HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406745.1)

Select a Genome:
BAKTA Annotations for GCA_021406745.1
Genome Selected: Porphyromonas gingivalis
ContigsBases CDSrRNA tmRNAtRNA
89 2282399 1950 3 1 46
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4021 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4021 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 JAEMBK010000001.1 repeat_region open 61741-62116 CRISPR array with 6 repeats of length 36%2C consensus sequence GTTGGATCTACCCTCTATTCGAAGGGTACACACAAC and spacer length 30
2 JAEMBK010000001.1 GCA021406745_00466 CDS open 61-1278 _na     405_aa Site-specific recombinase%2C phage integrase family
3 JAEMBK010000001.1 GCA021406745_00467 CDS open 1415-2944 _na     509_aa ADP-ribosylglycohydrolase
4 JAEMBK010000001.1 GCA021406745_00468 CDS open 2941-3603 _na     220_aa darT DarT domain-containing protein
5 JAEMBK010000001.1 GCA021406745_00469 CDS open 3606-5282 _na     558_aa DNA 3'-5' helicase
6 JAEMBK010000001.1 GCA021406745_00470 CDS open 5257-5388 _na     43_aa hypothetical protein
7 JAEMBK010000001.1 GCA021406745_00471 CDS open 5449-5787 _na     112_aa Helix-turn-helix domain-containing protein
8 JAEMBK010000001.1 GCA021406745_00472 CDS open 5796-6071 _na     91_aa Helix-turn-helix domain-containing protein
9 JAEMBK010000001.1 GCA021406745_00473 CDS open 6692-7726 _na     344_aa Virulence-associated protein E-like domain-containing protein
10 JAEMBK010000001.1 GCA021406745_00474 CDS open 8037-8546 _na     169_aa hypothetical protein
11 JAEMBK010000001.1 GCA021406745_00475 CDS open 8560-8970 _na     136_aa hypothetical protein
12 JAEMBK010000001.1 GCA021406745_00476 CDS open 9303-10559 _na     418_aa mobV MobV family relaxase
13 JAEMBK010000001.1 GCA021406745_00477 CDS open 10687-11601 _na     304_aa DUF1837 domain-containing protein
14 JAEMBK010000001.1 GCA021406745_00478 CDS open 11568-13880 _na     770_aa Helicase C-terminal domain-containing protein
15 JAEMBK010000001.1 GCA021406745_00479 CDS open 14107-14307 _na     66_aa DUF1661 domain-containing protein
16 JAEMBK010000001.1 GCA021406745_00480 CDS open 14346-15236 _na     296_aa wcaE Glycosyltransferase 2-like domain-containing protein
17 JAEMBK010000001.1 GCA021406745_00481 CDS open 15251-16375 _na     374_aa dprA DNA-processing protein DprA
18 JAEMBK010000001.1 GCA021406745_00482 CDS open 16368-20072 _na     1234_aa purL phosphoribosylformylglycinamidine synthase
19 JAEMBK010000001.1 GCA021406745_00483 CDS open 20325-20759 _na     144_aa hypothetical protein
20 JAEMBK010000001.1 GCA021406745_00484 CDS open 21729-22937 _na     402_aa cpoB TPR domain protein
21 JAEMBK010000001.1 GCA021406745_00485 CDS open 23293-23715 _na     140_aa rseC Positive regulator of sigma(E)%2C RseC/MucC
22 JAEMBK010000001.1 GCA021406745_00486 CDS open 23725-24597 _na     290_aa rnfB Fe-S cluster domain-containing protein
23 JAEMBK010000001.1 GCA021406745_00487 CDS open 24633-25964 _na     443_aa rsxC electron transport complex subunit RsxC
24 JAEMBK010000001.1 GCA021406745_00488 CDS open 25980-26963 _na     327_aa rnfD Ion-translocating oxidoreductase complex subunit D
25 JAEMBK010000001.1 GCA021406745_00489 CDS open 26960-27637 _na     225_aa rnfG Ion-translocating oxidoreductase complex subunit G
26 JAEMBK010000001.1 GCA021406745_00490 CDS open 27634-28224 _na     196_aa rnfE Ion-translocating oxidoreductase complex subunit E
27 JAEMBK010000001.1 GCA021406745_00491 CDS open 28249-28821 _na     190_aa rnfA Ion-translocating oxidoreductase complex subunit A
28 JAEMBK010000001.1 GCA021406745_00492 CDS open 29039-30052 _na     337_aa apbE FAD:protein FMN transferase
29 JAEMBK010000001.1 GCA021406745_00493 CDS open 30049-30588 _na     179_aa nfnB Nitroreductase family protein
30 JAEMBK010000001.1 GCA021406745_00494 CDS open 30588-31541 _na     317_aa wcaA Glycosyl transferase%2C group 2 family protein
31 JAEMBK010000001.1 GCA021406745_00495 CDS open 31538-32077 _na     179_aa DUF4199 domain-containing protein
32 JAEMBK010000001.1 GCA021406745_00496 CDS open 32813-33130 _na     105_aa rplU 50S ribosomal protein L21
33 JAEMBK010000001.1 GCA021406745_00497 CDS open 33158-33415 _na     85_aa rpmA 50S ribosomal protein L27
34 JAEMBK010000001.1 GCA021406745_00498 CDS open 33515-34786 _na     423_aa serS serine--tRNA ligase
35 JAEMBK010000001.1 GCA021406745_00499 CDS open 34799-37459 _na     886_aa Peptidase family M49
36 JAEMBK010000001.1 GCA021406745_00500 CDS open 38072-38455 _na     127_aa DUF1573 domain-containing protein
37 JAEMBK010000001.1 GCA021406745_00501 CDS open 38487-39575 _na     362_aa DUF1573 domain-containing protein
38 JAEMBK010000001.1 GCA021406745_00502 CDS open 39651-40757 _na     368_aa meaB methylmalonyl Co-A mutase-associated GTPase MeaB
39 JAEMBK010000001.1 GCA021406745_00503 CDS open 40786-41964 _na     392_aa gltP Serine/threonine transporter
40 JAEMBK010000001.1 GCA021406745_00504 CDS open 42087-42416 _na     109_aa qdoI Cupin type-2 domain-containing protein
41 JAEMBK010000001.1 GCA021406745_00505 CDS open 42617-44122 _na     501_aa hutH histidine ammonia-lyase
42 JAEMBK010000001.1 GCA021406745_00506 CDS open 44113-44742 _na     209_aa ftcD Cyclodeaminase/cyclohydrolase domain-containing protein
43 JAEMBK010000001.1 GCA021406745_00507 CDS open 44767-45894 _na     375_aa lomR Porin
44 JAEMBK010000001.1 GCA021406745_00508 CDS open 45935-47089 _na     384_aa Nucleoside transporter/FeoB GTPase Gate domain-containing protein
45 JAEMBK010000001.1 GCA021406745_00509 CDS open 47183-48433 _na     416_aa hutI imidazolonepropionase
46 JAEMBK010000001.1 GCA021406745_00510 CDS open 48555-49457 _na     300_aa ftcD glutamate formimidoyltransferase
47 JAEMBK010000001.1 GCA021406745_00511 CDS open 49498-50493 _na     331_aa Lipoprotein
48 JAEMBK010000001.1 GCA021406745_00512 CDS open 50526-51044 _na     172_aa hupA DNA-binding protein%2C histone-like family
