637 CDS open 5304-5528 _na     74_aa Putative Se/S carrier protein-like domain-containing protein
6 JAEMBJ010000001.1 GCA021406645_01638 CDS open 5512-6642 _na     376_aa csdA Aminotransferase%2C class V
7 JAEMBJ010000001.1 GCA021406645_01639 CDS open 6779-8599 _na     606_aa afuC Alpha-1%2C3/4-fucosidase%2C putative
8 JAEMBJ010000001.1 GCA021406645_01640 CDS open 9043-11064 _na     673_aa tktA Transketolase
9 JAEMBJ010000001.1 GCA021406645_01641 CDS open 11151-11588 _na     145_aa rpiB ribose 5-phosphate isomerase B
10 JAEMBJ010000001.1 GCA021406645_01642 CDS open 11623-12060 _na     145_aa Membrane protease subunit
11 JAEMBJ010000001.1 GCA021406645_01643 CDS open 12288-14903 _na     871_aa sfcA NADP-dependent malic enzyme
12 JAEMBJ010000001.1 GCA021406645_01644 CDS open 14910-16238 _na     442_aa salY ABC transporter%2C permease protein%2C putative
13 JAEMBJ010000001.1 GCA021406645_01645 CDS open 16260-17636 _na     458_aa salY ABC transporter%2C permease protein%2C putative
14 JAEMBJ010000001.1 GCA021406645_01646 CDS open 17857-18528 _na     223_aa lolD ABC transporter%2C ATP-binding protein
15 JAEMBJ010000001.1 GCA021406645_01647 CDS open 18608-19858 _na     416_aa emrA Efflux transporter%2C MFP component%2C RND family
16 JAEMBJ010000001.1 GCA021406645_01648 CDS open 20122-21627 _na     501_aa tolC Transporter
17 JAEMBJ010000001.1 GCA021406645_01649 CDS open 21817-22038 _na     73_aa DUF2795 domain-containing protein
18 JAEMBJ010000001.1 GCA021406645_01650 CDS open 22121-23062 _na     313_aa porP type IX secretion system membrane protein PorP
19 JAEMBJ010000001.1 GCA021406645_01651 CDS open 23119-24594 _na     491_aa porK Por secretion system protein porK/gldK
20 JAEMBJ010000001.1 GCA021406645_01652 CDS open 24635-25564 _na     309_aa porL Gliding motility protein GldL-like N-terminal domain-containing protein
21 JAEMBJ010000001.1 GCA021406645_01653 CDS open 25568-27118 _na     516_aa porM Por secretion system protein porM/gldM
22 JAEMBJ010000001.1 GCA021406645_01654 CDS open 27127-28206 _na     359_aa gldN Gliding motility protein GldN
23 JAEMBJ010000001.1 GCA021406645_01655 CDS open 28367-28957 _na     196_aa chrA Chromate transporter
24 JAEMBJ010000001.1 GCA021406645_01656 CDS open 28976-29569 _na     197_aa chrA putative chromate transport protein
25 JAEMBJ010000001.1 GCA021406645_01657 CDS open 29707-30285 _na     192_aa zliS Secretion activator protein%2C putative
26 JAEMBJ010000001.1 GCA021406645_01658 CDS open 30883-31773 _na     296_aa wcaE Glycosyltransferase 2-like domain-containing protein
27 JAEMBJ010000001.1 GCA021406645_01659 CDS open 31789-32913 _na     374_aa dprA DNA-processing protein DprA
28 JAEMBJ010000001.1 GCA021406645_01660 CDS open 32906-36610 _na     1234_aa purL phosphoribosylformylglycinamidine synthase
29 JAEMBJ010000001.1 GCA021406645_01661 CDS open 37475-37762 _na     95_aa Partial transposase in ISPg3
30 JAEMBJ010000001.1 GCA021406645_01662 CDS open 37977-39269 _na     430_aa cpoB TPR domain protein
31 JAEMBJ010000001.1 GCA021406645_01663 CDS open 39626-40048 _na     140_aa rseC Positive regulator of sigma(E)%2C RseC/MucC
32 JAEMBJ010000001.1 GCA021406645_01664 CDS open 40058-40930 _na     290_aa rnfB Fe-S cluster domain-containing protein
33 JAEMBJ010000001.1 GCA021406645_01665 CDS open 40966-42297 _na     443_aa rsxC electron transport complex subunit RsxC
34 JAEMBJ010000001.1 GCA021406645_01666 CDS open 42313-43296 _na     327_aa rnfD Ion-translocating oxidoreductase complex subunit D
35 JAEMBJ010000001.1 GCA021406645_01667 CDS open 43293-43970 _na     225_aa rnfG Ion-translocating oxidoreductase complex subunit G
36 JAEMBJ010000001.1 GCA021406645_01668 CDS open 43967-44557 _na     196_aa rnfE Ion-translocating oxidoreductase complex subunit E
37 JAEMBJ010000001.1 GCA021406645_01669 CDS open 44582-45154 _na     190_aa rnfA Ion-translocating oxidoreductase complex subunit A
38 JAEMBJ010000001.1 GCA021406645_01670 CDS open 45375-46388 _na     337_aa apbE FAD:protein FMN transferase
39 JAEMBJ010000001.1 GCA021406645_01671 CDS open 46385-46924 _na     179_aa nfnB Nitroreductase family protein
40 JAEMBJ010000001.1 GCA021406645_01672 CDS open 46924-47877 _na     317_aa wcaA Glycosyl transferase%2C group 2 family protein
41 JAEMBJ010000001.1 GCA021406645_01673 CDS open 47874-48413 _na     179_aa DUF4199 domain-containing protein
42 JAEMBJ010000001.1 GCA021406645_01674 CDS open 49150-49467 _na     105_aa rplU 50S ribosomal protein L21
43 JAEMBJ010000001.1 GCA021406645_01675 CDS open 49495-49752 _na     85_aa rpmA 50S ribosomal protein L27
44 JAEMBJ010000001.1 GCA021406645_01676 CDS open 49852-51123 _na     423_aa serS serine--tRNA ligase
45 JAEMBJ010000001.1 GCA021406645_01677 CDS open 51136-53985 _na     949_aa Peptidase family M49
46 JAEMBJ010000001.1 GCA021406645_01678 CDS open 54409-54792 _na     127_aa DUF1573 domain-containing protein
47 JAEMBJ010000001.1 GCA021406645_01679 CDS open 54824-55912 _na     362_aa DUF1573 domain-containing protein
48 JAEMBJ010000001.1 GCA021406645_01680 CDS open 55988-57094 _na     368_aa meaB methylmalonyl Co-A mutase-associated GTPase MeaB
49 JAEMBJ010000001.1 GCA021406645_01681 CDS open 57123-58301 _na     392_aa gltP Serine/threonine transporter
50 JAEMBJ010000001.1 GCA021406645_01682 CDS open 58424-58753 _na     109_aa qdoI Cupin type-2 domain-containing protein
51 JAEMBJ010000001.1 GCA021406645_01683 CDS open 58954-60447 _na     497_aa hutH histidine ammonia-lyase
52 JAEMBJ010000001.1 GCA021406645_01684 CDS open 60450-61079 _na     209_aa ftcD Cyclodeaminase/cyclohydrolase domain-containing protein
53 JAEMBJ010000001.1 GCA021406645_01685 CDS open 61104-62231 _na     375_aa lomR Porin
