BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406725.1)
Select a Genome:
|
BAKTA Annotations for GCA_021406725.1
|
Search & Sort all 4314 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | JAEMBO010000001.1 | repeat_region | open | 74439-74750 | CRISPR array with 5 repeats of length 36%2C consensus sequence GTTGGATCTACCCTCTATTCGAAGGGTACACACAAC and spacer length 30 | |||
| 2 | JAEMBO010000001.1 | GCA021406725_00244 | CDS | open | 118-1191 | _na 357_aa | dAP2 | Conserved domain protein |
| 3 | JAEMBO010000001.1 | GCA021406725_00245 | CDS | open | 1227-2273 | _na 348_aa | selD | selenide%2C water dikinase SelD |
| 4 | JAEMBO010000001.1 | GCA021406725_00246 | CDS | open | 2270-2494 | _na 74_aa | Putative Se/S carrier protein-like domain-containing protein | |
| 5 | JAEMBO010000001.1 | GCA021406725_00247 | CDS | open | 2478-3608 | _na 376_aa | csdA | Aminotransferase%2C class V |
| 6 | JAEMBO010000001.1 | GCA021406725_00248 | CDS | open | 3747-5567 | _na 606_aa | afuC | Alpha-1%2C3/4-fucosidase%2C putative |
| 7 | JAEMBO010000001.1 | GCA021406725_00249 | CDS | open | 6011-8038 | _na 675_aa | tktA | Transketolase |
| 8 | JAEMBO010000001.1 | GCA021406725_00250 | CDS | open | 8125-8562 | _na 145_aa | rpiB | ribose 5-phosphate isomerase B |
| 9 | JAEMBO010000001.1 | GCA021406725_00251 | CDS | open | 8597-9034 | _na 145_aa | Membrane protease subunit | |
| 10 | JAEMBO010000001.1 | GCA021406725_00252 | CDS | open | 9262-11877 | _na 871_aa | sfcA | NADP-dependent malic enzyme |
| 11 | JAEMBO010000001.1 | GCA021406725_00253 | CDS | open | 11884-13212 | _na 442_aa | salY | ABC transporter%2C permease protein%2C putative |
| 12 | JAEMBO010000001.1 | GCA021406725_00254 | CDS | open | 13234-14610 | _na 458_aa | salY | ABC transporter%2C permease protein%2C putative |
| 13 | JAEMBO010000001.1 | GCA021406725_00255 | CDS | open | 14831-15502 | _na 223_aa | lolD | ABC transporter%2C ATP-binding protein |
| 14 | JAEMBO010000001.1 | GCA021406725_00256 | CDS | open | 15582-16832 | _na 416_aa | emrA | Efflux transporter%2C MFP component%2C RND family |
| 15 | JAEMBO010000001.1 | GCA021406725_00257 | CDS | open | 17096-18601 | _na 501_aa | tolC | Transporter |
| 16 | JAEMBO010000001.1 | GCA021406725_00258 | CDS | open | 18791-19012 | _na 73_aa | DUF2795 domain-containing protein | |
| 17 | JAEMBO010000001.1 | GCA021406725_00259 | CDS | open | 19083-20036 | _na 317_aa | porP | type IX secretion system membrane protein PorP |
| 18 | JAEMBO010000001.1 | GCA021406725_00260 | CDS | open | 20093-21568 | _na 491_aa | porK | Por secretion system protein porK/gldK |
| 19 | JAEMBO010000001.1 | GCA021406725_00261 | CDS | open | 21609-22538 | _na 309_aa | porL | Gliding motility protein GldL-like N-terminal domain-containing protein |
| 20 | JAEMBO010000001.1 | GCA021406725_00262 | CDS | open | 22542-24092 | _na 516_aa | porM | Por secretion system protein porM/gldM |
| 21 | JAEMBO010000001.1 | GCA021406725_00263 | CDS | open | 24101-25180 | _na 359_aa | gldN | Gliding motility protein GldN |
| 22 | JAEMBO010000001.1 | GCA021406725_00264 | CDS | open | 25341-25931 | _na 196_aa | chrA | Chromate transporter |
| 23 | JAEMBO010000001.1 | GCA021406725_00265 | CDS | open | 25950-26543 | _na 197_aa | chrA | putative chromate transport protein |
| 24 | JAEMBO010000001.1 | GCA021406725_00266 | CDS | open | 26681-27259 | _na 192_aa | zliS | Secretion activator protein%2C putative |
| 25 | JAEMBO010000001.1 | GCA021406725_00267 | CDS | open | 27847-28743 | _na 298_aa | wcaE | Glycosyltransferase 2-like domain-containing protein |
| 26 | JAEMBO010000001.1 | GCA021406725_00268 | CDS | open | 28758-29882 | _na 374_aa | dprA | DNA-processing protein DprA |
| 27 | JAEMBO010000001.1 | GCA021406725_00269 | CDS | open | 29875-33579 | _na 1234_aa | purL | phosphoribosylformylglycinamidine synthase |
| 28 | JAEMBO010000001.1 | GCA021406725_00270 | CDS | open | 35195-36487 | _na 430_aa | cpoB | TPR domain protein |
| 29 | JAEMBO010000001.1 | GCA021406725_00271 | CDS | open | 36844-37266 | _na 140_aa | rseC | Positive regulator of sigma(E)%2C RseC/MucC |
| 30 | JAEMBO010000001.1 | GCA021406725_00272 | CDS | open | 37276-38148 | _na 290_aa | rnfB | Fe-S cluster domain-containing protein |
| 31 | JAEMBO010000001.1 | GCA021406725_00273 | CDS | open | 38184-39515 | _na 443_aa | rsxC | electron transport complex subunit RsxC |
| 32 | JAEMBO010000001.1 | GCA021406725_00274 | CDS | open | 39531-40514 | _na 327_aa | rnfD | Ion-translocating oxidoreductase complex subunit D |
| 33 | JAEMBO010000001.1 | GCA021406725_00275 | CDS | open | 40511-41188 | _na 225_aa | rnfG | Ion-translocating oxidoreductase complex subunit G |
| 34 | JAEMBO010000001.1 | GCA021406725_00276 | CDS | open | 41185-41775 | _na 196_aa | rnfE | Ion-translocating oxidoreductase complex subunit E |
| 35 | JAEMBO010000001.1 | GCA021406725_00277 | CDS | open | 41800-42372 | _na 190_aa | rnfA | Ion-translocating oxidoreductase complex subunit A |
| 36 | JAEMBO010000001.1 | GCA021406725_00278 | CDS | open | 42585-43598 | _na 337_aa | apbE | FAD:protein FMN transferase |
| 37 | JAEMBO010000001.1 | GCA021406725_00279 | CDS | open | 43595-44134 | _na 179_aa | nfnB | Nitroreductase family protein |
| 38 | JAEMBO010000001.1 | GCA021406725_00280 | CDS | open | 44134-45087 | _na 317_aa | wcaA | Glycosyl transferase%2C group 2 family protein |
| 39 | JAEMBO010000001.1 | GCA021406725_00281 | CDS | open | 45084-45623 | _na 179_aa | DUF4199 domain-containing protein | |
| 40 | JAEMBO010000001.1 | GCA021406725_00282 | CDS | open | 46359-46676 | _na 105_aa | rplU | 50S ribosomal protein L21 |
| 41 | JAEMBO010000001.1 | GCA021406725_00283 | CDS | open | 46704-46961 | _na 85_aa | rpmA | 50S ribosomal protein L27 |
| 42 | JAEMBO010000001.1 | GCA021406725_00284 | CDS | open | 47061-48332 | _na 423_aa | serS | serine--tRNA ligase |
| 43 | JAEMBO010000001.1 | GCA021406725_00285 | CDS | open | 48345-51005 | _na 886_aa | Peptidase family M49 | |
| 44 | JAEMBO010000001.1 | GCA021406725_00286 | CDS | open | 51163-51411 | _na 82_aa | hypothetical protein | |
| 45 | JAEMBO010000001.1 | GCA021406725_00287 | CDS | open | 51617-52000 | _na 127_aa | DUF1573 domain-containing protein | |
| 46 | JAEMBO010000001.1 | GCA021406725_00288 | CDS | open | 52032-53120 | _na 362_aa | DUF1573 domain-containing protein | |
| 47 | JAEMBO010000001.1 | GCA021406725_00289 | CDS | open | 53196-54302 | _na 368_aa | meaB | methylmalonyl Co-A mutase-associated GTPase MeaB |
| 48 | JAEMBO010000001.1 | GCA021406725_00290 | CDS | open | 54331-55509 | _na 392_aa | gltP | Serine/threonine transporter |
| 49 | JAEMBO010000001.1 | GCA021406725_00291 | CDS | open | 55632-55961 | _na 109_aa | qdoI | Cupin type-2 domain-containing protein |
| 50 | JAEMBO010000001.1 | GCA021406725_00292 | CDS | open | 56163-57668 | _na 501_aa | hutH | histidine ammonia-lyase |
| 51 | JAEMBO010000001.1 | GCA021406725_00293 | CDS | open | 57659-58288 | _na 209_aa | ftcD | Cyclodeaminase/cyclohydrolase domain-containing protein |