49 JAEMBK010000001.1 GCA021406745_00513 CDS open 51720-53684 _na     654_aa rho transcription termination factor Rho
50 JAEMBK010000001.1 GCA021406745_00514 CDS open 53912-54820 _na     302_aa rhaT EamA domain-containing protein
51 JAEMBK010000001.1 GCA021406745_00515 CDS open 54831-55790 _na     319_aa wcaA Glycosyl transferase%2C group 2 family protein
52 JAEMBK010000001.1 GCA021406745_00516 CDS open 55843-56745 _na     300_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
53 JAEMBK010000001.1 GCA021406745_00517 CDS open 56765-57334 _na     189_aa Plasmid pRiA4b Orf3-like domain-containing protein
54 JAEMBK010000001.1 GCA021406745_00518 CDS open 57622-60981 _na     1119_aa cas13b type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b
55 JAEMBK010000001.1 GCA021406745_00519 CDS open 60989-61531 _na     180_aa csx28 CRISPR-associated protein Csx28
56 JAEMBK010000001.1 GCA021406745_00520 CDS open 62593-62706 _na     37_aa hypothetical protein
57 JAEMBK010000001.1 GCA021406745_00521 CDS open 62920-64101 _na     393_aa megL methionine gamma-lyase
58 JAEMBK010000001.1 GCA021406745_00522 CDS open 64282-65751 _na     489_aa cpdA Metallophosphoesterase family protein
59 JAEMBK010000001.1 GCA021406745_00523 CDS open 65754-66347 _na     197_aa Histidine kinase
60 JAEMBK010000001.1 GCA021406745_00524 CDS open 66448-67053 _na     201_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
61 JAEMBK010000001.1 GCA021406745_00525 CDS open 67063-68091 _na     342_aa galE UDP-glucose 4-epimerase GalE
62 JAEMBK010000001.1 GCA021406745_00526 CDS open 68134-70230 _na     698_aa recG ATP-dependent DNA helicase RecG
63 JAEMBK010000001.1 GCA021406745_00527 CDS open 70248-71000 _na     250_aa ycjU Hydrolase%2C haloacid dehalogenase-like family
64 JAEMBK010000001.1 GCA021406745_00528 CDS open 71095-72489 _na     464_aa yopM Internalin
65 JAEMBK010000001.1 GCA021406745_00529 CDS open 72917-74497 _na     526_aa nanH exo-alpha-sialidase
66 JAEMBK010000001.1 GCA021406745_00530 CDS open 74444-74572 _na     42_aa hypothetical protein
67 JAEMBK010000001.1 GCA021406745_00531 CDS open 75433-76359 _na     308_aa hypothetical protein
68 JAEMBK010000001.1 GCA021406745_00532 CDS open 76388-77125 _na     245_aa sIMPL SIMPL domain-containing protein
69 JAEMBK010000001.1 GCA021406745_00533 CDS open 77172-78086 _na     304_aa pyrB aspartate carbamoyltransferase
70 JAEMBK010000001.1 GCA021406745_00534 CDS open 78114-78554 _na     146_aa pyrI aspartate carbamoyltransferase regulatory subunit
71 JAEMBK010000001.1 GCA021406745_00535 CDS open 78583-79170 _na     195_aa rutF Putative flavoredoxin
72 JAEMBK010000001.1 GCA021406745_00536 CDS open 79214-79804 _na     196_aa lemA LemA protein
73 JAEMBK010000001.1 GCA021406745_00537 CDS open 79826-81133 _na     435_aa rPS27A TPM domain-containing protein
74 JAEMBK010000001.1 GCA021406745_00538 CDS open 81141-83201 _na     686_aa TonB-dependent receptor
75 JAEMBK010000001.1 GCA021406745_00539 CDS open 83208-84029 _na     273_aa mltF Solute-binding protein family 3/N-terminal domain-containing protein
76 JAEMBK010000001.1 GCA021406745_00540 CDS open 84092-85297 _na     401_aa rlmK PUA domain-containing protein
77 JAEMBK010000001.1 GCA021406745_00541 CDS open 85294-85896 _na     200_aa rnd 3'-5' exonuclease domain protein
78 JAEMBK010000001.1 GCA021406745_00542 CDS open 85937-86497 _na     186_aa DUF5063 domain-containing protein
79 JAEMBK010000001.1 GCA021406745_00543 CDS open 86836-86934 _na     32_aa hypothetical protein
80 JAEMBK010000001.1 GCA021406745_00544 CDS open 86952-88886 _na     644_aa gyrB DNA topoisomerase (ATP-hydrolyzing)
81 JAEMBK010000001.1 GCA021406745_00545 CDS open 88917-89378 _na     153_aa coaD pantetheine-phosphate adenylyltransferase
82 JAEMBK010000001.1 GCA021406745_00546 CDS open 90416-91084 _na     222_aa Outer membrane protein beta-barrel domain-containing protein
83 JAEMBK010000001.1 GCA021406745_00547 CDS open 91645-92100 _na     151_aa rplM 50S ribosomal protein L13
84 JAEMBK010000001.1 GCA021406745_00548 CDS open 92110-92496 _na     128_aa rpsI 30S ribosomal protein S9
85 JAEMBK010000001.1 GCA021406745_00549 CDS open 92631-93476 _na     281_aa rpsB 30S ribosomal protein S2
86 JAEMBK010000001.1 GCA021406745_00550 CDS open 93615-94439 _na     274_aa tsf translation elongation factor Ts
87 JAEMBK010000001.1 GCA021406745_00551 CDS open 94813-96849 _na     678_aa uvrB excinuclease ABC subunit UvrB
88 JAEMBK010000001.1 GCA021406745_00552 CDS open 96846-98366 _na     506_aa nhaP2 potassium/proton antiporter
89 JAEMBK010000001.1 GCA021406745_00553 CDS open 98844-100163 _na     439_aa rseP RIP metalloprotease RseP
90 JAEMBK010000001.1 GCA021406745_00554 CDS open 100173-102695 _na     840_aa rqcU endonuclease MutS2
91 JAEMBK010000001.1 GCA021406745_00555 CDS open 102857-103048 _na     63_aa rpsU 30S ribosomal protein S21
92 JAEMBK010000001.1 GCA021406745_00556 CDS open 103125-104327 _na     400_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
93 JAEMBK010000001.1 GCA021406745_00559 CDS open 104721-105908 _na     395_aa tuf elongation factor Tu
94 JAEMBK010000001.1 GCA021406745_00561 CDS open 106067-106270 _na     67_aa secE preprotein translocase subunit SecE
95 JAEMBK010000001.1 GCA021406745_00562 CDS open 106292-106831 _na     179_aa nusG transcription termination/antitermination protein NusG
96 JAEMBK010000001.1 GCA021406745_00563 CDS open 106900-107337 _na     145_aa rplK 50S ribosomal protein L11
97 JAEMBK010000001.1 GCA021406745_00564 CDS open 107358-108056 _na     232_aa rplA 50S ribosomal protein L1
98 JAEMBK010000001.1 GCA021406745_00565 CDS open 108072-108596 _na     174_aa rplJ 50S ribosomal protein L10
99 JAEMBK010000001.1 GCA021406745_00566 CDS open 108638-109015 _na     125_aa rplL 50S ribosomal protein L7/L12
100 JAEMBK010000001.1 GCA021406745_00567 CDS open 109127-112936 _na     1269_aa rpoB DNA-directed RNA polymerase subunit beta