54 JAEMBJ010000001.1 GCA021406645_01686 CDS open 62272-63426 _na     384_aa Nucleoside transporter/FeoB GTPase Gate domain-containing protein
55 JAEMBJ010000001.1 GCA021406645_01687 CDS open 63520-64770 _na     416_aa hutI imidazolonepropionase
56 JAEMBJ010000001.1 GCA021406645_01688 CDS open 64892-65794 _na     300_aa ftcD glutamate formimidoyltransferase
57 JAEMBJ010000001.1 GCA021406645_01689 CDS open 65835-66830 _na     331_aa Lipoprotein
58 JAEMBJ010000001.1 GCA021406645_01690 CDS open 66863-67381 _na     172_aa hupA DNA-binding protein%2C histone-like family
59 JAEMBJ010000001.1 GCA021406645_01691 CDS open 68057-70033 _na     658_aa rho transcription termination factor Rho
60 JAEMBJ010000001.1 GCA021406645_01692 CDS open 70261-71169 _na     302_aa rhaT EamA domain-containing protein
61 JAEMBJ010000001.1 GCA021406645_01693 CDS open 71180-72139 _na     319_aa wcaA Glycosyl transferase%2C group 2 family protein
62 JAEMBJ010000001.1 GCA021406645_01694 CDS open 72192-73094 _na     300_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
63 JAEMBJ010000001.1 GCA021406645_01695 CDS open 73114-73683 _na     189_aa Plasmid pRiA4b Orf3-like domain-containing protein
64 JAEMBJ010000001.1 GCA021406645_01696 CDS open 73971-77498 _na     1175_aa cas13b type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b
65 JAEMBJ010000001.1 GCA021406645_01697 CDS open 77511-78047 _na     178_aa csx28 CRISPR-associated protein Csx28
66 JAEMBJ010000001.1 GCA021406645_01698 CDS open 79319-79552 _na     77_aa hypothetical protein
67 JAEMBJ010000001.1 GCA021406645_01699 CDS open 79646-80827 _na     393_aa megL methionine gamma-lyase
68 JAEMBJ010000001.1 GCA021406645_01700 CDS open 81008-82477 _na     489_aa cpdA Metallophosphoesterase family protein
69 JAEMBJ010000001.1 GCA021406645_01701 CDS open 82480-83073 _na     197_aa Histidine kinase
70 JAEMBJ010000001.1 GCA021406645_01702 CDS open 83174-83779 _na     201_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
71 JAEMBJ010000001.1 GCA021406645_01703 CDS open 83789-84817 _na     342_aa galE UDP-glucose 4-epimerase GalE
72 JAEMBJ010000001.1 GCA021406645_01704 CDS open 84860-86956 _na     698_aa recG ATP-dependent DNA helicase RecG
73 JAEMBJ010000001.1 GCA021406645_01705 CDS open 86974-87726 _na     250_aa ycjU Hydrolase%2C haloacid dehalogenase-like family
74 JAEMBJ010000001.1 GCA021406645_01706 CDS open 87821-89275 _na     484_aa yopM Internalin
75 JAEMBJ010000001.1 GCA021406645_01707 CDS open 89703-91283 _na     526_aa nanH exo-alpha-sialidase
76 JAEMBJ010000001.1 GCA021406645_01708 CDS open 91230-91358 _na     42_aa hypothetical protein
77 JAEMBJ010000001.1 GCA021406645_01709 CDS open 92219-93145 _na     308_aa hypothetical protein
78 JAEMBJ010000001.1 GCA021406645_01710 CDS open 93174-93911 _na     245_aa sIMPL SIMPL domain-containing protein
79 JAEMBJ010000001.1 GCA021406645_01711 CDS open 93958-94872 _na     304_aa pyrB aspartate carbamoyltransferase
80 JAEMBJ010000001.1 GCA021406645_01712 CDS open 94900-95340 _na     146_aa pyrI aspartate carbamoyltransferase regulatory subunit
81 JAEMBJ010000001.1 GCA021406645_01713 CDS open 95369-95956 _na     195_aa rutF Putative flavoredoxin
82 JAEMBJ010000001.1 GCA021406645_01714 CDS open 96000-96590 _na     196_aa lemA LemA protein
83 JAEMBJ010000001.1 GCA021406645_01715 CDS open 96612-97919 _na     435_aa rPS27A TPM domain-containing protein
84 JAEMBJ010000001.1 GCA021406645_01716 CDS open 97927-99987 _na     686_aa TonB-dependent receptor
85 JAEMBJ010000001.1 GCA021406645_01717 CDS open 99994-100815 _na     273_aa mltF Solute-binding protein family 3/N-terminal domain-containing protein
86 JAEMBJ010000001.1 GCA021406645_01718 CDS open 100878-102083 _na     401_aa rlmK PUA domain-containing protein
87 JAEMBJ010000001.1 GCA021406645_01719 CDS open 102080-102682 _na     200_aa rnd 3'-5' exonuclease domain protein
88 JAEMBJ010000001.1 GCA021406645_01720 CDS open 102723-103283 _na     186_aa DUF5063 domain-containing protein
89 JAEMBJ010000001.1 GCA021406645_01721 CDS open 103762-105696 _na     644_aa gyrB DNA topoisomerase (ATP-hydrolyzing)
90 JAEMBJ010000001.1 GCA021406645_01722 CDS open 105727-106188 _na     153_aa coaD pantetheine-phosphate adenylyltransferase
91 JAEMBJ010000001.1 GCA021406645_01723 CDS open 107228-107896 _na     222_aa Outer membrane protein beta-barrel domain-containing protein
92 JAEMBJ010000001.1 GCA021406645_01724 CDS open 108457-108912 _na     151_aa rplM 50S ribosomal protein L13
93 JAEMBJ010000001.1 GCA021406645_01725 CDS open 108922-109308 _na     128_aa rpsI 30S ribosomal protein S9
94 JAEMBJ010000001.1 GCA021406645_01726 CDS open 109443-110288 _na     281_aa rpsB 30S ribosomal protein S2
95 JAEMBJ010000001.1 GCA021406645_01727 CDS open 110427-111251 _na     274_aa tsf translation elongation factor Ts
96 JAEMBJ010000001.1 GCA021406645_01728 CDS open 111604-113640 _na     678_aa uvrB excinuclease ABC subunit UvrB
97 JAEMBJ010000001.1 GCA021406645_01729 CDS open 113637-115157 _na     506_aa nhaP2 potassium/proton antiporter
98 JAEMBJ010000001.1 GCA021406645_01730 CDS open 115634-116953 _na     439_aa rseP RIP metalloprotease RseP
99 JAEMBJ010000001.1 GCA021406645_01731 CDS open 116963-119485 _na     840_aa rqcU endonuclease MutS2
100 JAEMBJ010000001.1 GCA021406645_01732 CDS open 119647-119838 _na     63_aa rpsU 30S ribosomal protein S21
101 JAEMBJ010000001.1 GCA021406645_01733 CDS open 119915-121120 _na     401_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
102 JAEMBJ010000001.1 GCA021406645_01736 CDS open 121514-122701 _na     395_aa tuf elongation factor Tu