| 52 | JAEMBO010000001.1 | GCA021406725_00294 | CDS | open | 58313-59440 | _na 375_aa | lomR | Porin |
| 53 | JAEMBO010000001.1 | GCA021406725_00295 | CDS | open | 59481-60635 | _na 384_aa | Nucleoside transporter/FeoB GTPase Gate domain-containing protein | |
| 54 | JAEMBO010000001.1 | GCA021406725_00296 | CDS | open | 60729-61979 | _na 416_aa | hutI | imidazolonepropionase |
| 55 | JAEMBO010000001.1 | GCA021406725_00297 | CDS | open | 62101-63003 | _na 300_aa | ftcD | glutamate formimidoyltransferase |
| 56 | JAEMBO010000001.1 | GCA021406725_00298 | CDS | open | 63052-63567 | _na 171_aa | hupA | DNA-binding protein%2C histone-like family |
| 57 | JAEMBO010000001.1 | GCA021406725_00299 | CDS | open | 64243-66219 | _na 658_aa | rho | transcription termination factor Rho |
| 58 | JAEMBO010000001.1 | GCA021406725_00300 | CDS | open | 66447-67355 | _na 302_aa | rhaT | EamA domain-containing protein |
| 59 | JAEMBO010000001.1 | GCA021406725_00301 | CDS | open | 67366-68325 | _na 319_aa | wcaA | Glycosyl transferase%2C group 2 family protein |
| 60 | JAEMBO010000001.1 | GCA021406725_00302 | CDS | open | 68377-69279 | _na 300_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 61 | JAEMBO010000001.1 | GCA021406725_00303 | CDS | open | 69295-69864 | _na 189_aa | Plasmid pRiA4b Orf3-like domain-containing protein | |
| 62 | JAEMBO010000001.1 | GCA021406725_00304 | CDS | open | 70152-73679 | _na 1175_aa | cas13b | type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b |
| 63 | JAEMBO010000001.1 | GCA021406725_00305 | CDS | open | 73687-74229 | _na 180_aa | csx28 | CRISPR-associated protein Csx28 |
| 64 | JAEMBO010000001.1 | GCA021406725_00306 | CDS | open | 75227-75472 | _na 81_aa | hypothetical protein | |
| 65 | JAEMBO010000001.1 | GCA021406725_00307 | CDS | open | 75554-76735 | _na 393_aa | megL | methionine gamma-lyase |
| 66 | JAEMBO010000001.1 | GCA021406725_00308 | CDS | open | 76916-78385 | _na 489_aa | cpdA | Metallophosphoesterase family protein |
| 67 | JAEMBO010000001.1 | GCA021406725_00309 | CDS | open | 78388-78981 | _na 197_aa | Histidine kinase | |
| 68 | JAEMBO010000001.1 | GCA021406725_00310 | CDS | open | 79082-79687 | _na 201_aa | yihA | ribosome biogenesis GTP-binding protein YihA/YsxC |
| 69 | JAEMBO010000001.1 | GCA021406725_00311 | CDS | open | 79697-80725 | _na 342_aa | galE | UDP-glucose 4-epimerase GalE |
| 70 | JAEMBO010000001.1 | GCA021406725_00312 | CDS | open | 80768-82864 | _na 698_aa | recG | ATP-dependent DNA helicase RecG |
| 71 | JAEMBO010000001.1 | GCA021406725_00313 | CDS | open | 82882-83634 | _na 250_aa | ycjU | Hydrolase%2C haloacid dehalogenase-like family |
| 72 | JAEMBO010000001.1 | GCA021406725_00314 | CDS | open | 83729-85186 | _na 485_aa | yopM | Internalin |
| 73 | JAEMBO010000001.1 | GCA021406725_00315 | CDS | open | 85613-87193 | _na 526_aa | nanH | exo-alpha-sialidase |
| 74 | JAEMBO010000001.1 | GCA021406725_00316 | CDS | open | 88126-89052 | _na 308_aa | hypothetical protein | |
| 75 | JAEMBO010000001.1 | GCA021406725_00317 | CDS | open | 89081-89818 | _na 245_aa | sIMPL | SIMPL domain-containing protein |
| 76 | JAEMBO010000001.1 | GCA021406725_00318 | CDS | open | 89865-90779 | _na 304_aa | pyrB | aspartate carbamoyltransferase |
| 77 | JAEMBO010000001.1 | GCA021406725_00319 | CDS | open | 90807-91247 | _na 146_aa | pyrI | aspartate carbamoyltransferase regulatory subunit |
| 78 | JAEMBO010000001.1 | GCA021406725_00320 | CDS | open | 91276-91863 | _na 195_aa | rutF | Putative flavoredoxin |
| 79 | JAEMBO010000001.1 | GCA021406725_00321 | CDS | open | 91907-92497 | _na 196_aa | lemA | LemA protein |
| 80 | JAEMBO010000001.1 | GCA021406725_00322 | CDS | open | 92519-93826 | _na 435_aa | rPS27A | TPM domain-containing protein |
| 81 | JAEMBO010000001.1 | GCA021406725_00323 | CDS | open | 93771-95894 | _na 707_aa | TonB-dependent receptor | |
| 82 | JAEMBO010000001.1 | GCA021406725_00324 | CDS | open | 95901-96722 | _na 273_aa | mltF | Solute-binding protein family 3/N-terminal domain-containing protein |
| 83 | JAEMBO010000001.1 | GCA021406725_00325 | CDS | open | 96785-97990 | _na 401_aa | rlmK | PUA domain-containing protein |
| 84 | JAEMBO010000001.1 | GCA021406725_00326 | CDS | open | 97987-98589 | _na 200_aa | rnd | 3'-5' exonuclease domain protein |
| 85 | JAEMBO010000001.1 | GCA021406725_00327 | CDS | open | 98630-99190 | _na 186_aa | DUF5063 domain-containing protein | |
| 86 | JAEMBO010000001.1 | GCA021406725_00328 | CDS | open | 99669-101603 | _na 644_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) |
| 87 | JAEMBO010000001.1 | GCA021406725_00329 | CDS | open | 101634-102095 | _na 153_aa | coaD | pantetheine-phosphate adenylyltransferase |
| 88 | JAEMBO010000001.1 | GCA021406725_00330 | CDS | open | 103133-103801 | _na 222_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 89 | JAEMBO010000001.1 | GCA021406725_00331 | CDS | open | 104364-104819 | _na 151_aa | rplM | 50S ribosomal protein L13 |
| 90 | JAEMBO010000001.1 | GCA021406725_00332 | CDS | open | 104829-105215 | _na 128_aa | rpsI | 30S ribosomal protein S9 |
| 91 | JAEMBO010000001.1 | GCA021406725_00333 | CDS | open | 105350-106195 | _na 281_aa | rpsB | 30S ribosomal protein S2 |
| 92 | JAEMBO010000001.1 | GCA021406725_00334 | CDS | open | 106335-107159 | _na 274_aa | tsf | translation elongation factor Ts |
| 93 | JAEMBO010000001.1 | GCA021406725_00335 | CDS | open | 107533-109569 | _na 678_aa | uvrB | excinuclease ABC subunit UvrB |
| 94 | JAEMBO010000001.1 | GCA021406725_00336 | CDS | open | 109566-111086 | _na 506_aa | nhaP2 | potassium/proton antiporter |
| 95 | JAEMBO010000001.1 | GCA021406725_00337 | CDS | open | 111564-112883 | _na 439_aa | rseP | RIP metalloprotease RseP |
| 96 | JAEMBO010000001.1 | GCA021406725_00338 | CDS | open | 112893-115415 | _na 840_aa | rqcU | endonuclease MutS2 |
| 97 | JAEMBO010000001.1 | GCA021406725_00339 | CDS | open | 115577-115768 | _na 63_aa | rpsU | 30S ribosomal protein S21 |
| 98 | JAEMBO010000001.1 | GCA021406725_00340 | CDS | open | 115845-117050 | _na 401_aa | hpf | ribosome hibernation-promoting factor%2C HPF/YfiA family |
| 99 | JAEMBO010000001.1 | GCA021406725_00343 | CDS | open | 117444-118631 | _na 395_aa | tuf | elongation factor Tu |
| 100 | JAEMBO010000001.1 | GCA021406725_00345 | CDS | open | 118790-118993 | _na 67_aa | secE | preprotein translocase subunit SecE |
| 101 | JAEMBO010000001.1 | GCA021406725_00346 | CDS | open | 119015-119554 | _na 179_aa | nusG | transcription termination/antitermination protein NusG |
| 102 | JAEMBO010000001.1 | GCA021406725_00347 | CDS | open | 119623-120060 | _na 145_aa | rplK | 50S ribosomal protein L11 |
| 103 | JAEMBO010000001.1 | GCA021406725_00348 | CDS | open | 120081-120779 | _na 232_aa | rplA | 50S ribosomal protein L1 |
| 104 | JAEMBO010000001.1 | GCA021406725_00349 | CDS | open | 120795-121319 | _na 174_aa | rplJ | 50S ribosomal protein L10 |