101 JAEMBK010000001.1 GCA021406745_00568 CDS open 113002-117303 _na     1433_aa rpoC DNA-directed RNA polymerase subunit beta'
102 JAEMBK010000001.1 GCA021406745_00569 CDS open 117591-118289 _na     232_aa crp Transcriptional regulator%2C Crp/Fnr family
103 JAEMBK010000001.1 GCA021406745_00570 CDS open 118338-118628 _na     96_aa DUF721 domain-containing protein
104 JAEMBK010000001.1 GCA021406745_00571 CDS open 118642-119736 _na     364_aa recF DNA replication/repair protein RecF
105 JAEMBK010000001.1 GCA021406745_00572 CDS open 119733-120263 _na     176_aa gldH Gliding motility protein GldH
106 JAEMBK010000001.1 GCA021406745_00573 CDS open 120271-121683 _na     470_aa yaaT PSP1 C-terminal domain-containing protein
107 JAEMBK010000001.1 GCA021406745_00574 CDS open 121791-123332 _na     513_aa rny ribonuclease Y
108 JAEMBK010000001.1 GCA021406745_00575 CDS open 123479-123787 _na     102_aa zapA Cell division protein ZapA
109 JAEMBK010000001.1 GCA021406745_00576 CDS open 123794-124132 _na     112_aa Phenylalanyl-tRNA synthetase subunit beta
110 JAEMBK010000001.1 GCA021406745_00577 CDS open 125168-125482 _na     104_aa hypothetical protein
111 JAEMBK010000001.1 GCA021406745_00578 CDS open 125526-126347 _na     273_aa Outer membrane protein beta-barrel domain-containing protein
112 JAEMBK010000001.1 GCA021406745_00579 CDS open 126714-129479 _na     921_aa cTD-A Cleaved adhesin domain-containing protein
113 JAEMBK010000001.1 GCA021406745_00466 gene open 61-1278
114 JAEMBK010000001.1 GCA021406745_00467 gene open 1415-2944
115 JAEMBK010000001.1 GCA021406745_00468 gene open 2941-3603 darT
116 JAEMBK010000001.1 GCA021406745_00469 gene open 3606-5282
117 JAEMBK010000001.1 GCA021406745_00470 gene open 5257-5388
118 JAEMBK010000001.1 GCA021406745_00471 gene open 5449-5787
119 JAEMBK010000001.1 GCA021406745_00472 gene open 5796-6071
120 JAEMBK010000001.1 GCA021406745_00473 gene open 6692-7726
121 JAEMBK010000001.1 GCA021406745_00474 gene open 8037-8546
122 JAEMBK010000001.1 GCA021406745_00475 gene open 8560-8970
123 JAEMBK010000001.1 GCA021406745_00476 gene open 9303-10559 mobV
124 JAEMBK010000001.1 GCA021406745_00477 gene open 10687-11601
125 JAEMBK010000001.1 GCA021406745_00478 gene open 11568-13880
126 JAEMBK010000001.1 GCA021406745_00479 gene open 14107-14307
127 JAEMBK010000001.1 GCA021406745_00480 gene open 14346-15236 wcaE
128 JAEMBK010000001.1 GCA021406745_00481 gene open 15251-16375 dprA
129 JAEMBK010000001.1 GCA021406745_00482 gene open 16368-20072 purL
130 JAEMBK010000001.1 GCA021406745_00483 gene open 20325-20759
131 JAEMBK010000001.1 GCA021406745_00484 gene open 21729-22937 cpoB
132 JAEMBK010000001.1 GCA021406745_00485 gene open 23293-23715 rseC
133 JAEMBK010000001.1 GCA021406745_00486 gene open 23725-24597 rnfB
134 JAEMBK010000001.1 GCA021406745_00487 gene open 24633-25964 rsxC
135 JAEMBK010000001.1 GCA021406745_00488 gene open 25980-26963 rnfD
136 JAEMBK010000001.1 GCA021406745_00489 gene open 26960-27637 rnfG
137 JAEMBK010000001.1 GCA021406745_00490 gene open 27634-28224 rnfE
138 JAEMBK010000001.1 GCA021406745_00491 gene open 28249-28821 rnfA
139 JAEMBK010000001.1 GCA021406745_00492 gene open 29039-30052 apbE
140 JAEMBK010000001.1 GCA021406745_00493 gene open 30049-30588 nfnB
141 JAEMBK010000001.1 GCA021406745_00494 gene open 30588-31541 wcaA
142 JAEMBK010000001.1 GCA021406745_00495 gene open 31538-32077
143 JAEMBK010000001.1 GCA021406745_00496 gene open 32813-33130 rplU
144 JAEMBK010000001.1 GCA021406745_00497 gene open 33158-33415 rpmA
145 JAEMBK010000001.1 GCA021406745_00498 gene open 33515-34786 serS
146 JAEMBK010000001.1 GCA021406745_00499 gene open 34799-37459
147 JAEMBK010000001.1 GCA021406745_00500 gene open 38072-38455
148 JAEMBK010000001.1 GCA021406745_00501 gene open 38487-39575
149 JAEMBK010000001.1 GCA021406745_00502 gene open 39651-40757 meaB
150 JAEMBK010000001.1 GCA021406745_00503 gene open 40786-41964 gltP
151 JAEMBK010000001.1 GCA021406745_00504 gene open 42087-42416 qdoI
152 JAEMBK010000001.1 GCA021406745_00505 gene open 42617-44122 hutH
153 JAEMBK010000001.1 GCA021406745_00506 gene open 44113-44742 ftcD
154 JAEMBK010000001.1 GCA021406745_00507 gene open 44767-45894 lomR
155 JAEMBK010000001.1 GCA021406745_00508 gene open 45935-47089
156 JAEMBK010000001.1 GCA021406745_00509 gene open 47183-48433 hutI
157 JAEMBK010000001.1 GCA021406745_00510 gene open 48555-49457 ftcD
158 JAEMBK010000001.1 GCA021406745_00511 gene open 49498-50493
159 JAEMBK010000001.1 GCA021406745_00512 gene open 50526-51044 hupA
160 JAEMBK010000001.1 GCA021406745_00513 gene open 51720-53684 rho
161 JAEMBK010000001.1 GCA021406745_00514 gene open 53912-54820 rhaT
162 JAEMBK010000001.1 GCA021406745_00515 gene open 54831-55790 wcaA
163 JAEMBK010000001.1 GCA021406745_00516 gene open 55843-56745 miaA
164 JAEMBK010000001.1 GCA021406745_00517 gene open 56765-57334
165 JAEMBK010000001.1 GCA021406745_00518 gene open 57622-60981 cas13b
166 JAEMBK010000001.1 GCA021406745_00519 gene open 60989-61531 csx28
167 JAEMBK010000001.1 GCA021406745_00520 gene open 62593-62706
168 JAEMBK010000001.1 GCA021406745_00521 gene open 62920-64101 megL
169 JAEMBK010000001.1 GCA021406745_00522 gene open 64282-65751 cpdA
170 JAEMBK010000001.1 GCA021406745_00523 gene open 65754-66347
171 JAEMBK010000001.1 GCA021406745_00524 gene open 66448-67053 yihA
172 JAEMBK010000001.1 GCA021406745_00525 gene open 67063-68091 galE
173 JAEMBK010000001.1 GCA021406745_00526 gene open 68134-70230 recG
174 JAEMBK010000001.1 GCA021406745_00527 gene open 70248-71000 ycjU
175 JAEMBK010000001.1 GCA021406745_00528 gene open 71095-72489 yopM
176 JAEMBK010000001.1 GCA021406745_00529 gene open 72917-74497 nanH
177 JAEMBK010000001.1 GCA021406745_00530 gene open 74444-74572
178 JAEMBK010000001.1 GCA021406745_00531 gene open 75433-76359
179 JAEMBK010000001.1 GCA021406745_00532 gene open 76388-77125 sIMPL
180 JAEMBK010000001.1 GCA021406745_00533 gene open 77172-78086 pyrB