103 JAEMBJ010000001.1 GCA021406645_01738 CDS open 122860-123063 _na     67_aa secE preprotein translocase subunit SecE
104 JAEMBJ010000001.1 GCA021406645_01739 CDS open 123085-123624 _na     179_aa nusG transcription termination/antitermination protein NusG
105 JAEMBJ010000001.1 GCA021406645_01740 CDS open 123693-124130 _na     145_aa rplK 50S ribosomal protein L11
106 JAEMBJ010000001.1 GCA021406645_01741 CDS open 124151-124849 _na     232_aa rplA 50S ribosomal protein L1
107 JAEMBJ010000001.1 GCA021406645_01742 CDS open 124865-125389 _na     174_aa rplJ 50S ribosomal protein L10
108 JAEMBJ010000001.1 GCA021406645_01743 CDS open 125432-125809 _na     125_aa rplL 50S ribosomal protein L7/L12
109 JAEMBJ010000001.1 GCA021406645_01744 CDS open 125921-129730 _na     1269_aa rpoB DNA-directed RNA polymerase subunit beta
110 JAEMBJ010000001.1 GCA021406645_01745 CDS open 129796-134097 _na     1433_aa rpoC DNA-directed RNA polymerase subunit beta'
111 JAEMBJ010000001.1 GCA021406645_01746 CDS open 134386-135084 _na     232_aa crp Transcriptional regulator%2C Crp/Fnr family
112 JAEMBJ010000001.1 GCA021406645_01747 CDS open 135132-135422 _na     96_aa DUF721 domain-containing protein
113 JAEMBJ010000001.1 GCA021406645_01748 CDS open 135436-136530 _na     364_aa recF DNA replication/repair protein RecF
114 JAEMBJ010000001.1 GCA021406645_01749 CDS open 136527-137057 _na     176_aa gldH Gliding motility protein GldH
115 JAEMBJ010000001.1 GCA021406645_01750 CDS open 137065-138477 _na     470_aa yaaT PSP1 C-terminal domain-containing protein
116 JAEMBJ010000001.1 GCA021406645_01751 CDS open 138585-140126 _na     513_aa rny ribonuclease Y
117 JAEMBJ010000001.1 GCA021406645_01752 CDS open 140273-140581 _na     102_aa zapA Cell division protein ZapA
118 JAEMBJ010000001.1 GCA021406645_01753 CDS open 140588-140926 _na     112_aa Phenylalanyl-tRNA synthetase subunit beta
119 JAEMBJ010000001.1 GCA021406645_01754 CDS open 141958-142272 _na     104_aa hypothetical protein
120 JAEMBJ010000001.1 GCA021406645_01755 CDS open 142316-143137 _na     273_aa Outer membrane protein beta-barrel domain-containing protein
121 JAEMBJ010000001.1 GCA021406645_01756 CDS open 143504-146269 _na     921_aa cTD-A Cleaved adhesin domain-containing protein
122 JAEMBJ010000001.1 GCA021406645_01757 CDS open 146527-148383 _na     618_aa mutL DNA mismatch repair endonuclease MutL
123 JAEMBJ010000001.1 GCA021406645_01758 CDS open 148380-148724 _na     114_aa Ubiquitin carboxyl-hydrolase
124 JAEMBJ010000001.1 GCA021406645_01759 CDS open 148715-150595 _na     626_aa Organic solvent tolerance-like N-terminal domain-containing protein
125 JAEMBJ010000001.1 GCA021406645_01760 CDS open 150657-152024 _na     455_aa surA Peptidylprolyl isomerase
126 JAEMBJ010000001.1 GCA021406645_01761 CDS open 152076-154253 _na     725_aa recQ DNA helicase RecQ
127 JAEMBJ010000001.1 GCA021406645_01762 CDS open 154332-155567 _na     411_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
128 JAEMBJ010000001.1 GCA021406645_01763 CDS open 155604-156290 _na     228_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
129 JAEMBJ010000001.1 GCA021406645_01764 CDS open 156645-157505 _na     286_aa Putative auto-transporter adhesin head GIN domain-containing protein
130 JAEMBJ010000001.1 GCA021406645_01765 CDS open 157780-158637 _na     285_aa Putative auto-transporter adhesin head GIN domain-containing protein
131 JAEMBJ010000001.1 GCA021406645_01766 CDS open 158896-159081 _na     61_aa hypothetical protein
132 JAEMBJ010000001.1 GCA021406645_01767 CDS open 159144-159488 _na     114_aa DUF4878 domain-containing protein
133 JAEMBJ010000001.1 GCA021406645_01768 CDS open 159469-160128 _na     219_aa Orthopoxovirus protein%2C PF05708 family
134 JAEMBJ010000001.1 GCA021406645_01769 CDS open 160165-161004 _na     279_aa frmB Alpha/beta hydrolase family protein
135 JAEMBJ010000001.1 GCA021406645_01770 CDS open 161337-164504 _na     1055_aa RND transporter%2C HAE1/HME family%2C permease protein
136 JAEMBJ010000001.1 GCA021406645_01771 CDS open 164544-166034 _na     496_aa Putative ABC transport system exported protein
137 JAEMBJ010000001.1 GCA021406645_01772 CDS open 166012-169083 _na     1023_aa Putative cation efflux system
138 JAEMBJ010000001.1 GCA021406645_01773 CDS open 169118-170218 _na     366_aa putative cation efflux system protein
139 JAEMBJ010000001.1 GCA021406645_01774 CDS open 170237-171277 _na     346_aa Lipoprotein
140 JAEMBJ010000001.1 GCA021406645_01775 CDS open 171431-172483 _na     350_aa Lipoprotein
141 JAEMBJ010000001.1 GCA021406645_01776 CDS open 172588-172893 _na     101_aa hypothetical protein
142 JAEMBJ010000001.1 GCA021406645_01777 CDS open 172890-173807 _na     305_aa DUF1573 domain-containing protein
143 JAEMBJ010000001.1 GCA021406645_01778 CDS open 173882-174952 _na     356_aa Lipoprotein
144 JAEMBJ010000001.1 GCA021406645_01779 CDS open 175255-175983 _na     242_aa Putative carbonic anhydrase
145 JAEMBJ010000001.1 GCA021406645_01634 gene open 694-1575 fda
146 JAEMBJ010000001.1 GCA021406645_01635 gene open 1718-4225 dAP2
147 JAEMBJ010000001.1 GCA021406645_01636 gene open 4261-5307 selD
148 JAEMBJ010000001.1 GCA021406645_01637 gene open 5304-5528
149 JAEMBJ010000001.1 GCA021406645_01638 gene open 5512-6642 csdA
150 JAEMBJ010000001.1 GCA021406645_01639 gene open 6779-8599 afuC
151 JAEMBJ010000001.1 GCA021406645_01640 gene open 9043-11064 tktA
152 JAEMBJ010000001.1 GCA021406645_01641 gene open 11151-11588 rpiB
153 JAEMBJ010000001.1 GCA021406645_01642 gene open 11623-12060
154 JAEMBJ010000001.1 GCA021406645_01643 gene open 12288-14903 sfcA
155 JAEMBJ010000001.1 GCA021406645_01644 gene open 14910-16238 salY
156 JAEMBJ010000001.1 GCA021406645_01645 gene open 16260-17636 salY