| 105 | JAEMBO010000001.1 | GCA021406725_00350 | CDS | open | 121361-121738 | _na 125_aa | rplL | 50S ribosomal protein L7/L12 |
| 106 | JAEMBO010000001.1 | GCA021406725_00351 | CDS | open | 121850-125659 | _na 1269_aa | rpoB | DNA-directed RNA polymerase subunit beta |
| 107 | JAEMBO010000001.1 | GCA021406725_00352 | CDS | open | 125725-130026 | _na 1433_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 108 | JAEMBO010000001.1 | GCA021406725_00244 | gene | open | 118-1191 | dAP2 | ||
| 109 | JAEMBO010000001.1 | GCA021406725_00245 | gene | open | 1227-2273 | selD | ||
| 110 | JAEMBO010000001.1 | GCA021406725_00246 | gene | open | 2270-2494 | |||
| 111 | JAEMBO010000001.1 | GCA021406725_00247 | gene | open | 2478-3608 | csdA | ||
| 112 | JAEMBO010000001.1 | GCA021406725_00248 | gene | open | 3747-5567 | afuC | ||
| 113 | JAEMBO010000001.1 | GCA021406725_00249 | gene | open | 6011-8038 | tktA | ||
| 114 | JAEMBO010000001.1 | GCA021406725_00250 | gene | open | 8125-8562 | rpiB | ||
| 115 | JAEMBO010000001.1 | GCA021406725_00251 | gene | open | 8597-9034 | |||
| 116 | JAEMBO010000001.1 | GCA021406725_00252 | gene | open | 9262-11877 | sfcA | ||
| 117 | JAEMBO010000001.1 | GCA021406725_00253 | gene | open | 11884-13212 | salY | ||
| 118 | JAEMBO010000001.1 | GCA021406725_00254 | gene | open | 13234-14610 | salY | ||
| 119 | JAEMBO010000001.1 | GCA021406725_00255 | gene | open | 14831-15502 | lolD | ||
| 120 | JAEMBO010000001.1 | GCA021406725_00256 | gene | open | 15582-16832 | emrA | ||
| 121 | JAEMBO010000001.1 | GCA021406725_00257 | gene | open | 17096-18601 | tolC | ||
| 122 | JAEMBO010000001.1 | GCA021406725_00258 | gene | open | 18791-19012 | |||
| 123 | JAEMBO010000001.1 | GCA021406725_00259 | gene | open | 19083-20036 | porP | ||
| 124 | JAEMBO010000001.1 | GCA021406725_00260 | gene | open | 20093-21568 | porK | ||
| 125 | JAEMBO010000001.1 | GCA021406725_00261 | gene | open | 21609-22538 | porL | ||
| 126 | JAEMBO010000001.1 | GCA021406725_00262 | gene | open | 22542-24092 | porM | ||
| 127 | JAEMBO010000001.1 | GCA021406725_00263 | gene | open | 24101-25180 | gldN | ||
| 128 | JAEMBO010000001.1 | GCA021406725_00264 | gene | open | 25341-25931 | chrA | ||
| 129 | JAEMBO010000001.1 | GCA021406725_00265 | gene | open | 25950-26543 | chrA | ||
| 130 | JAEMBO010000001.1 | GCA021406725_00266 | gene | open | 26681-27259 | zliS | ||
| 131 | JAEMBO010000001.1 | GCA021406725_00267 | gene | open | 27847-28743 | wcaE | ||
| 132 | JAEMBO010000001.1 | GCA021406725_00268 | gene | open | 28758-29882 | dprA | ||
| 133 | JAEMBO010000001.1 | GCA021406725_00269 | gene | open | 29875-33579 | purL | ||
| 134 | JAEMBO010000001.1 | GCA021406725_00270 | gene | open | 35195-36487 | cpoB | ||
| 135 | JAEMBO010000001.1 | GCA021406725_00271 | gene | open | 36844-37266 | rseC | ||
| 136 | JAEMBO010000001.1 | GCA021406725_00272 | gene | open | 37276-38148 | rnfB | ||
| 137 | JAEMBO010000001.1 | GCA021406725_00273 | gene | open | 38184-39515 | rsxC | ||
| 138 | JAEMBO010000001.1 | GCA021406725_00274 | gene | open | 39531-40514 | rnfD | ||
| 139 | JAEMBO010000001.1 | GCA021406725_00275 | gene | open | 40511-41188 | rnfG | ||
| 140 | JAEMBO010000001.1 | GCA021406725_00276 | gene | open | 41185-41775 | rnfE | ||
| 141 | JAEMBO010000001.1 | GCA021406725_00277 | gene | open | 41800-42372 | rnfA | ||
| 142 | JAEMBO010000001.1 | GCA021406725_00278 | gene | open | 42585-43598 | apbE | ||
| 143 | JAEMBO010000001.1 | GCA021406725_00279 | gene | open | 43595-44134 | nfnB | ||
| 144 | JAEMBO010000001.1 | GCA021406725_00280 | gene | open | 44134-45087 | wcaA | ||
| 145 | JAEMBO010000001.1 | GCA021406725_00281 | gene | open | 45084-45623 | |||
| 146 | JAEMBO010000001.1 | GCA021406725_00282 | gene | open | 46359-46676 | rplU | ||
| 147 | JAEMBO010000001.1 | GCA021406725_00283 | gene | open | 46704-46961 | rpmA | ||
| 148 | JAEMBO010000001.1 | GCA021406725_00284 | gene | open | 47061-48332 | serS | ||
| 149 | JAEMBO010000001.1 | GCA021406725_00285 | gene | open | 48345-51005 | |||
| 150 | JAEMBO010000001.1 | GCA021406725_00286 | gene | open | 51163-51411 | |||
| 151 | JAEMBO010000001.1 | GCA021406725_00287 | gene | open | 51617-52000 | |||
| 152 | JAEMBO010000001.1 | GCA021406725_00288 | gene | open | 52032-53120 | |||
| 153 | JAEMBO010000001.1 | GCA021406725_00289 | gene | open | 53196-54302 | meaB | ||
| 154 | JAEMBO010000001.1 | GCA021406725_00290 | gene | open | 54331-55509 | gltP | ||
| 155 | JAEMBO010000001.1 | GCA021406725_00291 | gene | open | 55632-55961 | qdoI | ||
| 156 | JAEMBO010000001.1 | GCA021406725_00292 | gene | open | 56163-57668 | hutH | ||
| 157 | JAEMBO010000001.1 | GCA021406725_00293 | gene | open | 57659-58288 | ftcD | ||
| 158 | JAEMBO010000001.1 | GCA021406725_00294 | gene | open | 58313-59440 | lomR | ||
| 159 | JAEMBO010000001.1 | GCA021406725_00295 | gene | open | 59481-60635 | |||
| 160 | JAEMBO010000001.1 | GCA021406725_00296 | gene | open | 60729-61979 | hutI | ||
| 161 | JAEMBO010000001.1 | GCA021406725_00297 | gene | open | 62101-63003 | ftcD | ||
| 162 | JAEMBO010000001.1 | GCA021406725_00298 | gene | open | 63052-63567 | hupA | ||
| 163 | JAEMBO010000001.1 | GCA021406725_00299 | gene | open | 64243-66219 | rho | ||
| 164 | JAEMBO010000001.1 | GCA021406725_00300 | gene | open | 66447-67355 | rhaT | ||
| 165 | JAEMBO010000001.1 | GCA021406725_00301 | gene | open | 67366-68325 | wcaA | ||
| 166 | JAEMBO010000001.1 | GCA021406725_00302 | gene | open | 68377-69279 | miaA | ||
| 167 | JAEMBO010000001.1 | GCA021406725_00303 | gene | open | 69295-69864 | |||
| 168 | JAEMBO010000001.1 | GCA021406725_00304 | gene | open | 70152-73679 | cas13b | ||
| 169 | JAEMBO010000001.1 | GCA021406725_00305 | gene | open | 73687-74229 | csx28 | ||
| 170 | JAEMBO010000001.1 | GCA021406725_00306 | gene | open | 75227-75472 | |||
| 171 | JAEMBO010000001.1 | GCA021406725_00307 | gene | open | 75554-76735 | megL | ||
| 172 | JAEMBO010000001.1 | GCA021406725_00308 | gene | open | 76916-78385 | cpdA | ||
| 173 | JAEMBO010000001.1 | GCA021406725_00309 | gene | open | 78388-78981 | |||
| 174 | JAEMBO010000001.1 | GCA021406725_00310 | gene | open | 79082-79687 | yihA | ||
| 175 | JAEMBO010000001.1 | GCA021406725_00311 | gene | open | 79697-80725 | galE | ||
| 176 | JAEMBO010000001.1 | GCA021406725_00312 | gene | open | 80768-82864 | recG | ||
| 177 | JAEMBO010000001.1 | GCA021406725_00313 | gene | open | 82882-83634 | ycjU | ||
| 178 | JAEMBO010000001.1 | GCA021406725_00314 | gene | open | 83729-85186 | yopM | ||
| 179 | JAEMBO010000001.1 | GCA021406725_00315 | gene | open | 85613-87193 | nanH | ||
| 180 | JAEMBO010000001.1 | GCA021406725_00316 | gene | open | 88126-89052 | |||
| 181 | JAEMBO010000001.1 | GCA021406725_00317 | gene | open | 89081-89818 | sIMPL | ||
| 182 | JAEMBO010000001.1 | GCA021406725_00318 | gene | open | 89865-90779 | pyrB | ||
| 183 | JAEMBO010000001.1 | GCA021406725_00319 | gene | open | 90807-91247 | pyrI | ||