181 JAEMBK010000001.1 GCA021406745_00534 gene open 78114-78554 pyrI
182 JAEMBK010000001.1 GCA021406745_00535 gene open 78583-79170 rutF
183 JAEMBK010000001.1 GCA021406745_00536 gene open 79214-79804 lemA
184 JAEMBK010000001.1 GCA021406745_00537 gene open 79826-81133 rPS27A
185 JAEMBK010000001.1 GCA021406745_00538 gene open 81141-83201
186 JAEMBK010000001.1 GCA021406745_00539 gene open 83208-84029 mltF
187 JAEMBK010000001.1 GCA021406745_00540 gene open 84092-85297 rlmK
188 JAEMBK010000001.1 GCA021406745_00541 gene open 85294-85896 rnd
189 JAEMBK010000001.1 GCA021406745_00542 gene open 85937-86497
190 JAEMBK010000001.1 GCA021406745_00543 gene open 86836-86934
191 JAEMBK010000001.1 GCA021406745_00544 gene open 86952-88886 gyrB
192 JAEMBK010000001.1 GCA021406745_00545 gene open 88917-89378 coaD
193 JAEMBK010000001.1 GCA021406745_00546 gene open 90416-91084
194 JAEMBK010000001.1 GCA021406745_00547 gene open 91645-92100 rplM
195 JAEMBK010000001.1 GCA021406745_00548 gene open 92110-92496 rpsI
196 JAEMBK010000001.1 GCA021406745_00549 gene open 92631-93476 rpsB
197 JAEMBK010000001.1 GCA021406745_00550 gene open 93615-94439 tsf
198 JAEMBK010000001.1 GCA021406745_00551 gene open 94813-96849 uvrB
199 JAEMBK010000001.1 GCA021406745_00552 gene open 96846-98366 nhaP2
200 JAEMBK010000001.1 GCA021406745_00553 gene open 98844-100163 rseP
201 JAEMBK010000001.1 GCA021406745_00554 gene open 100173-102695 rqcU
202 JAEMBK010000001.1 GCA021406745_00555 gene open 102857-103048 rpsU
203 JAEMBK010000001.1 GCA021406745_00556 gene open 103125-104327 hpf
204 JAEMBK010000001.1 GCA021406745_00559 gene open 104721-105908 tuf
205 JAEMBK010000001.1 GCA021406745_00561 gene open 106067-106270 secE
206 JAEMBK010000001.1 GCA021406745_00562 gene open 106292-106831 nusG
207 JAEMBK010000001.1 GCA021406745_00563 gene open 106900-107337 rplK
208 JAEMBK010000001.1 GCA021406745_00564 gene open 107358-108056 rplA
209 JAEMBK010000001.1 GCA021406745_00565 gene open 108072-108596 rplJ
210 JAEMBK010000001.1 GCA021406745_00566 gene open 108638-109015 rplL
211 JAEMBK010000001.1 GCA021406745_00567 gene open 109127-112936 rpoB
212 JAEMBK010000001.1 GCA021406745_00568 gene open 113002-117303 rpoC
213 JAEMBK010000001.1 GCA021406745_00569 gene open 117591-118289 crp
214 JAEMBK010000001.1 GCA021406745_00570 gene open 118338-118628
215 JAEMBK010000001.1 GCA021406745_00571 gene open 118642-119736 recF
216 JAEMBK010000001.1 GCA021406745_00572 gene open 119733-120263 gldH
217 JAEMBK010000001.1 GCA021406745_00573 gene open 120271-121683 yaaT
218 JAEMBK010000001.1 GCA021406745_00574 gene open 121791-123332 rny
219 JAEMBK010000001.1 GCA021406745_00575 gene open 123479-123787 zapA
220 JAEMBK010000001.1 GCA021406745_00576 gene open 123794-124132
221 JAEMBK010000001.1 GCA021406745_00577 gene open 125168-125482
222 JAEMBK010000001.1 GCA021406745_00578 gene open 125526-126347
223 JAEMBK010000001.1 GCA021406745_00579 gene open 126714-129479 cTD-A
224 JAEMBK010000001.1 GCA021406745_00557 gene open 104467-104549 trnY
225 JAEMBK010000001.1 GCA021406745_00558 gene open 104582-104653 trnT
226 JAEMBK010000001.1 GCA021406745_00560 gene open 105979-106051 trnW
227 JAEMBK010000001.1 GCA021406745_00557 tRNA open 104467-104549 trnY tRNA-Tyr(gta)
228 JAEMBK010000001.1 GCA021406745_00558 tRNA open 104582-104653 trnT tRNA-Thr(ggt)
229 JAEMBK010000001.1 GCA021406745_00560 tRNA open 105979-106051 trnW tRNA-Trp(cca)
230 JAEMBK010000002.1 repeat_region open 116303-116679 CRISPR array with 6 repeats of length 36%2C consensus sequence GTTGTCTCCACCCTTCTAACTAAGGGTATTCCCAAC and spacer length 30
231 JAEMBK010000002.1 GCA021406745_01200 CDS open 601-1200 _na     199_aa acrR Transcriptional regulator%2C tetR family
232 JAEMBK010000002.1 GCA021406745_01201 CDS open 1241-3646 _na     801_aa mMPL SSD domain-containing protein
233 JAEMBK010000002.1 GCA021406745_01202 CDS open 3724-4515 _na     263_aa Outer membrane lipoprotein-sorting protein
234 JAEMBK010000002.1 GCA021406745_01203 CDS open 4519-5796 _na     425_aa Porin
235 JAEMBK010000002.1 GCA021406745_01204 CDS open 5821-7575 _na     584_aa mdlB ABC transporter ATP-binding protein
236 JAEMBK010000002.1 GCA021406745_01205 CDS open 7622-9328 _na     568_aa mdlB ABC transporter%2C ATP-binding protein%2C putative
237 JAEMBK010000002.1 GCA021406745_01206 CDS open 9943-11775 _na     610_aa ctpA Carboxyl-terminal processing protease
238 JAEMBK010000002.1 GCA021406745_01207 CDS open 12089-13177 _na     362_aa tnp ISAs1 family ISPg6 transposase
239 JAEMBK010000002.1 GCA021406745_01208 CDS open 14620-15060 _na     146_aa vapI HTH cro/C1-type domain-containing protein
240 JAEMBK010000002.1 GCA021406745_01209 CDS open 15112-15909 _na     265_aa mcr1 Dihydroorotate dehydrogenase%2C putative
241 JAEMBK010000002.1 GCA021406745_01210 CDS open 15945-16814 _na     289_aa pyrD dihydroorotate dehydrogenase
242 JAEMBK010000002.1 GCA021406745_01211 CDS open 17085-17729 _na     214_aa atoD Butyrate-acetoacetate CoA-transferase%2C subunit A
243 JAEMBK010000002.1 GCA021406745_01212 CDS open 17783-18172 _na     129_aa yciA HotDog ACOT-type domain-containing protein
244 JAEMBK010000002.1 GCA021406745_01213 CDS open 18209-19021 _na     270_aa 3-keto-5-aminohexanoate cleavage protein
245 JAEMBK010000002.1 GCA021406745_01214 CDS open 19063-20106 _na     347_aa qor Alcohol dehydrogenase%2C zinc-containing%2C putative
246 JAEMBK010000002.1 GCA021406745_01215 CDS open 20193-21443 _na     416_aa ablA lysine 2%2C3-aminomutase
247 JAEMBK010000002.1 GCA021406745_01216 CDS open 21543-22541 _na     332_aa yqeC Selenium-dependent hydroxylase accessory protein YqeC
248 JAEMBK010000002.1 GCA021406745_01217 CDS open 22541-23932 _na     463_aa mutS MutS family protein
249 JAEMBK010000002.1 GCA021406745_01218 CDS open 23960-25531 _na     523_aa D-lysine 5%2C6-aminomutase%2C alpha subunit
250 JAEMBK010000002.1 GCA021406745_01219 CDS open 25528-26319 _na     263_aa mtbC1 D-lysine 5%2C6-aminomutase%2C beta subunit