157 JAEMBJ010000001.1 GCA021406645_01646 gene open 17857-18528 lolD
158 JAEMBJ010000001.1 GCA021406645_01647 gene open 18608-19858 emrA
159 JAEMBJ010000001.1 GCA021406645_01648 gene open 20122-21627 tolC
160 JAEMBJ010000001.1 GCA021406645_01649 gene open 21817-22038
161 JAEMBJ010000001.1 GCA021406645_01650 gene open 22121-23062 porP
162 JAEMBJ010000001.1 GCA021406645_01651 gene open 23119-24594 porK
163 JAEMBJ010000001.1 GCA021406645_01652 gene open 24635-25564 porL
164 JAEMBJ010000001.1 GCA021406645_01653 gene open 25568-27118 porM
165 JAEMBJ010000001.1 GCA021406645_01654 gene open 27127-28206 gldN
166 JAEMBJ010000001.1 GCA021406645_01655 gene open 28367-28957 chrA
167 JAEMBJ010000001.1 GCA021406645_01656 gene open 28976-29569 chrA
168 JAEMBJ010000001.1 GCA021406645_01657 gene open 29707-30285 zliS
169 JAEMBJ010000001.1 GCA021406645_01658 gene open 30883-31773 wcaE
170 JAEMBJ010000001.1 GCA021406645_01659 gene open 31789-32913 dprA
171 JAEMBJ010000001.1 GCA021406645_01660 gene open 32906-36610 purL
172 JAEMBJ010000001.1 GCA021406645_01661 gene open 37475-37762
173 JAEMBJ010000001.1 GCA021406645_01662 gene open 37977-39269 cpoB
174 JAEMBJ010000001.1 GCA021406645_01663 gene open 39626-40048 rseC
175 JAEMBJ010000001.1 GCA021406645_01664 gene open 40058-40930 rnfB
176 JAEMBJ010000001.1 GCA021406645_01665 gene open 40966-42297 rsxC
177 JAEMBJ010000001.1 GCA021406645_01666 gene open 42313-43296 rnfD
178 JAEMBJ010000001.1 GCA021406645_01667 gene open 43293-43970 rnfG
179 JAEMBJ010000001.1 GCA021406645_01668 gene open 43967-44557 rnfE
180 JAEMBJ010000001.1 GCA021406645_01669 gene open 44582-45154 rnfA
181 JAEMBJ010000001.1 GCA021406645_01670 gene open 45375-46388 apbE
182 JAEMBJ010000001.1 GCA021406645_01671 gene open 46385-46924 nfnB
183 JAEMBJ010000001.1 GCA021406645_01672 gene open 46924-47877 wcaA
184 JAEMBJ010000001.1 GCA021406645_01673 gene open 47874-48413
185 JAEMBJ010000001.1 GCA021406645_01674 gene open 49150-49467 rplU
186 JAEMBJ010000001.1 GCA021406645_01675 gene open 49495-49752 rpmA
187 JAEMBJ010000001.1 GCA021406645_01676 gene open 49852-51123 serS
188 JAEMBJ010000001.1 GCA021406645_01677 gene open 51136-53985
189 JAEMBJ010000001.1 GCA021406645_01678 gene open 54409-54792
190 JAEMBJ010000001.1 GCA021406645_01679 gene open 54824-55912
191 JAEMBJ010000001.1 GCA021406645_01680 gene open 55988-57094 meaB
192 JAEMBJ010000001.1 GCA021406645_01681 gene open 57123-58301 gltP
193 JAEMBJ010000001.1 GCA021406645_01682 gene open 58424-58753 qdoI
194 JAEMBJ010000001.1 GCA021406645_01683 gene open 58954-60447 hutH
195 JAEMBJ010000001.1 GCA021406645_01684 gene open 60450-61079 ftcD
196 JAEMBJ010000001.1 GCA021406645_01685 gene open 61104-62231 lomR
197 JAEMBJ010000001.1 GCA021406645_01686 gene open 62272-63426
198 JAEMBJ010000001.1 GCA021406645_01687 gene open 63520-64770 hutI
199 JAEMBJ010000001.1 GCA021406645_01688 gene open 64892-65794 ftcD
200 JAEMBJ010000001.1 GCA021406645_01689 gene open 65835-66830
201 JAEMBJ010000001.1 GCA021406645_01690 gene open 66863-67381 hupA
202 JAEMBJ010000001.1 GCA021406645_01691 gene open 68057-70033 rho
203 JAEMBJ010000001.1 GCA021406645_01692 gene open 70261-71169 rhaT
204 JAEMBJ010000001.1 GCA021406645_01693 gene open 71180-72139 wcaA
205 JAEMBJ010000001.1 GCA021406645_01694 gene open 72192-73094 miaA
206 JAEMBJ010000001.1 GCA021406645_01695 gene open 73114-73683
207 JAEMBJ010000001.1 GCA021406645_01696 gene open 73971-77498 cas13b
208 JAEMBJ010000001.1 GCA021406645_01697 gene open 77511-78047 csx28
209 JAEMBJ010000001.1 GCA021406645_01698 gene open 79319-79552
210 JAEMBJ010000001.1 GCA021406645_01699 gene open 79646-80827 megL
211 JAEMBJ010000001.1 GCA021406645_01700 gene open 81008-82477 cpdA
212 JAEMBJ010000001.1 GCA021406645_01701 gene open 82480-83073
213 JAEMBJ010000001.1 GCA021406645_01702 gene open 83174-83779 yihA
214 JAEMBJ010000001.1 GCA021406645_01703 gene open 83789-84817 galE
215 JAEMBJ010000001.1 GCA021406645_01704 gene open 84860-86956 recG
216 JAEMBJ010000001.1 GCA021406645_01705 gene open 86974-87726 ycjU
217 JAEMBJ010000001.1 GCA021406645_01706 gene open 87821-89275 yopM
218 JAEMBJ010000001.1 GCA021406645_01707 gene open 89703-91283 nanH
219 JAEMBJ010000001.1 GCA021406645_01708 gene open 91230-91358
220 JAEMBJ010000001.1 GCA021406645_01709 gene open 92219-93145
221 JAEMBJ010000001.1 GCA021406645_01710 gene open 93174-93911 sIMPL
222 JAEMBJ010000001.1 GCA021406645_01711 gene open 93958-94872 pyrB
223 JAEMBJ010000001.1 GCA021406645_01712 gene open 94900-95340 pyrI
224 JAEMBJ010000001.1 GCA021406645_01713 gene open 95369-95956 rutF
225 JAEMBJ010000001.1 GCA021406645_01714 gene open 96000-96590 lemA
226 JAEMBJ010000001.1 GCA021406645_01715 gene open 96612-97919 rPS27A
227 JAEMBJ010000001.1 GCA021406645_01716 gene open 97927-99987
228 JAEMBJ010000001.1 GCA021406645_01717 gene open 99994-100815 mltF
229 JAEMBJ010000001.1 GCA021406645_01718 gene open 100878-102083 rlmK
230 JAEMBJ010000001.1 GCA021406645_01719 gene open 102080-102682 rnd
231 JAEMBJ010000001.1 GCA021406645_01720 gene open 102723-103283
232 JAEMBJ010000001.1 GCA021406645_01721 gene open 103762-105696 gyrB
233 JAEMBJ010000001.1 GCA021406645_01722 gene open 105727-106188 coaD
234 JAEMBJ010000001.1 GCA021406645_01723 gene open 107228-107896
235 JAEMBJ010000001.1 GCA021406645_01724 gene open 108457-108912 rplM
236 JAEMBJ010000001.1 GCA021406645_01725 gene open 108922-109308 rpsI
237 JAEMBJ010000001.1 GCA021406645_01726 gene open 109443-110288 rpsB
238 JAEMBJ010000001.1 GCA021406645_01727 gene open 110427-111251 tsf
239 JAEMBJ010000001.1 GCA021406645_01728 gene open 111604-113640 uvrB