| 184 | JAEMBO010000001.1 | GCA021406725_00320 | gene | open | 91276-91863 | rutF | ||
| 185 | JAEMBO010000001.1 | GCA021406725_00321 | gene | open | 91907-92497 | lemA | ||
| 186 | JAEMBO010000001.1 | GCA021406725_00322 | gene | open | 92519-93826 | rPS27A | ||
| 187 | JAEMBO010000001.1 | GCA021406725_00323 | gene | open | 93771-95894 | |||
| 188 | JAEMBO010000001.1 | GCA021406725_00324 | gene | open | 95901-96722 | mltF | ||
| 189 | JAEMBO010000001.1 | GCA021406725_00325 | gene | open | 96785-97990 | rlmK | ||
| 190 | JAEMBO010000001.1 | GCA021406725_00326 | gene | open | 97987-98589 | rnd | ||
| 191 | JAEMBO010000001.1 | GCA021406725_00327 | gene | open | 98630-99190 | |||
| 192 | JAEMBO010000001.1 | GCA021406725_00328 | gene | open | 99669-101603 | gyrB | ||
| 193 | JAEMBO010000001.1 | GCA021406725_00329 | gene | open | 101634-102095 | coaD | ||
| 194 | JAEMBO010000001.1 | GCA021406725_00330 | gene | open | 103133-103801 | |||
| 195 | JAEMBO010000001.1 | GCA021406725_00331 | gene | open | 104364-104819 | rplM | ||
| 196 | JAEMBO010000001.1 | GCA021406725_00332 | gene | open | 104829-105215 | rpsI | ||
| 197 | JAEMBO010000001.1 | GCA021406725_00333 | gene | open | 105350-106195 | rpsB | ||
| 198 | JAEMBO010000001.1 | GCA021406725_00334 | gene | open | 106335-107159 | tsf | ||
| 199 | JAEMBO010000001.1 | GCA021406725_00335 | gene | open | 107533-109569 | uvrB | ||
| 200 | JAEMBO010000001.1 | GCA021406725_00336 | gene | open | 109566-111086 | nhaP2 | ||
| 201 | JAEMBO010000001.1 | GCA021406725_00337 | gene | open | 111564-112883 | rseP | ||
| 202 | JAEMBO010000001.1 | GCA021406725_00338 | gene | open | 112893-115415 | rqcU | ||
| 203 | JAEMBO010000001.1 | GCA021406725_00339 | gene | open | 115577-115768 | rpsU | ||
| 204 | JAEMBO010000001.1 | GCA021406725_00340 | gene | open | 115845-117050 | hpf | ||
| 205 | JAEMBO010000001.1 | GCA021406725_00343 | gene | open | 117444-118631 | tuf | ||
| 206 | JAEMBO010000001.1 | GCA021406725_00345 | gene | open | 118790-118993 | secE | ||
| 207 | JAEMBO010000001.1 | GCA021406725_00346 | gene | open | 119015-119554 | nusG | ||
| 208 | JAEMBO010000001.1 | GCA021406725_00347 | gene | open | 119623-120060 | rplK | ||
| 209 | JAEMBO010000001.1 | GCA021406725_00348 | gene | open | 120081-120779 | rplA | ||
| 210 | JAEMBO010000001.1 | GCA021406725_00349 | gene | open | 120795-121319 | rplJ | ||
| 211 | JAEMBO010000001.1 | GCA021406725_00350 | gene | open | 121361-121738 | rplL | ||
| 212 | JAEMBO010000001.1 | GCA021406725_00351 | gene | open | 121850-125659 | rpoB | ||
| 213 | JAEMBO010000001.1 | GCA021406725_00352 | gene | open | 125725-130026 | rpoC | ||
| 214 | JAEMBO010000001.1 | GCA021406725_00341 | gene | open | 117190-117272 | trnY | ||
| 215 | JAEMBO010000001.1 | GCA021406725_00342 | gene | open | 117305-117376 | trnT | ||
| 216 | JAEMBO010000001.1 | GCA021406725_00344 | gene | open | 118702-118774 | trnW | ||
| 217 | JAEMBO010000001.1 | GCA021406725_00341 | tRNA | open | 117190-117272 | trnY | tRNA-Tyr(gta) | |
| 218 | JAEMBO010000001.1 | GCA021406725_00342 | tRNA | open | 117305-117376 | trnT | tRNA-Thr(ggt) | |
| 219 | JAEMBO010000001.1 | GCA021406725_00344 | tRNA | open | 118702-118774 | trnW | tRNA-Trp(cca) | |
| 220 | JAEMBO010000002.1 | repeat_region | open | 9837-10215 | CRISPR array with 6 repeats of length 36%2C consensus sequence GTTGGGAATACCCTTAGTTAGAAGGGTGGAGACAAC and spacer length 30 | |||
| 221 | JAEMBO010000002.1 | GCA021406725_00872 | CDS | open | 248-721 | _na 157_aa | paaI | Thioesterase family protein |
| 222 | JAEMBO010000002.1 | GCA021406725_00873 | CDS | open | 832-1416 | _na 194_aa | lutC | LUD domain-containing protein |
| 223 | JAEMBO010000002.1 | GCA021406725_00874 | CDS | open | 1422-2789 | _na 455_aa | lutB | Putative electron transport protein |
| 224 | JAEMBO010000002.1 | GCA021406725_00875 | CDS | open | 2786-3607 | _na 273_aa | glpC | Oxidoreductase%2C putative |
| 225 | JAEMBO010000002.1 | GCA021406725_00876 | CDS | open | 3847-4719 | _na 290_aa | serB | phosphoserine phosphatase SerB |
| 226 | JAEMBO010000002.1 | GCA021406725_00877 | CDS | open | 5415-5636 | _na 73_aa | 30S ribosomal protein S21 domain protein | |
| 227 | JAEMBO010000002.1 | GCA021406725_00878 | CDS | open | 5709-6425 | _na 238_aa | csx27 | CRISPR-associated protein Csx27 |
| 228 | JAEMBO010000002.1 | GCA021406725_00879 | CDS | open | 6422-9829 | _na 1135_aa | cas13b | type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b |
| 229 | JAEMBO010000002.1 | GCA021406725_00880 | CDS | open | 10423-11742 | _na 439_aa | cobB | cobyrinate a%2Cc-diamide synthase |
| 230 | JAEMBO010000002.1 | GCA021406725_00881 | CDS | open | 11765-12331 | _na 188_aa | pduO | Corrinoid adenosyltransferase |
| 231 | JAEMBO010000002.1 | GCA021406725_00882 | CDS | open | 12328-13824 | _na 498_aa | cobyric acid synthase | |
| 232 | JAEMBO010000002.1 | GCA021406725_00883 | CDS | open | 13817-14824 | _na 335_aa | cobD | threonine-phosphate decarboxylase CobD |
| 233 | JAEMBO010000002.1 | GCA021406725_00884 | CDS | open | 14799-15857 | _na 352_aa | cbiB | adenosylcobinamide-phosphate synthase CbiB |
| 234 | JAEMBO010000002.1 | GCA021406725_00885 | CDS | open | 16533-16985 | _na 150_aa | rsuA | RNA-binding S4 domain-containing protein |
| 235 | JAEMBO010000002.1 | GCA021406725_00886 | CDS | open | 16969-18024 | _na 351_aa | rfaF | ADP-heptose--LPS heptosyltransferase%2C putative |
| 236 | JAEMBO010000002.1 | GCA021406725_00887 | CDS | open | 18108-18713 | _na 201_aa | DUF4254 domain-containing protein | |
| 237 | JAEMBO010000002.1 | GCA021406725_00888 | CDS | open | 18873-19289 | _na 138_aa | hypothetical protein | |
| 238 | JAEMBO010000002.1 | GCA021406725_00889 | CDS | open | 19428-20624 | _na 398_aa | yqdH | Iron-containing alcohol dehydrogenase |
| 239 | JAEMBO010000002.1 | GCA021406725_00890 | CDS | open | 20800-21957 | _na 385_aa | rfaB | Glycosyl transferase%2C group 1 family protein |
| 240 | JAEMBO010000002.1 | GCA021406725_00891 | CDS | open | 23334-25157 | _na 607_aa | fAA1 | Long-chain-fatty-acid-CoA ligase |
| 241 | JAEMBO010000002.1 | GCA021406725_00892 | CDS | open | 25438-26397 | _na 319_aa | prfB | peptide chain release factor 2 |
| 242 | JAEMBO010000002.1 | GCA021406725_00893 | CDS | open | 26553-28004 | _na 483_aa | ugd | UDP-glucose 6-dehydrogenase |
| 243 | JAEMBO010000002.1 | GCA021406725_00894 | CDS | open | 28011-29054 | _na 347_aa | epsG | EpsG family protein |
| 244 | JAEMBO010000002.1 | GCA021406725_00895 | CDS | open | 29246-30397 | _na 383_aa | Glycosyltransferase%2C group 1 family protein | |
| 245 | JAEMBO010000002.1 | GCA021406725_00896 | CDS | open | 30403-31263 | _na 286_aa | wcaE | Glycosyl transferase%2C group 2 family protein |
| 246 | JAEMBO010000002.1 | GCA021406725_00897 | CDS | open | 31383-32510 | _na 375_aa | DUF4369 domain-containing protein | |
| 247 | JAEMBO010000002.1 | GCA021406725_00898 | CDS | open | 32690-33844 | _na 384_aa | wecE | Pigmentation and extracellular proteinase regulator |