251 JAEMBK010000002.1 GCA021406745_01220 CDS open 26342-27004 _na     220_aa atoA Coenzyme A transferase beta subunit
252 JAEMBK010000002.1 GCA021406745_01221 CDS open 27050-28186 _na     378_aa caiA Acyl-CoA dehydrogenase%2C short-chain specific
253 JAEMBK010000002.1 GCA021406745_01222 CDS open 28204-28989 _na     261_aa fixA Electron transfer flavoprotein%2C beta subunit
254 JAEMBK010000002.1 GCA021406745_01223 CDS open 29003-30010 _na     335_aa fixB Electron transfer flavoprotein%2C alpha subunit
255 JAEMBK010000002.1 GCA021406745_01224 CDS open 30114-30884 _na     256_aa caiD Enoyl-CoA hydratase/isomerase family protein
256 JAEMBK010000002.1 GCA021406745_01225 CDS open 30931-31776 _na     281_aa fadB 3-hydroxybutyryl-CoA dehydrogenase
257 JAEMBK010000002.1 GCA021406745_01226 CDS open 31949-33145 _na     398_aa ackA Acetate kinase
258 JAEMBK010000002.1 GCA021406745_01227 CDS open 33191-34201 _na     336_aa pta phosphate acetyltransferase
259 JAEMBK010000002.1 GCA021406745_01228 CDS open 34412-35260 _na     282_aa DUF3108 domain-containing protein
260 JAEMBK010000002.1 GCA021406745_01229 CDS open 35401-36504 _na     367_aa trxA putative thiol:disulfide oxidoreductase
261 JAEMBK010000002.1 GCA021406745_01230 CDS open 36832-37020 _na     62_aa hypothetical protein
262 JAEMBK010000002.1 GCA021406745_01231 CDS open 37377-38309 _na     310_aa yhcC TIGR01212 family radical SAM protein
263 JAEMBK010000002.1 GCA021406745_01232 CDS open 38361-38924 _na     187_aa rimI Acetyltransferase%2C GNAT family
264 JAEMBK010000002.1 GCA021406745_01233 CDS open 39041-39778 _na     245_aa ompR DNA-binding response regulator RprY
265 JAEMBK010000002.1 GCA021406745_01234 CDS open 40537-41580 _na     347_aa nrnA DHH family phosphoesterase
266 JAEMBK010000002.1 GCA021406745_01235 CDS open 41673-42269 _na     198_aa DUF4827 domain-containing protein
267 JAEMBK010000002.1 GCA021406745_01236 CDS open 42323-43711 _na     462_aa glmM phosphoglucosamine mutase
268 JAEMBK010000002.1 GCA021406745_01237 CDS open 43756-45192 _na     478_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
269 JAEMBK010000002.1 GCA021406745_01238 CDS open 45507-46493 _na     328_aa GSCFA domain-containing protein
270 JAEMBK010000002.1 GCA021406745_01239 CDS open 46529-49000 _na     823_aa alr bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase
271 JAEMBK010000002.1 GCA021406745_01240 CDS open 49309-50532 _na     407_aa rsmD THUMP-like domain-containing protein
272 JAEMBK010000002.1 GCA021406745_01243 CDS open 50869-51693 _na     274_aa murQ N-acetylmuramic acid 6-phosphate etherase
273 JAEMBK010000002.1 GCA021406745_01244 CDS open 51686-52537 _na     283_aa badF BadF/BadG/BcrA/BcrD ATPase family protein
274 JAEMBK010000002.1 GCA021406745_01245 CDS open 52534-53994 _na     486_aa putP Sodium:solute symporter family protein
275 JAEMBK010000002.1 GCA021406745_01246 CDS open 54343-54801 _na     152_aa DNA-binding protein histone-like family
276 JAEMBK010000002.1 GCA021406745_01247 CDS open 54870-56189 _na     439_aa rarA ATPase%2C AAA family
277 JAEMBK010000002.1 GCA021406745_01248 CDS open 56215-56982 _na     255_aa trmN6 tRNA1(Val) (adenine(37)-N6)-methyltransferase
278 JAEMBK010000002.1 GCA021406745_01249 CDS open 56946-58403 _na     485_aa rpoN RNA polymerase factor sigma-54
279 JAEMBK010000002.1 GCA021406745_01250 CDS open 58397-59701 _na     434_aa murF UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
280 JAEMBK010000002.1 GCA021406745_01251 CDS open 59911-60267 _na     118_aa panD aspartate 1-decarboxylase
281 JAEMBK010000002.1 GCA021406745_01252 CDS open 60346-61683 _na     445_aa ffh signal recognition particle protein
282 JAEMBK010000002.1 GCA021406745_01253 CDS open 61804-62694 _na     296_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
283 JAEMBK010000002.1 GCA021406745_01254 CDS open 62998-64344 _na     448_aa norM Multidrug-efflux transporter
284 JAEMBK010000002.1 GCA021406745_01255 CDS open 65170-67761 _na     863_aa clpB ATP-dependent chaperone ClpB
285 JAEMBK010000002.1 GCA021406745_01256 CDS open 67980-68540 _na     186_aa fldA Flavodoxin-like domain-containing protein
286 JAEMBK010000002.1 GCA021406745_01257 CDS open 69231-70640 _na     469_aa asnS asparagine--tRNA ligase
287 JAEMBK010000002.1 GCA021406745_01258 CDS open 70672-71991 _na     439_aa rsuA Pseudouridine synthase
288 JAEMBK010000002.1 GCA021406745_01259 CDS open 72092-73435 _na     447_aa purB adenylosuccinate lyase
289 JAEMBK010000002.1 GCA021406745_01260 CDS open 73570-74133 _na     187_aa pduO Corrinoid adenosyltransferase
290 JAEMBK010000002.1 GCA021406745_01261 CDS open 74156-74806 _na     216_aa SAM-dependent methyltransferase
291 JAEMBK010000002.1 GCA021406745_01262 CDS open 74831-76018 _na     395_aa uraA Uracil permease
292 JAEMBK010000002.1 GCA021406745_01263 CDS open 76363-76830 _na     155_aa lrp Transcriptional regulator%2C AsnC Family
293 JAEMBK010000002.1 GCA021406745_01264 CDS open 76877-78259 _na     460_aa xseA exodeoxyribonuclease VII large subunit
294 JAEMBK010000002.1 GCA021406745_01265 CDS open 78532-81084 _na     850_aa nrdA adenosylcobalamin-dependent ribonucleoside-diphosphate reductase
295 JAEMBK010000002.1 GCA021406745_01266 CDS open 81275-83455 _na     726_aa hypothetical protein
296 JAEMBK010000002.1 GCA021406745_01267 CDS open 84291-86921 _na     876_aa valS valine--tRNA ligase
297 JAEMBK010000002.1 GCA021406745_01268 CDS open 86950-87402 _na     150_aa hypothetical protein
298 JAEMBK010000002.1 GCA021406745_01270 CDS open 87725-88666 _na     313_aa trxB thioredoxin-disulfide reductase
299 JAEMBK010000002.1 GCA021406745_01271 CDS open 89230-89844 _na     204_aa wcaJ Bacterial sugar transferase domain-containing protein
300 JAEMBK010000002.1 GCA021406745_01272 CDS open 90019-91647 _na     542_aa asnB asparagine synthase (glutamine-hydrolyzing)