240 JAEMBJ010000001.1 GCA021406645_01729 gene open 113637-115157 nhaP2
241 JAEMBJ010000001.1 GCA021406645_01730 gene open 115634-116953 rseP
242 JAEMBJ010000001.1 GCA021406645_01731 gene open 116963-119485 rqcU
243 JAEMBJ010000001.1 GCA021406645_01732 gene open 119647-119838 rpsU
244 JAEMBJ010000001.1 GCA021406645_01733 gene open 119915-121120 hpf
245 JAEMBJ010000001.1 GCA021406645_01736 gene open 121514-122701 tuf
246 JAEMBJ010000001.1 GCA021406645_01738 gene open 122860-123063 secE
247 JAEMBJ010000001.1 GCA021406645_01739 gene open 123085-123624 nusG
248 JAEMBJ010000001.1 GCA021406645_01740 gene open 123693-124130 rplK
249 JAEMBJ010000001.1 GCA021406645_01741 gene open 124151-124849 rplA
250 JAEMBJ010000001.1 GCA021406645_01742 gene open 124865-125389 rplJ
251 JAEMBJ010000001.1 GCA021406645_01743 gene open 125432-125809 rplL
252 JAEMBJ010000001.1 GCA021406645_01744 gene open 125921-129730 rpoB
253 JAEMBJ010000001.1 GCA021406645_01745 gene open 129796-134097 rpoC
254 JAEMBJ010000001.1 GCA021406645_01746 gene open 134386-135084 crp
255 JAEMBJ010000001.1 GCA021406645_01747 gene open 135132-135422
256 JAEMBJ010000001.1 GCA021406645_01748 gene open 135436-136530 recF
257 JAEMBJ010000001.1 GCA021406645_01749 gene open 136527-137057 gldH
258 JAEMBJ010000001.1 GCA021406645_01750 gene open 137065-138477 yaaT
259 JAEMBJ010000001.1 GCA021406645_01751 gene open 138585-140126 rny
260 JAEMBJ010000001.1 GCA021406645_01752 gene open 140273-140581 zapA
261 JAEMBJ010000001.1 GCA021406645_01753 gene open 140588-140926
262 JAEMBJ010000001.1 GCA021406645_01754 gene open 141958-142272
263 JAEMBJ010000001.1 GCA021406645_01755 gene open 142316-143137
264 JAEMBJ010000001.1 GCA021406645_01756 gene open 143504-146269 cTD-A
265 JAEMBJ010000001.1 GCA021406645_01757 gene open 146527-148383 mutL
266 JAEMBJ010000001.1 GCA021406645_01758 gene open 148380-148724
267 JAEMBJ010000001.1 GCA021406645_01759 gene open 148715-150595
268 JAEMBJ010000001.1 GCA021406645_01760 gene open 150657-152024 surA
269 JAEMBJ010000001.1 GCA021406645_01761 gene open 152076-154253 recQ
270 JAEMBJ010000001.1 GCA021406645_01762 gene open 154332-155567 clpX
271 JAEMBJ010000001.1 GCA021406645_01763 gene open 155604-156290 clpP
272 JAEMBJ010000001.1 GCA021406645_01764 gene open 156645-157505
273 JAEMBJ010000001.1 GCA021406645_01765 gene open 157780-158637
274 JAEMBJ010000001.1 GCA021406645_01766 gene open 158896-159081
275 JAEMBJ010000001.1 GCA021406645_01767 gene open 159144-159488
276 JAEMBJ010000001.1 GCA021406645_01768 gene open 159469-160128
277 JAEMBJ010000001.1 GCA021406645_01769 gene open 160165-161004 frmB
278 JAEMBJ010000001.1 GCA021406645_01770 gene open 161337-164504
279 JAEMBJ010000001.1 GCA021406645_01771 gene open 164544-166034
280 JAEMBJ010000001.1 GCA021406645_01772 gene open 166012-169083
281 JAEMBJ010000001.1 GCA021406645_01773 gene open 169118-170218
282 JAEMBJ010000001.1 GCA021406645_01774 gene open 170237-171277
283 JAEMBJ010000001.1 GCA021406645_01775 gene open 171431-172483
284 JAEMBJ010000001.1 GCA021406645_01776 gene open 172588-172893
285 JAEMBJ010000001.1 GCA021406645_01777 gene open 172890-173807
286 JAEMBJ010000001.1 GCA021406645_01778 gene open 173882-174952
287 JAEMBJ010000001.1 GCA021406645_01779 gene open 175255-175983
288 JAEMBJ010000001.1 GCA021406645_01734 gene open 121260-121342 trnY
289 JAEMBJ010000001.1 GCA021406645_01735 gene open 121375-121446 trnT
290 JAEMBJ010000001.1 GCA021406645_01737 gene open 122772-122844 trnW
291 JAEMBJ010000001.1 GCA021406645_01734 tRNA open 121260-121342 trnY tRNA-Tyr(gta)
292 JAEMBJ010000001.1 GCA021406645_01735 tRNA open 121375-121446 trnT tRNA-Thr(ggt)
293 JAEMBJ010000001.1 GCA021406645_01737 tRNA open 122772-122844 trnW tRNA-Trp(cca)
294 JAEMBJ010000002.1 GCA021406645_01780 CDS open 81-170 _na     29_aa hypothetical protein
295 JAEMBJ010000002.1 GCA021406645_01781 CDS open 184-327 _na     47_aa hypothetical protein
296 JAEMBJ010000002.1 GCA021406645_01782 CDS open 398-520 _na     40_aa hypothetical protein
297 JAEMBJ010000002.1 GCA021406645_01783 CDS open 644-2716 _na     690_aa topA DNA topoisomerase
298 JAEMBJ010000002.1 GCA021406645_01784 CDS open 3274-3870 _na     198_aa traJ Conjugative transposon TraJ C-terminal domain-containing protein
299 JAEMBJ010000002.1 GCA021406645_01785 CDS open 4101-5207 _na     368_aa rfe Glycosyl transferase family 4
300 JAEMBJ010000002.1 GCA021406645_01786 CDS open 5470-6660 _na     396_aa wecC UDP-N-acetyl-D-mannosamine dehydrogenase
301 JAEMBJ010000002.1 GCA021406645_01787 CDS open 6946-7932 _na     328_aa Glycosyltransferase 2-like domain-containing protein
302 JAEMBJ010000002.1 GCA021406645_01788 CDS open 7902-9107 _na     401_aa epsG EpsG family protein
303 JAEMBJ010000002.1 GCA021406645_01789 CDS open 9117-10175 _na     352_aa glycosyltransferase family 4 protein
304 JAEMBJ010000002.1 GCA021406645_01790 CDS open 10188-11522 _na     444_aa Coenzyme F390 synthetase
305 JAEMBJ010000002.1 GCA021406645_01791 CDS open 11859-12338 _na     159_aa Putative DNA-binding protein
306 JAEMBJ010000002.1 GCA021406645_01792 CDS open 12467-12904 _na     145_aa cysE Serine acetyltransferase
307 JAEMBJ010000002.1 GCA021406645_01793 CDS open 12898-14082 _na     394_aa Delta-aminolevulinic acid dehydratase
308 JAEMBJ010000002.1 GCA021406645_01794 CDS open 14103-15143 _na     346_aa Glycosyltransferase 2-like domain-containing protein
309 JAEMBJ010000002.1 GCA021406645_01795 CDS open 15185-15883 _na     232_aa wecG Glycosyl transferase
310 JAEMBJ010000002.1 GCA021406645_01796 CDS open 15901-17046 _na     381_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
311 JAEMBJ010000002.1 GCA021406645_01797 CDS open 17352-17618 _na     88_aa hupA DNA-binding protein HU