| 248 | JAEMBO010000002.1 | GCA021406725_00899 | CDS | open | 33841-35148 | _na 435_aa | rfbX | PorS protein |
| 249 | JAEMBO010000002.1 | GCA021406725_00900 | CDS | open | 35111-36739 | _na 542_aa | asnB | asparagine synthase (glutamine-hydrolyzing) |
| 250 | JAEMBO010000002.1 | GCA021406725_00901 | CDS | open | 36914-37528 | _na 204_aa | wcaJ | Bacterial sugar transferase domain-containing protein |
| 251 | JAEMBO010000002.1 | GCA021406725_00902 | CDS | open | 37655-37837 | _na 60_aa | hypothetical protein | |
| 252 | JAEMBO010000002.1 | GCA021406725_00903 | CDS | open | 38093-39034 | _na 313_aa | trxB | thioredoxin-disulfide reductase |
| 253 | JAEMBO010000002.1 | GCA021406725_00905 | CDS | open | 39361-39813 | _na 150_aa | hypothetical protein | |
| 254 | JAEMBO010000002.1 | GCA021406725_00906 | CDS | open | 39842-42472 | _na 876_aa | valS | valine--tRNA ligase |
| 255 | JAEMBO010000002.1 | GCA021406725_00907 | CDS | open | 43333-45507 | _na 724_aa | TPR domain protein | |
| 256 | JAEMBO010000002.1 | GCA021406725_00908 | CDS | open | 45706-48258 | _na 850_aa | nrdA | adenosylcobalamin-dependent ribonucleoside-diphosphate reductase |
| 257 | JAEMBO010000002.1 | GCA021406725_00909 | CDS | open | 48531-49913 | _na 460_aa | xseA | exodeoxyribonuclease VII large subunit |
| 258 | JAEMBO010000002.1 | GCA021406725_00910 | CDS | open | 49960-50427 | _na 155_aa | lrp | Transcriptional regulator%2C AsnC Family |
| 259 | JAEMBO010000002.1 | GCA021406725_00911 | CDS | open | 50767-51954 | _na 395_aa | uraA | Uracil permease |
| 260 | JAEMBO010000002.1 | GCA021406725_00912 | CDS | open | 51979-52629 | _na 216_aa | SAM-dependent methyltransferase | |
| 261 | JAEMBO010000002.1 | GCA021406725_00913 | CDS | open | 52652-53215 | _na 187_aa | pduO | Corrinoid adenosyltransferase |
| 262 | JAEMBO010000002.1 | GCA021406725_00914 | CDS | open | 53350-54693 | _na 447_aa | purB | adenylosuccinate lyase |
| 263 | JAEMBO010000002.1 | GCA021406725_00915 | CDS | open | 54794-56113 | _na 439_aa | rsuA | Pseudouridine synthase |
| 264 | JAEMBO010000002.1 | GCA021406725_00916 | CDS | open | 56145-57554 | _na 469_aa | asnS | asparagine--tRNA ligase |
| 265 | JAEMBO010000002.1 | GCA021406725_00917 | CDS | open | 58201-58761 | _na 186_aa | fldA | Flavodoxin-like domain-containing protein |
| 266 | JAEMBO010000002.1 | GCA021406725_00918 | CDS | open | 58980-61571 | _na 863_aa | clpB | ATP-dependent chaperone ClpB |
| 267 | JAEMBO010000002.1 | GCA021406725_00919 | CDS | open | 62120-63466 | _na 448_aa | norM | Multidrug-efflux transporter |
| 268 | JAEMBO010000002.1 | GCA021406725_00920 | CDS | open | 63759-64649 | _na 296_aa | folD | bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD |
| 269 | JAEMBO010000002.1 | GCA021406725_00921 | CDS | open | 64770-66107 | _na 445_aa | ffh | signal recognition particle protein |
| 270 | JAEMBO010000002.1 | GCA021406725_00922 | CDS | open | 66184-66540 | _na 118_aa | panD | aspartate 1-decarboxylase |
| 271 | JAEMBO010000002.1 | GCA021406725_00923 | CDS | open | 66750-68054 | _na 434_aa | murF | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase |
| 272 | JAEMBO010000002.1 | GCA021406725_00924 | CDS | open | 68048-69505 | _na 485_aa | rpoN | RNA polymerase factor sigma-54 |
| 273 | JAEMBO010000002.1 | GCA021406725_00925 | CDS | open | 69469-70236 | _na 255_aa | trmN6 | tRNA1(Val) (adenine(37)-N6)-methyltransferase |
| 274 | JAEMBO010000002.1 | GCA021406725_00926 | CDS | open | 70262-71581 | _na 439_aa | rarA | ATPase%2C AAA family |
| 275 | JAEMBO010000002.1 | GCA021406725_00927 | CDS | open | 71650-72108 | _na 152_aa | DNA-binding protein histone-like family | |
| 276 | JAEMBO010000002.1 | GCA021406725_00928 | CDS | open | 72457-73917 | _na 486_aa | putP | Sodium:solute symporter family protein |
| 277 | JAEMBO010000002.1 | GCA021406725_00929 | CDS | open | 73914-74765 | _na 283_aa | badF | BadF/BadG/BcrA/BcrD ATPase family protein |
| 278 | JAEMBO010000002.1 | GCA021406725_00930 | CDS | open | 74758-75582 | _na 274_aa | murQ | N-acetylmuramic acid 6-phosphate etherase |
| 279 | JAEMBO010000002.1 | GCA021406725_00933 | CDS | open | 75919-77142 | _na 407_aa | rsmD | THUMP-like domain-containing protein |
| 280 | JAEMBO010000002.1 | GCA021406725_00934 | CDS | open | 77451-79922 | _na 823_aa | alr | bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase |
| 281 | JAEMBO010000002.1 | GCA021406725_00935 | CDS | open | 79990-80943 | _na 317_aa | GSCFA domain-containing protein | |
| 282 | JAEMBO010000002.1 | GCA021406725_00936 | CDS | open | 81258-82694 | _na 478_aa | rlmD | 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD |
| 283 | JAEMBO010000002.1 | GCA021406725_00937 | CDS | open | 82739-84127 | _na 462_aa | glmM | phosphoglucosamine mutase |
| 284 | JAEMBO010000002.1 | GCA021406725_00938 | CDS | open | 84181-84777 | _na 198_aa | DUF4827 domain-containing protein | |
| 285 | JAEMBO010000002.1 | GCA021406725_00939 | CDS | open | 84868-85911 | _na 347_aa | nrnA | DHH family phosphoesterase |
| 286 | JAEMBO010000002.1 | GCA021406725_00940 | CDS | open | 86670-87407 | _na 245_aa | ompR | DNA-binding response regulator RprY |
| 287 | JAEMBO010000002.1 | GCA021406725_00941 | CDS | open | 87524-88087 | _na 187_aa | rimI | Acetyltransferase%2C GNAT family |
| 288 | JAEMBO010000002.1 | GCA021406725_00942 | CDS | open | 88139-89074 | _na 311_aa | yhcC | TIGR01212 family radical SAM protein |
| 289 | JAEMBO010000002.1 | GCA021406725_00943 | CDS | open | 89428-89676 | _na 82_aa | hypothetical protein | |
| 290 | JAEMBO010000002.1 | GCA021406725_00944 | CDS | open | 89944-91047 | _na 367_aa | trxA | putative thiol:disulfide oxidoreductase |
| 291 | JAEMBO010000002.1 | GCA021406725_00945 | CDS | open | 91188-92036 | _na 282_aa | DUF3108 domain-containing protein | |
| 292 | JAEMBO010000002.1 | GCA021406725_00946 | CDS | open | 92247-93263 | _na 338_aa | pta | phosphate acetyltransferase |
| 293 | JAEMBO010000002.1 | GCA021406725_00947 | CDS | open | 93309-94505 | _na 398_aa | ackA | Acetate kinase |
| 294 | JAEMBO010000002.1 | GCA021406725_00948 | CDS | open | 94675-95520 | _na 281_aa | fadB | 3-hydroxybutyryl-CoA dehydrogenase |
| 295 | JAEMBO010000002.1 | GCA021406725_00949 | CDS | open | 95567-96337 | _na 256_aa | caiD | Enoyl-CoA hydratase/isomerase family protein |
| 296 | JAEMBO010000002.1 | GCA021406725_00950 | CDS | open | 96441-97448 | _na 335_aa | fixB | Electron transfer flavoprotein%2C alpha subunit |
| 297 | JAEMBO010000002.1 | GCA021406725_00951 | CDS | open | 97462-98247 | _na 261_aa | fixA | Electron transfer flavoprotein%2C beta subunit |
| 298 | JAEMBO010000002.1 | GCA021406725_00952 | CDS | open | 98265-99401 | _na 378_aa | caiA | Acyl-CoA dehydrogenase%2C short-chain specific |
| 299 | JAEMBO010000002.1 | GCA021406725_00953 | CDS | open | 99447-100109 | _na 220_aa | atoA | Coenzyme A transferase beta subunit |