301 JAEMBK010000002.1 GCA021406745_01273 CDS open 91610-92917 _na     435_aa rfbX PorS protein
302 JAEMBK010000002.1 GCA021406745_01274 CDS open 92914-94068 _na     384_aa wecE Pigmentation and extracellular proteinase regulator
303 JAEMBK010000002.1 GCA021406745_01275 CDS open 94249-95376 _na     375_aa DUF4369 domain-containing protein
304 JAEMBK010000002.1 GCA021406745_01276 CDS open 95506-96366 _na     286_aa wcaE Glycosyl transferase%2C group 2 family protein
305 JAEMBK010000002.1 GCA021406745_01277 CDS open 96372-97523 _na     383_aa Glycosyltransferase%2C group 1 family protein
306 JAEMBK010000002.1 GCA021406745_01278 CDS open 97715-98758 _na     347_aa epsG EpsG family protein
307 JAEMBK010000002.1 GCA021406745_01279 CDS open 98765-100216 _na     483_aa ugd UDP-glucose 6-dehydrogenase
308 JAEMBK010000002.1 GCA021406745_01280 CDS open 100372-101331 _na     319_aa prfB peptide chain release factor 2
309 JAEMBK010000002.1 GCA021406745_01281 CDS open 101612-103435 _na     607_aa fAA1 Long-chain-fatty-acid-CoA ligase
310 JAEMBK010000002.1 GCA021406745_01282 CDS open 104812-105969 _na     385_aa rfaB Glycosyl transferase%2C group 1 family protein
311 JAEMBK010000002.1 GCA021406745_01283 CDS open 106145-107341 _na     398_aa yqdH Iron-containing alcohol dehydrogenase
312 JAEMBK010000002.1 GCA021406745_01284 CDS open 107480-107896 _na     138_aa hypothetical protein
313 JAEMBK010000002.1 GCA021406745_01285 CDS open 108057-108662 _na     201_aa DUF4254 domain-containing protein
314 JAEMBK010000002.1 GCA021406745_01286 CDS open 108746-109801 _na     351_aa rfaF ADP-heptose--LPS heptosyltransferase%2C putative
315 JAEMBK010000002.1 GCA021406745_01287 CDS open 109785-110237 _na     150_aa rsuA RNA-binding S4 domain-containing protein
316 JAEMBK010000002.1 GCA021406745_01288 CDS open 110673-111722 _na     349_aa cbiB adenosylcobinamide-phosphate synthase CbiB
317 JAEMBK010000002.1 GCA021406745_01289 CDS open 111697-112704 _na     335_aa cobD threonine-phosphate decarboxylase CobD
318 JAEMBK010000002.1 GCA021406745_01290 CDS open 112697-114193 _na     498_aa cobyric acid synthase
319 JAEMBK010000002.1 GCA021406745_01291 CDS open 114190-114756 _na     188_aa pduO Corrinoid adenosyltransferase
320 JAEMBK010000002.1 GCA021406745_01292 CDS open 114779-116098 _na     439_aa cobB cobyrinate a%2Cc-diamide synthase
321 JAEMBK010000002.1 GCA021406745_01293 CDS open 120081-120797 _na     238_aa csx27 CRISPR-associated protein Csx27
322 JAEMBK010000002.1 GCA021406745_01294 CDS open 120870-121091 _na     73_aa 30S ribosomal protein S21 domain protein
323 JAEMBK010000002.1 GCA021406745_01295 CDS open 121499-121588 _na     29_aa hypothetical protein
324 JAEMBK010000002.1 GCA021406745_01296 CDS open 121788-122660 _na     290_aa serB phosphoserine phosphatase SerB
325 JAEMBK010000002.1 GCA021406745_01297 CDS open 122980-123720 _na     246_aa glpC Oxidoreductase%2C putative
326 JAEMBK010000002.1 GCA021406745_01298 CDS open 123717-125084 _na     455_aa lutB Putative electron transport protein
327 JAEMBK010000002.1 GCA021406745_01299 CDS open 125090-125674 _na     194_aa lutC LUD domain-containing protein
328 JAEMBK010000002.1 GCA021406745_01300 CDS open 125785-126258 _na     157_aa paaI Thioesterase family protein
329 JAEMBK010000002.1 GCA021406745_01200 gene open 601-1200 acrR
330 JAEMBK010000002.1 GCA021406745_01201 gene open 1241-3646 mMPL
331 JAEMBK010000002.1 GCA021406745_01202 gene open 3724-4515
332 JAEMBK010000002.1 GCA021406745_01203 gene open 4519-5796
333 JAEMBK010000002.1 GCA021406745_01204 gene open 5821-7575 mdlB
334 JAEMBK010000002.1 GCA021406745_01205 gene open 7622-9328 mdlB
335 JAEMBK010000002.1 GCA021406745_01206 gene open 9943-11775 ctpA
336 JAEMBK010000002.1 GCA021406745_01207 gene open 12089-13177 tnp
337 JAEMBK010000002.1 GCA021406745_01208 gene open 14620-15060 vapI
338 JAEMBK010000002.1 GCA021406745_01209 gene open 15112-15909 mcr1
339 JAEMBK010000002.1 GCA021406745_01210 gene open 15945-16814 pyrD
340 JAEMBK010000002.1 GCA021406745_01211 gene open 17085-17729 atoD
341 JAEMBK010000002.1 GCA021406745_01212 gene open 17783-18172 yciA
342 JAEMBK010000002.1 GCA021406745_01213 gene open 18209-19021
343 JAEMBK010000002.1 GCA021406745_01214 gene open 19063-20106 qor
344 JAEMBK010000002.1 GCA021406745_01215 gene open 20193-21443 ablA
345 JAEMBK010000002.1 GCA021406745_01216 gene open 21543-22541 yqeC
346 JAEMBK010000002.1 GCA021406745_01217 gene open 22541-23932 mutS
347 JAEMBK010000002.1 GCA021406745_01218 gene open 23960-25531
348 JAEMBK010000002.1 GCA021406745_01219 gene open 25528-26319 mtbC1
349 JAEMBK010000002.1 GCA021406745_01220 gene open 26342-27004 atoA
350 JAEMBK010000002.1 GCA021406745_01221 gene open 27050-28186 caiA
351 JAEMBK010000002.1 GCA021406745_01222 gene open 28204-28989 fixA
352 JAEMBK010000002.1 GCA021406745_01223 gene open 29003-30010 fixB
353 JAEMBK010000002.1 GCA021406745_01224 gene open 30114-30884 caiD
354 JAEMBK010000002.1 GCA021406745_01225 gene open 30931-31776 fadB
355 JAEMBK010000002.1 GCA021406745_01226 gene open 31949-33145 ackA
356 JAEMBK010000002.1 GCA021406745_01227 gene open 33191-34201 pta
357 JAEMBK010000002.1 GCA021406745_01228 gene open 34412-35260
358 JAEMBK010000002.1 GCA021406745_01229 gene open 35401-36504 trxA
359 JAEMBK010000002.1 GCA021406745_01230 gene open 36832-37020
360 JAEMBK010000002.1 GCA021406745_01231 gene open 37377-38309 yhcC
361 JAEMBK010000002.1 GCA021406745_01232 gene open 38361-38924 rimI
362 JAEMBK010000002.1 GCA021406745_01233 gene open 39041-39778 ompR
363 JAEMBK010000002.1 GCA021406745_01234 gene open 40537-41580 nrnA
364 JAEMBK010000002.1 GCA021406745_01235 gene open 41673-42269
365 JAEMBK010000002.1 GCA021406745_01236 gene open 42323-43711 glmM
366 JAEMBK010000002.1 GCA021406745_01237 gene open 43756-45192 rlmD
367 JAEMBK010000002.1 GCA021406745_01238 gene open 45507-46493
368 JAEMBK010000002.1 GCA021406745_01239 gene open 46529-49000 alr