312 JAEMBJ010000002.1 GCA021406645_01798 CDS open 17820-18389 _na     189_aa Outer membrane protein beta-barrel domain-containing protein
313 JAEMBJ010000002.1 GCA021406645_01799 CDS open 18448-19068 _na     206_aa yIH1 Impact N-terminal domain-containing protein
314 JAEMBJ010000002.1 GCA021406645_01800 CDS open 19072-19620 _na     182_aa DUF4924 domain-containing protein
315 JAEMBJ010000002.1 GCA021406645_01801 CDS open 19617-20852 _na     411_aa ataC Putative type I phosphodiesterase-nucleotide pyrophosphatase
316 JAEMBJ010000002.1 GCA021406645_01802 CDS open 21147-22472 _na     441_aa Ferrochelatase
317 JAEMBJ010000002.1 GCA021406645_01803 CDS open 22479-23453 _na     324_aa bud32 Lipopolysaccharide kinase
318 JAEMBJ010000002.1 GCA021406645_01804 CDS open 23470-24618 _na     382_aa rfaB Mannosyltransferase
319 JAEMBJ010000002.1 GCA021406645_01805 CDS open 24649-24774 _na     41_aa hypothetical protein
320 JAEMBJ010000002.1 GCA021406645_01806 CDS open 24756-25502 _na     248_aa gpmA 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase
321 JAEMBJ010000002.1 GCA021406645_01807 CDS open 25786-27096 _na     436_aa CDP-Glycerol:Poly(Glycerophosphate) glycerophosphotransferase
322 JAEMBJ010000002.1 GCA021406645_01808 CDS open 27093-28598 _na     501_aa rfbX Polysaccharide biosynthesis protein C-terminal domain-containing protein
323 JAEMBJ010000002.1 GCA021406645_01809 CDS open 28617-29969 _na     450_aa mgtE magnesium transporter
324 JAEMBJ010000002.1 GCA021406645_01810 CDS open 30000-30773 _na     257_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
325 JAEMBJ010000002.1 GCA021406645_01811 CDS open 30934-31956 _na     340_aa Dolichol-P-glucose synthetase
326 JAEMBJ010000002.1 GCA021406645_01812 CDS open 31987-33441 _na     484_aa pepD2 Aminoacyl-histidine dipeptidase
327 JAEMBJ010000002.1 GCA021406645_01813 CDS open 33556-34437 _na     293_aa fabD ACP S-malonyltransferase
328 JAEMBJ010000002.1 GCA021406645_01814 CDS open 34620-35975 _na     451_aa mltF Putative membrane-bound lytic murein transglycosylase D
329 JAEMBJ010000002.1 GCA021406645_01815 CDS open 35985-36692 _na     235_aa DUF5683 domain-containing protein
330 JAEMBJ010000002.1 GCA021406645_01816 CDS open 36712-37581 _na     289_aa spo0J SpoOJ protein
331 JAEMBJ010000002.1 GCA021406645_01817 CDS open 37589-38365 _na     258_aa parA SpoOJ regulator protein
332 JAEMBJ010000002.1 GCA021406645_01818 CDS open 38581-39459 _na     292_aa nit1 Acyltransferase
333 JAEMBJ010000002.1 GCA021406645_01819 CDS open 39477-40538 _na     353_aa aguA Agmatine deiminase
334 JAEMBJ010000002.1 GCA021406645_01820 CDS open 40853-41239 _na     128_aa secG preprotein translocase subunit SecG
335 JAEMBJ010000002.1 GCA021406645_01821 CDS open 41242-41949 _na     235_aa Tetratricopeptide repeat protein
336 JAEMBJ010000002.1 GCA021406645_01822 CDS open 41962-42501 _na     179_aa Lipoprotein
337 JAEMBJ010000002.1 GCA021406645_01823 CDS open 42488-43741 _na     417_aa atoC Sigma-54-dependent transcriptional regulator
338 JAEMBJ010000002.1 GCA021406645_01824 CDS open 43769-45037 _na     422_aa lysM LysM domain-containing protein
339 JAEMBJ010000002.1 GCA021406645_01825 CDS open 45074-46378 _na     434_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
340 JAEMBJ010000002.1 GCA021406645_01826 CDS open 46375-47328 _na     317_aa ftsY signal recognition particle-docking protein FtsY
341 JAEMBJ010000002.1 GCA021406645_01827 CDS open 47355-48491 _na     378_aa nspC carboxynorspermidine decarboxylase
342 JAEMBJ010000002.1 GCA021406645_01828 CDS open 48501-50264 _na     587_aa aspS aspartate--tRNA ligase
343 JAEMBJ010000002.1 GCA021406645_01829 CDS open 50695-51687 _na     330_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
344 JAEMBJ010000002.1 GCA021406645_01830 CDS open 51712-52593 _na     293_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
345 JAEMBJ010000002.1 GCA021406645_01831 CDS open 52590-53075 _na     161_aa recX Regulatory protein RecX
346 JAEMBJ010000002.1 GCA021406645_01832 CDS open 53059-53799 _na     246_aa comFC putative amidophosphoribosyl-transferase
347 JAEMBJ010000002.1 GCA021406645_01833 CDS open 53929-55998 _na     689_aa pepO M13 family metallopeptidase
348 JAEMBJ010000002.1 GCA021406645_01834 CDS open 56017-56919 _na     300_aa rmlA1 Nucleotidyltransferase
349 JAEMBJ010000002.1 GCA021406645_01835 CDS open 57100-57240 _na     46_aa hypothetical protein
350 JAEMBJ010000002.1 GCA021406645_01836 CDS open 57338-57919 _na     193_aa rpoE RNA polymerase sigma-70 factor%2C ECF subfamily
351 JAEMBJ010000002.1 GCA021406645_01837 CDS open 58068-59717 _na     549_aa pfp diphosphate--fructose-6-phosphate 1-phosphotransferase
352 JAEMBJ010000002.1 GCA021406645_01838 CDS open 59913-60227 _na     104_aa DUF1905 domain-containing protein
353 JAEMBJ010000002.1 GCA021406645_01839 CDS open 60202-60639 _na     145_aa hslR Heat shock protein 15
354 JAEMBJ010000002.1 GCA021406645_01840 CDS open 60645-61202 _na     185_aa pth aminoacyl-tRNA hydrolase
355 JAEMBJ010000002.1 GCA021406645_01841 CDS open 61345-61923 _na     192_aa rplY 50S ribosomal protein L25/general stress protein Ctc
356 JAEMBJ010000002.1 GCA021406645_01842 CDS open 62534-64576 _na     680_aa metG methionine--tRNA ligase
357 JAEMBJ010000002.1 GCA021406645_01843 CDS open 64606-66378 _na     590_aa ushA 5'-nucleotidase family protein
358 JAEMBJ010000002.1 GCA021406645_01844 CDS open 66375-67157 _na     260_aa dnaQ putative exonuclease
359 JAEMBJ010000002.1 GCA021406645_01845 CDS open 67220-67600 _na     126_aa marR Transcriptional regulator%2C putative