| 300 | JAEMBO010000002.1 | GCA021406725_00954 | CDS | open | 100132-100923 | _na 263_aa | mtbC1 | D-lysine 5%2C6-aminomutase%2C beta subunit |
| 301 | JAEMBO010000002.1 | GCA021406725_00955 | CDS | open | 100920-102491 | _na 523_aa | D-lysine 5%2C6-aminomutase%2C alpha subunit | |
| 302 | JAEMBO010000002.1 | GCA021406725_00956 | CDS | open | 102519-103910 | _na 463_aa | mutS | MutS family protein |
| 303 | JAEMBO010000002.1 | GCA021406725_00957 | CDS | open | 103910-104908 | _na 332_aa | yqeC | Selenium-dependent hydroxylase accessory protein YqeC |
| 304 | JAEMBO010000002.1 | GCA021406725_00958 | CDS | open | 105008-106258 | _na 416_aa | ablA | lysine 2%2C3-aminomutase |
| 305 | JAEMBO010000002.1 | GCA021406725_00959 | CDS | open | 106345-107388 | _na 347_aa | qor | Alcohol dehydrogenase%2C zinc-containing%2C putative |
| 306 | JAEMBO010000002.1 | GCA021406725_00960 | CDS | open | 107430-108242 | _na 270_aa | 3-keto-5-aminohexanoate cleavage protein | |
| 307 | JAEMBO010000002.1 | GCA021406725_00961 | CDS | open | 108279-108668 | _na 129_aa | yciA | HotDog ACOT-type domain-containing protein |
| 308 | JAEMBO010000002.1 | GCA021406725_00962 | CDS | open | 108722-109366 | _na 214_aa | atoD | Butyrate-acetoacetate CoA-transferase%2C subunit A |
| 309 | JAEMBO010000002.1 | GCA021406725_00963 | CDS | open | 109637-110506 | _na 289_aa | pyrD | dihydroorotate dehydrogenase |
| 310 | JAEMBO010000002.1 | GCA021406725_00964 | CDS | open | 110542-111339 | _na 265_aa | mcr1 | Dihydroorotate dehydrogenase%2C putative |
| 311 | JAEMBO010000002.1 | GCA021406725_00965 | CDS | open | 111391-111831 | _na 146_aa | vapI | HTH cro/C1-type domain-containing protein |
| 312 | JAEMBO010000002.1 | GCA021406725_00966 | CDS | open | 113275-114363 | _na 362_aa | tnp | ISAs1 family ISPg6 transposase |
| 313 | JAEMBO010000002.1 | GCA021406725_00967 | CDS | open | 114352-114465 | _na 37_aa | hypothetical protein | |
| 314 | JAEMBO010000002.1 | GCA021406725_00968 | CDS | open | 114676-116385 | _na 569_aa | ctpA | Carboxyl-terminal processing protease |
| 315 | JAEMBO010000002.1 | GCA021406725_00969 | CDS | open | 116805-116969 | _na 54_aa | hypothetical protein | |
| 316 | JAEMBO010000002.1 | GCA021406725_00970 | CDS | open | 117142-118848 | _na 568_aa | mdlB | ABC transporter%2C ATP-binding protein%2C putative |
| 317 | JAEMBO010000002.1 | GCA021406725_00971 | CDS | open | 118895-120649 | _na 584_aa | mdlB | ABC transporter ATP-binding protein |
| 318 | JAEMBO010000002.1 | GCA021406725_00972 | CDS | open | 120674-121951 | _na 425_aa | Porin | |
| 319 | JAEMBO010000002.1 | GCA021406725_00973 | CDS | open | 121955-122746 | _na 263_aa | Outer membrane lipoprotein-sorting protein | |
| 320 | JAEMBO010000002.1 | GCA021406725_00974 | CDS | open | 122824-125229 | _na 801_aa | mMPL | SSD domain-containing protein |
| 321 | JAEMBO010000002.1 | GCA021406725_00975 | CDS | open | 125270-125869 | _na 199_aa | acrR | Transcriptional regulator%2C tetR family |
| 322 | JAEMBO010000002.1 | GCA021406725_00872 | gene | open | 248-721 | paaI | ||
| 323 | JAEMBO010000002.1 | GCA021406725_00873 | gene | open | 832-1416 | lutC | ||
| 324 | JAEMBO010000002.1 | GCA021406725_00874 | gene | open | 1422-2789 | lutB | ||
| 325 | JAEMBO010000002.1 | GCA021406725_00875 | gene | open | 2786-3607 | glpC | ||
| 326 | JAEMBO010000002.1 | GCA021406725_00876 | gene | open | 3847-4719 | serB | ||
| 327 | JAEMBO010000002.1 | GCA021406725_00877 | gene | open | 5415-5636 | |||
| 328 | JAEMBO010000002.1 | GCA021406725_00878 | gene | open | 5709-6425 | csx27 | ||
| 329 | JAEMBO010000002.1 | GCA021406725_00879 | gene | open | 6422-9829 | cas13b | ||
| 330 | JAEMBO010000002.1 | GCA021406725_00880 | gene | open | 10423-11742 | cobB | ||
| 331 | JAEMBO010000002.1 | GCA021406725_00881 | gene | open | 11765-12331 | pduO | ||
| 332 | JAEMBO010000002.1 | GCA021406725_00882 | gene | open | 12328-13824 | |||
| 333 | JAEMBO010000002.1 | GCA021406725_00883 | gene | open | 13817-14824 | cobD | ||
| 334 | JAEMBO010000002.1 | GCA021406725_00884 | gene | open | 14799-15857 | cbiB | ||
| 335 | JAEMBO010000002.1 | GCA021406725_00885 | gene | open | 16533-16985 | rsuA | ||
| 336 | JAEMBO010000002.1 | GCA021406725_00886 | gene | open | 16969-18024 | rfaF | ||
| 337 | JAEMBO010000002.1 | GCA021406725_00887 | gene | open | 18108-18713 | |||
| 338 | JAEMBO010000002.1 | GCA021406725_00888 | gene | open | 18873-19289 | |||
| 339 | JAEMBO010000002.1 | GCA021406725_00889 | gene | open | 19428-20624 | yqdH | ||
| 340 | JAEMBO010000002.1 | GCA021406725_00890 | gene | open | 20800-21957 | rfaB | ||
| 341 | JAEMBO010000002.1 | GCA021406725_00891 | gene | open | 23334-25157 | fAA1 | ||
| 342 | JAEMBO010000002.1 | GCA021406725_00892 | gene | open | 25438-26397 | prfB | ||
| 343 | JAEMBO010000002.1 | GCA021406725_00893 | gene | open | 26553-28004 | ugd | ||
| 344 | JAEMBO010000002.1 | GCA021406725_00894 | gene | open | 28011-29054 | epsG | ||
| 345 | JAEMBO010000002.1 | GCA021406725_00895 | gene | open | 29246-30397 | |||
| 346 | JAEMBO010000002.1 | GCA021406725_00896 | gene | open | 30403-31263 | wcaE | ||
| 347 | JAEMBO010000002.1 | GCA021406725_00897 | gene | open | 31383-32510 | |||
| 348 | JAEMBO010000002.1 | GCA021406725_00898 | gene | open | 32690-33844 | wecE | ||
| 349 | JAEMBO010000002.1 | GCA021406725_00899 | gene | open | 33841-35148 | rfbX | ||
| 350 | JAEMBO010000002.1 | GCA021406725_00900 | gene | open | 35111-36739 | asnB | ||
| 351 | JAEMBO010000002.1 | GCA021406725_00901 | gene | open | 36914-37528 | wcaJ | ||
| 352 | JAEMBO010000002.1 | GCA021406725_00902 | gene | open | 37655-37837 | |||
| 353 | JAEMBO010000002.1 | GCA021406725_00903 | gene | open | 38093-39034 | trxB | ||
| 354 | JAEMBO010000002.1 | GCA021406725_00905 | gene | open | 39361-39813 | |||
| 355 | JAEMBO010000002.1 | GCA021406725_00906 | gene | open | 39842-42472 | valS | ||
| 356 | JAEMBO010000002.1 | GCA021406725_00907 | gene | open | 43333-45507 | |||
| 357 | JAEMBO010000002.1 | GCA021406725_00908 | gene | open | 45706-48258 | nrdA | ||
| 358 | JAEMBO010000002.1 | GCA021406725_00909 | gene | open | 48531-49913 | xseA | ||
| 359 | JAEMBO010000002.1 | GCA021406725_00910 | gene | open | 49960-50427 | lrp | ||
| 360 | JAEMBO010000002.1 | GCA021406725_00911 | gene | open | 50767-51954 | uraA | ||
| 361 | JAEMBO010000002.1 | GCA021406725_00912 | gene | open | 51979-52629 | |||
| 362 | JAEMBO010000002.1 | GCA021406725_00913 | gene | open | 52652-53215 | pduO | ||
| 363 | JAEMBO010000002.1 | GCA021406725_00914 | gene | open | 53350-54693 | purB | ||
| 364 | JAEMBO010000002.1 | GCA021406725_00915 | gene | open | 54794-56113 | rsuA | ||
| 365 | JAEMBO010000002.1 | GCA021406725_00916 | gene | open | 56145-57554 | asnS | ||
| 366 | JAEMBO010000002.1 | GCA021406725_00917 | gene | open | 58201-58761 | fldA | ||
| 367 | JAEMBO010000002.1 | GCA021406725_00918 | gene | open | 58980-61571 | clpB | ||
| 368 | JAEMBO010000002.1 | GCA021406725_00919 | gene | open | 62120-63466 | norM | ||