369 JAEMBK010000002.1 GCA021406745_01240 gene open 49309-50532 rsmD
370 JAEMBK010000002.1 GCA021406745_01243 gene open 50869-51693 murQ
371 JAEMBK010000002.1 GCA021406745_01244 gene open 51686-52537 badF
372 JAEMBK010000002.1 GCA021406745_01245 gene open 52534-53994 putP
373 JAEMBK010000002.1 GCA021406745_01246 gene open 54343-54801
374 JAEMBK010000002.1 GCA021406745_01247 gene open 54870-56189 rarA
375 JAEMBK010000002.1 GCA021406745_01248 gene open 56215-56982 trmN6
376 JAEMBK010000002.1 GCA021406745_01249 gene open 56946-58403 rpoN
377 JAEMBK010000002.1 GCA021406745_01250 gene open 58397-59701 murF
378 JAEMBK010000002.1 GCA021406745_01251 gene open 59911-60267 panD
379 JAEMBK010000002.1 GCA021406745_01252 gene open 60346-61683 ffh
380 JAEMBK010000002.1 GCA021406745_01253 gene open 61804-62694 folD
381 JAEMBK010000002.1 GCA021406745_01254 gene open 62998-64344 norM
382 JAEMBK010000002.1 GCA021406745_01255 gene open 65170-67761 clpB
383 JAEMBK010000002.1 GCA021406745_01256 gene open 67980-68540 fldA
384 JAEMBK010000002.1 GCA021406745_01257 gene open 69231-70640 asnS
385 JAEMBK010000002.1 GCA021406745_01258 gene open 70672-71991 rsuA
386 JAEMBK010000002.1 GCA021406745_01259 gene open 72092-73435 purB
387 JAEMBK010000002.1 GCA021406745_01260 gene open 73570-74133 pduO
388 JAEMBK010000002.1 GCA021406745_01261 gene open 74156-74806
389 JAEMBK010000002.1 GCA021406745_01262 gene open 74831-76018 uraA
390 JAEMBK010000002.1 GCA021406745_01263 gene open 76363-76830 lrp
391 JAEMBK010000002.1 GCA021406745_01264 gene open 76877-78259 xseA
392 JAEMBK010000002.1 GCA021406745_01265 gene open 78532-81084 nrdA
393 JAEMBK010000002.1 GCA021406745_01266 gene open 81275-83455
394 JAEMBK010000002.1 GCA021406745_01267 gene open 84291-86921 valS
395 JAEMBK010000002.1 GCA021406745_01268 gene open 86950-87402
396 JAEMBK010000002.1 GCA021406745_01270 gene open 87725-88666 trxB
397 JAEMBK010000002.1 GCA021406745_01271 gene open 89230-89844 wcaJ
398 JAEMBK010000002.1 GCA021406745_01272 gene open 90019-91647 asnB
399 JAEMBK010000002.1 GCA021406745_01273 gene open 91610-92917 rfbX
400 JAEMBK010000002.1 GCA021406745_01274 gene open 92914-94068 wecE
401 JAEMBK010000002.1 GCA021406745_01275 gene open 94249-95376
402 JAEMBK010000002.1 GCA021406745_01276 gene open 95506-96366 wcaE
403 JAEMBK010000002.1 GCA021406745_01277 gene open 96372-97523
404 JAEMBK010000002.1 GCA021406745_01278 gene open 97715-98758 epsG
405 JAEMBK010000002.1 GCA021406745_01279 gene open 98765-100216 ugd
406 JAEMBK010000002.1 GCA021406745_01280 gene open 100372-101331 prfB
407 JAEMBK010000002.1 GCA021406745_01281 gene open 101612-103435 fAA1
408 JAEMBK010000002.1 GCA021406745_01282 gene open 104812-105969 rfaB
409 JAEMBK010000002.1 GCA021406745_01283 gene open 106145-107341 yqdH
410 JAEMBK010000002.1 GCA021406745_01284 gene open 107480-107896
411 JAEMBK010000002.1 GCA021406745_01285 gene open 108057-108662
412 JAEMBK010000002.1 GCA021406745_01286 gene open 108746-109801 rfaF
413 JAEMBK010000002.1 GCA021406745_01287 gene open 109785-110237 rsuA
414 JAEMBK010000002.1 GCA021406745_01288 gene open 110673-111722 cbiB
415 JAEMBK010000002.1 GCA021406745_01289 gene open 111697-112704 cobD
416 JAEMBK010000002.1 GCA021406745_01290 gene open 112697-114193
417 JAEMBK010000002.1 GCA021406745_01291 gene open 114190-114756 pduO
418 JAEMBK010000002.1 GCA021406745_01292 gene open 114779-116098 cobB
419 JAEMBK010000002.1 GCA021406745_01293 gene open 120081-120797 csx27
420 JAEMBK010000002.1 GCA021406745_01294 gene open 120870-121091
421 JAEMBK010000002.1 GCA021406745_01295 gene open 121499-121588
422 JAEMBK010000002.1 GCA021406745_01296 gene open 121788-122660 serB
423 JAEMBK010000002.1 GCA021406745_01297 gene open 122980-123720 glpC
424 JAEMBK010000002.1 GCA021406745_01298 gene open 123717-125084 lutB
425 JAEMBK010000002.1 GCA021406745_01299 gene open 125090-125674 lutC
426 JAEMBK010000002.1 GCA021406745_01300 gene open 125785-126258 paaI
427 JAEMBK010000002.1 GCA021406745_01241 gene open 50592-50665 trnR
428 JAEMBK010000002.1 GCA021406745_01242 gene open 50701-50774 trnR
429 JAEMBK010000002.1 GCA021406745_01269 gene open 87463-87535 trnT
430 JAEMBK010000002.1 GCA021406745_01241 tRNA open 50592-50665 trnR tRNA-Arg(acg)
431 JAEMBK010000002.1 GCA021406745_01242 tRNA open 50701-50774 trnR tRNA-Arg(acg)
432 JAEMBK010000002.1 GCA021406745_01269 tRNA open 87463-87535 trnT tRNA-Thr(cgt)
433 JAEMBK010000003.1 regulatory_region open 66582-66784 Cobalamin riboswitch aptamer
434 JAEMBK010000003.1 regulatory_region open 98681-98917 Cobalamin riboswitch aptamer
435 JAEMBK010000003.1 regulatory_region open 116476-116655 Cobalamin riboswitch aptamer
436 JAEMBK010000003.1 GCA021406745_01677 CDS open 246-2021 _na     591_aa pilF Tetratricopeptide repeat protein
437 JAEMBK010000003.1 GCA021406745_01678 CDS open 2056-2388 _na     110_aa tetratricopeptide repeat protein
438 JAEMBK010000003.1 GCA021406745_01679 CDS open 2427-4553 _na     708_aa dcp Peptidyl-dipeptidase Dcp
439 JAEMBK010000003.1 GCA021406745_01680 CDS open 4650-5297 _na     215_aa Mpv17 / PMP22 family protein
440 JAEMBK010000003.1 GCA021406745_01681 CDS open 5347-6699 _na     450_aa DUF2130 domain-containing protein
441 JAEMBK010000003.1 GCA021406745_01682 CDS open 6814-7314 _na     166_aa Lipoprotein
442 JAEMBK010000003.1 GCA021406745_01683 CDS open 7382-8815 _na     477_aa Lipoprotein
443 JAEMBK010000003.1 GCA021406745_01684 CDS open 8851-9333 _na     160_aa DNA-binding protein
444 JAEMBK010000003.1 GCA021406745_01685 CDS open 10071-10829 _na     252_aa truA tRNA pseudouridine(38-40) synthase TruA
445 JAEMBK010000003.1 GCA021406745_01686 CDS open 10833-13199 _na     788_aa topA type I DNA topoisomerase
446 JAEMBK010000003.1 GCA021406745_01687 CDS open 13936-15843 _na     635_aa rlhA Protease
447 JAEMBK010000003.1 GCA021406745_01688 CDS open 15827-16477 _na     216_aa upp uracil phosphoribosyltransferase