360 JAEMBJ010000002.1 GCA021406645_01846 CDS open 67644-70085 _na     813_aa yrkE FAD-dependent oxidoreductase
361 JAEMBJ010000002.1 GCA021406645_01847 CDS open 71491-71760 _na     89_aa hypothetical protein
362 JAEMBJ010000002.1 GCA021406645_01848 CDS open 71720-73186 _na     488_aa fimbria major subunit Mfa1
363 JAEMBJ010000002.1 GCA021406645_01849 CDS open 73284-74240 _na     318_aa mfa2 fimbrial anchor subunit Mfa2
364 JAEMBJ010000002.1 GCA021406645_01850 CDS open 74260-74361 _na     33_aa hypothetical protein
365 JAEMBJ010000002.1 GCA021406645_01851 CDS open 74540-75880 _na     446_aa mfa3 fimbrial tip subunit Mfa3
366 JAEMBJ010000002.1 GCA021406645_01852 CDS open 75889-76890 _na     333_aa mfa4 minor fimbrial subunit Mfa4
367 JAEMBJ010000002.1 GCA021406645_01853 CDS open 76948-80967 _na     1339_aa T9SS type A sorting domain-containing protein
368 JAEMBJ010000002.1 GCA021406645_01854 CDS open 81908-85048 _na     1046_aa Collagen-binding protein
369 JAEMBJ010000002.1 GCA021406645_01855 CDS open 85079-86578 _na     499_aa RagB/SusD domain-containing protein
370 JAEMBJ010000002.1 GCA021406645_01856 CDS open 86795-88165 _na     456_aa DUF6242 domain-containing protein
371 JAEMBJ010000002.1 GCA021406645_01857 CDS open 88152-88859 _na     235_aa Outer membrane protein beta-barrel domain-containing protein
372 JAEMBJ010000002.1 GCA021406645_01858 CDS open 88937-89701 _na     254_aa uppS isoprenyl transferase
373 JAEMBJ010000002.1 GCA021406645_01859 CDS open 89707-92394 _na     895_aa bamA outer membrane protein assembly factor BamA
374 JAEMBJ010000002.1 GCA021406645_01860 CDS open 92463-92975 _na     170_aa ompH Cationic outer membrane protein OmpH
375 JAEMBJ010000002.1 GCA021406645_01861 CDS open 93010-93501 _na     163_aa ompH Cationic outer membrane protein OmpH
376 JAEMBJ010000002.1 GCA021406645_01862 CDS open 93831-94409 _na     192_aa rbr rubrerythrin
377 JAEMBJ010000002.1 GCA021406645_01863 CDS open 94687-97512 _na     941_aa pqqL Peptidase M16
378 JAEMBJ010000002.1 GCA021406645_01864 CDS open 98722-99261 _na     179_aa yhaH DUF805 domain-containing protein
379 JAEMBJ010000002.1 GCA021406645_01865 CDS open 99214-99927 _na     237_aa tatD Hydrolase TatD
380 JAEMBJ010000002.1 GCA021406645_01866 CDS open 99911-100141 _na     76_aa yidD membrane protein insertion efficiency factor YidD
381 JAEMBJ010000002.1 GCA021406645_01867 CDS open 100147-100560 _na     137_aa rnpA ribonuclease P protein component
382 JAEMBJ010000002.1 GCA021406645_01868 CDS open 100557-101303 _na     248_aa hemD Uroporphyrinogen-III synthase HemD%2C putative
383 JAEMBJ010000002.1 GCA021406645_01869 CDS open 101294-102001 _na     235_aa DUF4271 domain-containing protein
384 JAEMBJ010000002.1 GCA021406645_01870 CDS open 102052-102270 _na     72_aa hypothetical protein
385 JAEMBJ010000002.1 GCA021406645_01871 CDS open 102303-103883 _na     526_aa prfC peptide chain release factor 3
386 JAEMBJ010000002.1 GCA021406645_01872 CDS open 105112-105897 _na     261_aa focA putative formate/nitrite transporter
387 JAEMBJ010000002.1 GCA021406645_01873 CDS open 105992-107800 _na     602_aa cbiD cobalt-precorrin-5B (C(1))-methyltransferase CbiD
388 JAEMBJ010000002.1 GCA021406645_01874 CDS open 107797-109641 _na     614_aa cobM precorrin-4 C(11)-methyltransferase
389 JAEMBJ010000002.1 GCA021406645_01875 CDS open 109666-110193 _na     175_aa GIY-YIG catalytic domain-containing protein
390 JAEMBJ010000002.1 GCA021406645_01876 CDS open 110284-110445 _na     53_aa DNA-binding protein
391 JAEMBJ010000002.1 GCA021406645_01877 CDS open 110442-111683 _na     413_aa cobL Precorrin-6Y C5%2C15-methyltransferase%2C decarboxylating
392 JAEMBJ010000002.1 GCA021406645_01878 CDS open 111676-113196 _na     506_aa cobH Precorrin-3B C(17)-methyltransferase
393 JAEMBJ010000002.1 GCA021406645_01780 gene open 81-170
394 JAEMBJ010000002.1 GCA021406645_01781 gene open 184-327
395 JAEMBJ010000002.1 GCA021406645_01782 gene open 398-520
396 JAEMBJ010000002.1 GCA021406645_01783 gene open 644-2716 topA
397 JAEMBJ010000002.1 GCA021406645_01784 gene open 3274-3870 traJ
398 JAEMBJ010000002.1 GCA021406645_01785 gene open 4101-5207 rfe
399 JAEMBJ010000002.1 GCA021406645_01786 gene open 5470-6660 wecC
400 JAEMBJ010000002.1 GCA021406645_01787 gene open 6946-7932
401 JAEMBJ010000002.1 GCA021406645_01788 gene open 7902-9107 epsG
402 JAEMBJ010000002.1 GCA021406645_01789 gene open 9117-10175
403 JAEMBJ010000002.1 GCA021406645_01790 gene open 10188-11522
404 JAEMBJ010000002.1 GCA021406645_01791 gene open 11859-12338
405 JAEMBJ010000002.1 GCA021406645_01792 gene open 12467-12904 cysE
406 JAEMBJ010000002.1 GCA021406645_01793 gene open 12898-14082
407 JAEMBJ010000002.1 GCA021406645_01794 gene open 14103-15143
408 JAEMBJ010000002.1 GCA021406645_01795 gene open 15185-15883 wecG
409 JAEMBJ010000002.1 GCA021406645_01796 gene open 15901-17046 wecB
410 JAEMBJ010000002.1 GCA021406645_01797 gene open 17352-17618 hupA
411 JAEMBJ010000002.1 GCA021406645_01798 gene open 17820-18389
412 JAEMBJ010000002.1 GCA021406645_01799 gene open 18448-19068 yIH1
413 JAEMBJ010000002.1 GCA021406645_01800 gene open 19072-19620
414 JAEMBJ010000002.1 GCA021406645_01801 gene open 19617-20852 ataC
415 JAEMBJ010000002.1 GCA021406645_01802 gene open 21147-22472
416 JAEMBJ010000002.1 GCA021406645_01803 gene open 22479-23453 bud32
417 JAEMBJ010000002.1 GCA021406645_01804 gene open 23470-24618 rfaB
418 JAEMBJ010000002.1 GCA021406645_01805 gene open 24649-24774
419 JAEMBJ010000002.1 GCA021406645_01806 gene open 24756-25502 gpmA
420 JAEMBJ010000002.1 GCA021406645_01807 gene open 25786-27096
421 JAEMBJ010000002.1 GCA021406645_01808 gene open 27093-28598 rfbX
422 JAEMBJ010000002.1 GCA021406645_01809 gene open 28617-29969 mgtE