| 369 | JAEMBO010000002.1 | GCA021406725_00920 | gene | open | 63759-64649 | folD | ||
| 370 | JAEMBO010000002.1 | GCA021406725_00921 | gene | open | 64770-66107 | ffh | ||
| 371 | JAEMBO010000002.1 | GCA021406725_00922 | gene | open | 66184-66540 | panD | ||
| 372 | JAEMBO010000002.1 | GCA021406725_00923 | gene | open | 66750-68054 | murF | ||
| 373 | JAEMBO010000002.1 | GCA021406725_00924 | gene | open | 68048-69505 | rpoN | ||
| 374 | JAEMBO010000002.1 | GCA021406725_00925 | gene | open | 69469-70236 | trmN6 | ||
| 375 | JAEMBO010000002.1 | GCA021406725_00926 | gene | open | 70262-71581 | rarA | ||
| 376 | JAEMBO010000002.1 | GCA021406725_00927 | gene | open | 71650-72108 | |||
| 377 | JAEMBO010000002.1 | GCA021406725_00928 | gene | open | 72457-73917 | putP | ||
| 378 | JAEMBO010000002.1 | GCA021406725_00929 | gene | open | 73914-74765 | badF | ||
| 379 | JAEMBO010000002.1 | GCA021406725_00930 | gene | open | 74758-75582 | murQ | ||
| 380 | JAEMBO010000002.1 | GCA021406725_00933 | gene | open | 75919-77142 | rsmD | ||
| 381 | JAEMBO010000002.1 | GCA021406725_00934 | gene | open | 77451-79922 | alr | ||
| 382 | JAEMBO010000002.1 | GCA021406725_00935 | gene | open | 79990-80943 | |||
| 383 | JAEMBO010000002.1 | GCA021406725_00936 | gene | open | 81258-82694 | rlmD | ||
| 384 | JAEMBO010000002.1 | GCA021406725_00937 | gene | open | 82739-84127 | glmM | ||
| 385 | JAEMBO010000002.1 | GCA021406725_00938 | gene | open | 84181-84777 | |||
| 386 | JAEMBO010000002.1 | GCA021406725_00939 | gene | open | 84868-85911 | nrnA | ||
| 387 | JAEMBO010000002.1 | GCA021406725_00940 | gene | open | 86670-87407 | ompR | ||
| 388 | JAEMBO010000002.1 | GCA021406725_00941 | gene | open | 87524-88087 | rimI | ||
| 389 | JAEMBO010000002.1 | GCA021406725_00942 | gene | open | 88139-89074 | yhcC | ||
| 390 | JAEMBO010000002.1 | GCA021406725_00943 | gene | open | 89428-89676 | |||
| 391 | JAEMBO010000002.1 | GCA021406725_00944 | gene | open | 89944-91047 | trxA | ||
| 392 | JAEMBO010000002.1 | GCA021406725_00945 | gene | open | 91188-92036 | |||
| 393 | JAEMBO010000002.1 | GCA021406725_00946 | gene | open | 92247-93263 | pta | ||
| 394 | JAEMBO010000002.1 | GCA021406725_00947 | gene | open | 93309-94505 | ackA | ||
| 395 | JAEMBO010000002.1 | GCA021406725_00948 | gene | open | 94675-95520 | fadB | ||
| 396 | JAEMBO010000002.1 | GCA021406725_00949 | gene | open | 95567-96337 | caiD | ||
| 397 | JAEMBO010000002.1 | GCA021406725_00950 | gene | open | 96441-97448 | fixB | ||
| 398 | JAEMBO010000002.1 | GCA021406725_00951 | gene | open | 97462-98247 | fixA | ||
| 399 | JAEMBO010000002.1 | GCA021406725_00952 | gene | open | 98265-99401 | caiA | ||
| 400 | JAEMBO010000002.1 | GCA021406725_00953 | gene | open | 99447-100109 | atoA | ||
| 401 | JAEMBO010000002.1 | GCA021406725_00954 | gene | open | 100132-100923 | mtbC1 | ||
| 402 | JAEMBO010000002.1 | GCA021406725_00955 | gene | open | 100920-102491 | |||
| 403 | JAEMBO010000002.1 | GCA021406725_00956 | gene | open | 102519-103910 | mutS | ||
| 404 | JAEMBO010000002.1 | GCA021406725_00957 | gene | open | 103910-104908 | yqeC | ||
| 405 | JAEMBO010000002.1 | GCA021406725_00958 | gene | open | 105008-106258 | ablA | ||
| 406 | JAEMBO010000002.1 | GCA021406725_00959 | gene | open | 106345-107388 | qor | ||
| 407 | JAEMBO010000002.1 | GCA021406725_00960 | gene | open | 107430-108242 | |||
| 408 | JAEMBO010000002.1 | GCA021406725_00961 | gene | open | 108279-108668 | yciA | ||
| 409 | JAEMBO010000002.1 | GCA021406725_00962 | gene | open | 108722-109366 | atoD | ||
| 410 | JAEMBO010000002.1 | GCA021406725_00963 | gene | open | 109637-110506 | pyrD | ||
| 411 | JAEMBO010000002.1 | GCA021406725_00964 | gene | open | 110542-111339 | mcr1 | ||
| 412 | JAEMBO010000002.1 | GCA021406725_00965 | gene | open | 111391-111831 | vapI | ||
| 413 | JAEMBO010000002.1 | GCA021406725_00966 | gene | open | 113275-114363 | tnp | ||
| 414 | JAEMBO010000002.1 | GCA021406725_00967 | gene | open | 114352-114465 | |||
| 415 | JAEMBO010000002.1 | GCA021406725_00968 | gene | open | 114676-116385 | ctpA | ||
| 416 | JAEMBO010000002.1 | GCA021406725_00969 | gene | open | 116805-116969 | |||
| 417 | JAEMBO010000002.1 | GCA021406725_00970 | gene | open | 117142-118848 | mdlB | ||
| 418 | JAEMBO010000002.1 | GCA021406725_00971 | gene | open | 118895-120649 | mdlB | ||
| 419 | JAEMBO010000002.1 | GCA021406725_00972 | gene | open | 120674-121951 | |||
| 420 | JAEMBO010000002.1 | GCA021406725_00973 | gene | open | 121955-122746 | |||
| 421 | JAEMBO010000002.1 | GCA021406725_00974 | gene | open | 122824-125229 | mMPL | ||
| 422 | JAEMBO010000002.1 | GCA021406725_00975 | gene | open | 125270-125869 | acrR | ||
| 423 | JAEMBO010000002.1 | GCA021406725_00904 | gene | open | 39228-39300 | trnT | ||
| 424 | JAEMBO010000002.1 | GCA021406725_00931 | gene | open | 75677-75750 | trnR | ||
| 425 | JAEMBO010000002.1 | GCA021406725_00932 | gene | open | 75786-75859 | trnR | ||
| 426 | JAEMBO010000002.1 | GCA021406725_00904 | tRNA | open | 39228-39300 | trnT | tRNA-Thr(cgt) | |
| 427 | JAEMBO010000002.1 | GCA021406725_00931 | tRNA | open | 75677-75750 | trnR | tRNA-Arg(acg) | |
| 428 | JAEMBO010000002.1 | GCA021406725_00932 | tRNA | open | 75786-75859 | trnR | tRNA-Arg(acg) | |
| 429 | JAEMBO010000003.1 | GCA021406725_01361 | CDS | open | 113-259 | _na 48_aa | hypothetical protein | |
| 430 | JAEMBO010000003.1 | GCA021406725_01362 | CDS | open | 282-1883 | _na 533_aa | ctpA | Carboxyl-terminal processing protease |
| 431 | JAEMBO010000003.1 | GCA021406725_01363 | CDS | open | 1955-3475 | _na 506_aa | Right-handed parallel beta-helix repeat-containing protein | |
| 432 | JAEMBO010000003.1 | GCA021406725_01364 | CDS | open | 3509-4177 | _na 222_aa | ung | uracil-DNA glycosylase |
| 433 | JAEMBO010000003.1 | GCA021406725_01365 | CDS | open | 4658-4855 | _na 65_aa | hypothetical protein | |
| 434 | JAEMBO010000003.1 | GCA021406725_01366 | CDS | open | 5514-6224 | _na 236_aa | Repressor | |
| 435 | JAEMBO010000003.1 | GCA021406725_01367 | CDS | open | 6309-6695 | _na 128_aa | hypothetical protein | |
| 436 | JAEMBO010000003.1 | GCA021406725_01368 | CDS | open | 6700-7083 | _na 127_aa | yopX | YopX protein domain-containing protein |
| 437 | JAEMBO010000003.1 | GCA021406725_01369 | CDS | open | 7087-7536 | _na 149_aa | hypothetical protein | |
| 438 | JAEMBO010000003.1 | GCA021406725_01371 | CDS | open | 7712-9760 | _na 682_aa | Transposase family protein | |
| 439 | JAEMBO010000003.1 | GCA021406725_01372 | CDS | open | 9778-10152 | _na 124_aa | hypothetical protein | |
| 440 | JAEMBO010000003.1 | GCA021406725_01373 | CDS | open | 10179-11039 | _na 286_aa | ATP-binding protein | |
| 441 | JAEMBO010000003.1 | GCA021406725_01374 | CDS | open | 11039-11767 | _na 242_aa | AAA+ ATPase domain-containing protein | |
| 442 | JAEMBO010000003.1 | GCA021406725_01375 | CDS | open | 11742-11924 | _na 60_aa | hypothetical protein | |
| 443 | JAEMBO010000003.1 | GCA021406725_01376 | CDS | open | 11921-12199 | _na 92_aa | hypothetical protein | |