448 JAEMBK010000003.1 GCA021406745_01689 CDS open 16615-17349 _na     244_aa porT PorT protein
449 JAEMBK010000003.1 GCA021406745_01690 CDS open 17438-18247 _na     269_aa wcaA Glycosyl transferase%2C group 2 family protein
450 JAEMBK010000003.1 GCA021406745_01692 CDS open 18900-20294 _na     464_aa atoC Sigma-54 dependent DNA-binding response regulator
451 JAEMBK010000003.1 GCA021406745_01693 CDS open 20320-21657 _na     445_aa histidine kinase
452 JAEMBK010000003.1 GCA021406745_01694 CDS open 21813-22211 _na     132_aa gloA Aldoketomutase
453 JAEMBK010000003.1 GCA021406745_01695 CDS open 22296-23060 _na     254_aa spoU RNA methyltransferase%2C TrmH family
454 JAEMBK010000003.1 GCA021406745_01696 CDS open 23929-24498 _na     189_aa nlpC NlpC/P60 domain-containing protein
455 JAEMBK010000003.1 GCA021406745_01697 CDS open 24473-25387 _na     304_aa rnz ribonuclease Z
456 JAEMBK010000003.1 GCA021406745_01698 CDS open 25419-25871 _na     150_aa tadA tRNA-specific adenosine deaminase
457 JAEMBK010000003.1 GCA021406745_01699 CDS open 25868-26095 _na     75_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
458 JAEMBK010000003.1 GCA021406745_01700 CDS open 26121-26726 _na     201_aa rnhB ribonuclease HII
459 JAEMBK010000003.1 GCA021406745_01701 CDS open 26737-27951 _na     404_aa csdA cysteine desulfurase
460 JAEMBK010000003.1 GCA021406745_01702 CDS open 28011-28562 _na     183_aa nfnB putative nitroreductase
461 JAEMBK010000003.1 GCA021406745_01703 CDS open 28559-29161 _na     200_aa ribC riboflavin synthase
462 JAEMBK010000003.1 GCA021406745_01704 CDS open 29551-29778 _na     75_aa hypothetical protein
463 JAEMBK010000003.1 GCA021406745_01705 CDS open 29864-30520 _na     218_aa pASTA PASTA domain-containing protein
464 JAEMBK010000003.1 GCA021406745_01706 CDS open 30534-31655 _na     373_aa rluA Pseudouridine synthase
465 JAEMBK010000003.1 GCA021406745_01707 CDS open 31719-32714 _na     331_aa ddl D-alanine--D-alanine ligase
466 JAEMBK010000003.1 GCA021406745_01708 CDS open 32739-33899 _na     386_aa plsC Phospholipid/glycerol acyltransferase domain-containing protein
467 JAEMBK010000003.1 GCA021406745_01709 CDS open 34148-34537 _na     129_aa PEGA domain-containing protein
468 JAEMBK010000003.1 GCA021406745_01710 CDS open 34602-35228 _na     208_aa yigB Haloacid dehalogenase
469 JAEMBK010000003.1 GCA021406745_01711 CDS open 35313-37343 _na     676_aa dpp5 Dipeptidyl-peptidase 5
470 JAEMBK010000003.1 GCA021406745_01712 CDS open 37645-37797 _na     50_aa hypothetical protein
471 JAEMBK010000003.1 GCA021406745_01713 CDS open 38033-38641 _na     202_aa nlpC C40 family peptidase
472 JAEMBK010000003.1 GCA021406745_01714 CDS open 38873-39610 _na     245_aa ompR DNA-binding response regulator
473 JAEMBK010000003.1 GCA021406745_01715 CDS open 39565-39771 _na     68_aa hypothetical protein
474 JAEMBK010000003.1 GCA021406745_01716 CDS open 40166-41086 _na     306_aa corA Transporter
475 JAEMBK010000003.1 GCA021406745_01717 CDS open 41091-41837 _na     248_aa cutC PF03932 family protein CutC
476 JAEMBK010000003.1 GCA021406745_01718 CDS open 42774-43040 _na     88_aa hypothetical protein
477 JAEMBK010000003.1 GCA021406745_01719 CDS open 43125-47774 _na     1549_aa DUF4332 domain-containing protein
478 JAEMBK010000003.1 GCA021406745_01720 CDS open 48046-48159 _na     37_aa hypothetical protein
479 JAEMBK010000003.1 GCA021406745_01721 CDS open 48342-48938 _na     198_aa pabA Anthranilate synthase component II
480 JAEMBK010000003.1 GCA021406745_01722 CDS open 48960-49307 _na     115_aa PAS fold-4 domain-containing protein
481 JAEMBK010000003.1 GCA021406745_01723 CDS open 50057-50644 _na     195_aa fkpA Peptidyl-prolyl cis-trans isomerase
482 JAEMBK010000003.1 GCA021406745_01724 CDS open 50662-51435 _na     257_aa fkpA Peptidyl-prolyl cis-trans isomerase
483 JAEMBK010000003.1 GCA021406745_01725 CDS open 51463-52293 _na     276_aa fkpA Peptidyl-prolyl cis-trans isomerase
484 JAEMBK010000003.1 GCA021406745_01726 CDS open 52340-52462 _na     40_aa hypothetical protein
485 JAEMBK010000003.1 GCA021406745_01727 CDS open 52459-55005 _na     848_aa fepA TonB-dependent receptor%2C putative
486 JAEMBK010000003.1 GCA021406745_01728 CDS open 55239-55670 _na     143_aa DUF306 domain-containing protein
487 JAEMBK010000003.1 GCA021406745_01729 CDS open 55688-56614 _na     308_aa murI glutamate racemase
488 JAEMBK010000003.1 GCA021406745_01730 CDS open 56574-57113 _na     179_aa cobC alpha-ribazole phosphatase
489 JAEMBK010000003.1 GCA021406745_01731 CDS open 57115-57897 _na     260_aa cobS Adenosylcobinamide-GDP ribazoletransferase
490 JAEMBK010000003.1 GCA021406745_01732 CDS open 57904-58941 _na     345_aa cobT nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase
491 JAEMBK010000003.1 GCA021406745_01733 CDS open 58972-59529 _na     185_aa cobU bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase
492 JAEMBK010000003.1 GCA021406745_01734 CDS open 60129-62699 _na     856_aa glgP Maltodextrin phosphorylase
493 JAEMBK010000003.1 GCA021406745_01735 CDS open 62743-63714 _na     323_aa DUF5106 domain-containing protein
494 JAEMBK010000003.1 GCA021406745_01736 CDS open 64020-65195 _na     391_aa ompA Outer membrane protein 41
495 JAEMBK010000003.1 GCA021406745_01737 CDS open 65242-66384 _na     380_aa ompA Outer membrane protein 40
496 JAEMBK010000003.1 GCA021406745_01738 CDS open 67085-68545 _na     486_aa yoaI 4-hydroxybutyryl-CoA dehydratase
497 JAEMBK010000003.1 GCA021406745_01739 CDS open 68618-68902 _na     94_aa nifU NifU-related protein
498 JAEMBK010000003.1 GCA021406745_01740 CDS open 68908-70203 _na     431_aa aCH1 4-hydroxybutyrate CoA-transferase
499 JAEMBK010000003.1 GCA021406745_01741 CDS open 70254-71369 _na     371_aa eutG NAD-dependent 4-hydroxybutyrate dehydrogenase
500 JAEMBK010000003.1 GCA021406745_01742 CDS open 71565-72920 _na     451_aa adhE Succinate-semialdehyde dehydrogenase