423 JAEMBJ010000002.1 GCA021406645_01810 gene open 30000-30773 rsmA
424 JAEMBJ010000002.1 GCA021406645_01811 gene open 30934-31956
425 JAEMBJ010000002.1 GCA021406645_01812 gene open 31987-33441 pepD2
426 JAEMBJ010000002.1 GCA021406645_01813 gene open 33556-34437 fabD
427 JAEMBJ010000002.1 GCA021406645_01814 gene open 34620-35975 mltF
428 JAEMBJ010000002.1 GCA021406645_01815 gene open 35985-36692
429 JAEMBJ010000002.1 GCA021406645_01816 gene open 36712-37581 spo0J
430 JAEMBJ010000002.1 GCA021406645_01817 gene open 37589-38365 parA
431 JAEMBJ010000002.1 GCA021406645_01818 gene open 38581-39459 nit1
432 JAEMBJ010000002.1 GCA021406645_01819 gene open 39477-40538 aguA
433 JAEMBJ010000002.1 GCA021406645_01820 gene open 40853-41239 secG
434 JAEMBJ010000002.1 GCA021406645_01821 gene open 41242-41949
435 JAEMBJ010000002.1 GCA021406645_01822 gene open 41962-42501
436 JAEMBJ010000002.1 GCA021406645_01823 gene open 42488-43741 atoC
437 JAEMBJ010000002.1 GCA021406645_01824 gene open 43769-45037 lysM
438 JAEMBJ010000002.1 GCA021406645_01825 gene open 45074-46378 rimO
439 JAEMBJ010000002.1 GCA021406645_01826 gene open 46375-47328 ftsY
440 JAEMBJ010000002.1 GCA021406645_01827 gene open 47355-48491 nspC
441 JAEMBJ010000002.1 GCA021406645_01828 gene open 48501-50264 aspS
442 JAEMBJ010000002.1 GCA021406645_01829 gene open 50695-51687 ribD
443 JAEMBJ010000002.1 GCA021406645_01830 gene open 51712-52593 prmC
444 JAEMBJ010000002.1 GCA021406645_01831 gene open 52590-53075 recX
445 JAEMBJ010000002.1 GCA021406645_01832 gene open 53059-53799 comFC
446 JAEMBJ010000002.1 GCA021406645_01833 gene open 53929-55998 pepO
447 JAEMBJ010000002.1 GCA021406645_01834 gene open 56017-56919 rmlA1
448 JAEMBJ010000002.1 GCA021406645_01835 gene open 57100-57240
449 JAEMBJ010000002.1 GCA021406645_01836 gene open 57338-57919 rpoE
450 JAEMBJ010000002.1 GCA021406645_01837 gene open 58068-59717 pfp
451 JAEMBJ010000002.1 GCA021406645_01838 gene open 59913-60227
452 JAEMBJ010000002.1 GCA021406645_01839 gene open 60202-60639 hslR
453 JAEMBJ010000002.1 GCA021406645_01840 gene open 60645-61202 pth
454 JAEMBJ010000002.1 GCA021406645_01841 gene open 61345-61923 rplY
455 JAEMBJ010000002.1 GCA021406645_01842 gene open 62534-64576 metG
456 JAEMBJ010000002.1 GCA021406645_01843 gene open 64606-66378 ushA
457 JAEMBJ010000002.1 GCA021406645_01844 gene open 66375-67157 dnaQ
458 JAEMBJ010000002.1 GCA021406645_01845 gene open 67220-67600 marR
459 JAEMBJ010000002.1 GCA021406645_01846 gene open 67644-70085 yrkE
460 JAEMBJ010000002.1 GCA021406645_01847 gene open 71491-71760
461 JAEMBJ010000002.1 GCA021406645_01848 gene open 71720-73186
462 JAEMBJ010000002.1 GCA021406645_01849 gene open 73284-74240 mfa2
463 JAEMBJ010000002.1 GCA021406645_01850 gene open 74260-74361
464 JAEMBJ010000002.1 GCA021406645_01851 gene open 74540-75880 mfa3
465 JAEMBJ010000002.1 GCA021406645_01852 gene open 75889-76890 mfa4
466 JAEMBJ010000002.1 GCA021406645_01853 gene open 76948-80967
467 JAEMBJ010000002.1 GCA021406645_01854 gene open 81908-85048
468 JAEMBJ010000002.1 GCA021406645_01855 gene open 85079-86578
469 JAEMBJ010000002.1 GCA021406645_01856 gene open 86795-88165
470 JAEMBJ010000002.1 GCA021406645_01857 gene open 88152-88859
471 JAEMBJ010000002.1 GCA021406645_01858 gene open 88937-89701 uppS
472 JAEMBJ010000002.1 GCA021406645_01859 gene open 89707-92394 bamA
473 JAEMBJ010000002.1 GCA021406645_01860 gene open 92463-92975 ompH
474 JAEMBJ010000002.1 GCA021406645_01861 gene open 93010-93501 ompH
475 JAEMBJ010000002.1 GCA021406645_01862 gene open 93831-94409 rbr
476 JAEMBJ010000002.1 GCA021406645_01863 gene open 94687-97512 pqqL
477 JAEMBJ010000002.1 GCA021406645_01864 gene open 98722-99261 yhaH
478 JAEMBJ010000002.1 GCA021406645_01865 gene open 99214-99927 tatD
479 JAEMBJ010000002.1 GCA021406645_01866 gene open 99911-100141 yidD
480 JAEMBJ010000002.1 GCA021406645_01867 gene open 100147-100560 rnpA
481 JAEMBJ010000002.1 GCA021406645_01868 gene open 100557-101303 hemD
482 JAEMBJ010000002.1 GCA021406645_01869 gene open 101294-102001
483 JAEMBJ010000002.1 GCA021406645_01870 gene open 102052-102270
484 JAEMBJ010000002.1 GCA021406645_01871 gene open 102303-103883 prfC
485 JAEMBJ010000002.1 GCA021406645_01872 gene open 105112-105897 focA
486 JAEMBJ010000002.1 GCA021406645_01873 gene open 105992-107800 cbiD
487 JAEMBJ010000002.1 GCA021406645_01874 gene open 107797-109641 cobM
488 JAEMBJ010000002.1 GCA021406645_01875 gene open 109666-110193
489 JAEMBJ010000002.1 GCA021406645_01876 gene open 110284-110445
490 JAEMBJ010000002.1 GCA021406645_01877 gene open 110442-111683 cobL
491 JAEMBJ010000002.1 GCA021406645_01878 gene open 111676-113196 cobH
492 JAEMBJ010000003.1 GCA021406645_01264 CDS open 231-755 _na     174_aa rpoE RNA polymerase sigma-70 factor%2C ECF subfamily
493 JAEMBJ010000003.1 GCA021406645_01265 CDS open 752-1144 _na     130_aa DUF3333 domain-containing protein
494 JAEMBJ010000003.1 GCA021406645_01266 CDS open 1341-1595 _na     84_aa Transposase
495 JAEMBJ010000003.1 GCA021406645_01267 CDS open 1998-4145 _na     715_aa scpA methylmalonyl-CoA mutase
496 JAEMBJ010000003.1 GCA021406645_01268 CDS open 4174-6030 _na     618_aa mutA methylmalonyl-CoA mutase small subunit
497 JAEMBJ010000003.1 GCA021406645_01269 CDS open 6304-7803 _na     499_aa T9SS C-terminal target domain-containing protein
498 JAEMBJ010000003.1 GCA021406645_01270 CDS open 8722-9189 _na     155_aa hupA Histidinol phosphate aminotransferase
499 JAEMBJ010000003.1 GCA021406645_01271 CDS open 9251-9697 _na     148_aa hypothetical protein
500 JAEMBJ010000003.1 GCA021406645_01272 CDS open 9717-10157 _na     146_aa hypothetical protein