| 444 | JAEMBO010000003.1 | GCA021406725_01377 | CDS | open | 12196-12627 | _na 143_aa | hypothetical protein | |
| 445 | JAEMBO010000003.1 | GCA021406725_01378 | CDS | open | 12644-12859 | _na 71_aa | hypothetical protein | |
| 446 | JAEMBO010000003.1 | GCA021406725_01379 | CDS | open | 12881-13402 | _na 173_aa | Host-nuclease inhibitor Gam family protein | |
| 447 | JAEMBO010000003.1 | GCA021406725_01380 | CDS | open | 13399-13794 | _na 131_aa | DUF4494 domain-containing protein | |
| 448 | JAEMBO010000003.1 | GCA021406725_01381 | CDS | open | 13791-14183 | _na 130_aa | Hydrolase | |
| 449 | JAEMBO010000003.1 | GCA021406725_01382 | CDS | open | 14288-14647 | _na 119_aa | hypothetical protein | |
| 450 | JAEMBO010000003.1 | GCA021406725_01383 | CDS | open | 14697-15038 | _na 113_aa | hypothetical protein | |
| 451 | JAEMBO010000003.1 | GCA021406725_01384 | CDS | open | 15035-15469 | _na 144_aa | Tail completion | |
| 452 | JAEMBO010000003.1 | GCA021406725_01385 | CDS | open | 15473-15973 | _na 166_aa | Phage virion morphogenesis protein | |
| 453 | JAEMBO010000003.1 | GCA021406725_01386 | CDS | open | 16225-18783 | _na 852_aa | DUF935 domain-containing protein | |
| 454 | JAEMBO010000003.1 | GCA021406725_01387 | CDS | open | 18787-19212 | _na 141_aa | DUF1320 domain-containing protein | |
| 455 | JAEMBO010000003.1 | GCA021406725_01388 | CDS | open | 19214-20764 | _na 516_aa | Terminase | |
| 456 | JAEMBO010000003.1 | GCA021406725_01389 | CDS | open | 20767-21216 | _na 149_aa | Terminase SSU | |
| 457 | JAEMBO010000003.1 | GCA021406725_01390 | CDS | open | 21387-22376 | _na 329_aa | Phage protease | |
| 458 | JAEMBO010000003.1 | GCA021406725_01391 | CDS | open | 22394-23299 | _na 301_aa | Major capsid | |
| 459 | JAEMBO010000003.1 | GCA021406725_01392 | CDS | open | 23299-23772 | _na 157_aa | N-acetylmuramoyl-L-alanine amidase | |
| 460 | JAEMBO010000003.1 | GCA021406725_01393 | CDS | open | 23780-24169 | _na 129_aa | hypothetical protein | |
| 461 | JAEMBO010000003.1 | GCA021406725_01394 | CDS | open | 24186-24632 | _na 148_aa | hypothetical protein | |
| 462 | JAEMBO010000003.1 | GCA021406725_01395 | CDS | open | 24890-25363 | _na 157_aa | Phage tail protein | |
| 463 | JAEMBO010000003.1 | GCA021406725_01396 | CDS | open | 25363-25842 | _na 159_aa | hypothetical protein | |
| 464 | JAEMBO010000003.1 | GCA021406725_01397 | CDS | open | 25953-26078 | _na 41_aa | hypothetical protein | |
| 465 | JAEMBO010000003.1 | GCA021406725_01398 | CDS | open | 26053-29748 | _na 1231_aa | Tail tape measure protein | |
| 466 | JAEMBO010000003.1 | GCA021406725_01399 | CDS | open | 29745-30269 | _na 174_aa | Receptor binding | |
| 467 | JAEMBO010000003.1 | GCA021406725_01400 | CDS | open | 30247-32892 | _na 881_aa | Tail | |
| 468 | JAEMBO010000003.1 | GCA021406725_01401 | CDS | open | 32900-34591 | _na 563_aa | Tail | |
| 469 | JAEMBO010000003.1 | GCA021406725_01402 | CDS | open | 34598-34795 | _na 65_aa | hypothetical protein | |
| 470 | JAEMBO010000003.1 | GCA021406725_01403 | CDS | open | 34797-35921 | _na 374_aa | Tail | |
| 471 | JAEMBO010000003.1 | GCA021406725_01404 | CDS | open | 35921-37231 | _na 436_aa | Tail | |
| 472 | JAEMBO010000003.1 | GCA021406725_01405 | CDS | open | 37481-37609 | _na 42_aa | Acr candidate | |
| 473 | JAEMBO010000003.1 | GCA021406725_01406 | CDS | open | 37606-38739 | _na 377_aa | N-acetyltransferase domain-containing protein | |
| 474 | JAEMBO010000003.1 | GCA021406725_01407 | CDS | open | 38736-39209 | _na 157_aa | Formyl transferase | |
| 475 | JAEMBO010000003.1 | GCA021406725_01408 | CDS | open | 39699-40514 | _na 271_aa | yigB | YjjG family noncanonical pyrimidine nucleotidase |
| 476 | JAEMBO010000003.1 | GCA021406725_01409 | CDS | open | 40664-41551 | _na 295_aa | Lipoprotein | |
| 477 | JAEMBO010000003.1 | GCA021406725_01410 | CDS | open | 41563-42264 | _na 233_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 478 | JAEMBO010000003.1 | GCA021406725_01411 | CDS | open | 42280-42756 | _na 158_aa | hypothetical protein | |
| 479 | JAEMBO010000003.1 | GCA021406725_01412 | CDS | open | 42813-43025 | _na 70_aa | hypothetical protein | |
| 480 | JAEMBO010000003.1 | GCA021406725_01413 | CDS | open | 43077-44189 | _na 370_aa | uspA | Universal stress family protein |
| 481 | JAEMBO010000003.1 | GCA021406725_01414 | CDS | open | 44354-44608 | _na 84_aa | DNA-binding protein | |
| 482 | JAEMBO010000003.1 | GCA021406725_01415 | CDS | open | 44815-45147 | _na 110_aa | sUI1 | putative translation initation factor SUI1 |
| 483 | JAEMBO010000003.1 | GCA021406725_01416 | CDS | open | 45244-47103 | _na 619_aa | oadA1 | Oxaloacetate decarboxylase%2C putative |
| 484 | JAEMBO010000003.1 | GCA021406725_01417 | CDS | open | 47210-47533 | _na 107_aa | hypothetical protein | |
| 485 | JAEMBO010000003.1 | GCA021406725_01418 | CDS | open | 47962-48420 | _na 152_aa | rimP | ribosome assembly cofactor RimP |
| 486 | JAEMBO010000003.1 | GCA021406725_01419 | CDS | open | 48466-49800 | _na 444_aa | nusA | Transcription termination/antitermination protein NusA |
| 487 | JAEMBO010000003.1 | GCA021406725_01420 | CDS | open | 49893-52832 | _na 979_aa | infB | translation initiation factor IF-2 |
| 488 | JAEMBO010000003.1 | GCA021406725_01421 | CDS | open | 52860-53351 | _na 163_aa | cvpA | CvpA family protein |
| 489 | JAEMBO010000003.1 | GCA021406725_01422 | CDS | open | 53385-54830 | _na 481_aa | sufB | Fe-S cluster assembly protein SufB |
| 490 | JAEMBO010000003.1 | GCA021406725_01423 | CDS | open | 54870-55622 | _na 250_aa | sufC | Fe-S cluster assembly ATPase SufC |
| 491 | JAEMBO010000003.1 | GCA021406725_01424 | CDS | open | 55629-56972 | _na 447_aa | sufD | Fe-S cluster assembly protein SufD |
| 492 | JAEMBO010000003.1 | GCA021406725_01425 | CDS | open | 57937-59229 | _na 430_aa | tyrS | tyrosine--tRNA ligase |
| 493 | JAEMBO010000003.1 | GCA021406725_01426 | CDS | open | 59249-60316 | _na 355_aa | wcaE | Glycosyl transferase%2C group 2 family protein |
| 494 | JAEMBO010000003.1 | GCA021406725_01427 | CDS | open | 61602-63395 | _na 597_aa | argS | arginine--tRNA ligase |
| 495 | JAEMBO010000003.1 | GCA021406725_01428 | CDS | open | 63400-64485 | _na 361_aa | mnmA | tRNA 2-thiouridine(34) synthase MnmA |
| 496 | JAEMBO010000003.1 | GCA021406725_01429 | CDS | open | 64530-65294 | _na 254_aa | xthA | exodeoxyribonuclease III |
| 497 | JAEMBO010000003.1 | GCA021406725_01430 | CDS | open | 65367-66293 | _na 308_aa | oxyR | Redox-sensitive transcriptional activator OxyR |
| 498 | JAEMBO010000003.1 | GCA021406725_01431 | CDS | open | 66344-66814 | _na 156_aa | ssb | Single-stranded DNA-binding protein |
| 499 | JAEMBO010000003.1 | GCA021406725_01432 | CDS | open | 66832-68160 | _na 442_aa | mpfA | CBS domain protein |
| 500 | JAEMBO010000003.1 | GCA021406725_01433 | CDS | open | 68196-68792 | _na 198_aa | sfp | 4'-phosphopantetheinyl transferase domain-containing protein |

