BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406795.1)
Select a Genome:
|
BAKTA Annotations for GCA_021406795.1
|
Search & Sort all 4358 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | JAEMBP010000001.1 | repeat_region | open | 127781-128090 | CRISPR array with 5 repeats of length 36%2C consensus sequence GTTGTGTGTACCCTTCGAATAGAGGGTAGATCCAAC and spacer length 30 | |||
| 2 | JAEMBP010000001.1 | GCA021406795_00787 | CDS | open | 546-761 | _na 71_aa | hypothetical protein | |
| 3 | JAEMBP010000001.1 | GCA021406795_00788 | CDS | open | 1122-2396 | _na 424_aa | mgtC | DUF4010 domain-containing protein |
| 4 | JAEMBP010000001.1 | GCA021406795_00789 | CDS | open | 2685-4832 | _na 715_aa | Peptidylprolyl isomerase | |
| 5 | JAEMBP010000001.1 | GCA021406795_00790 | CDS | open | 4939-6192 | _na 417_aa | mpfA | CBS domain protein |
| 6 | JAEMBP010000001.1 | GCA021406795_00791 | CDS | open | 6189-6893 | _na 234_aa | lptC | LPS export ABC transporter periplasmic protein LptC |
| 7 | JAEMBP010000001.1 | GCA021406795_00792 | CDS | open | 6924-8276 | _na 450_aa | bepA | TPR domain protein |
| 8 | JAEMBP010000001.1 | GCA021406795_00793 | CDS | open | 8318-9622 | _na 434_aa | Outer membrane protein | |
| 9 | JAEMBP010000001.1 | GCA021406795_00794 | CDS | open | 9615-10349 | _na 244_aa | coaX | type III pantothenate kinase |
| 10 | JAEMBP010000001.1 | GCA021406795_00795 | CDS | open | 10405-11154 | _na 249_aa | thiF | ThiF protein |
| 11 | JAEMBP010000001.1 | GCA021406795_00796 | CDS | open | 11242-12459 | _na 405_aa | pepT | peptidase T |
| 12 | JAEMBP010000001.1 | GCA021406795_00797 | CDS | open | 12476-14455 | _na 659_aa | oPT | OPT family oligopeptide transporter |
| 13 | JAEMBP010000001.1 | GCA021406795_00798 | CDS | open | 14644-15663 | _na 339_aa | Hemagglutinin-related protein | |
| 14 | JAEMBP010000001.1 | GCA021406795_00799 | CDS | open | 15869-16231 | _na 120_aa | hypothetical protein | |
| 15 | JAEMBP010000001.1 | GCA021406795_00800 | CDS | open | 16343-18973 | _na 876_aa | cirA | Carboxypeptidase-like regulatory domain-containing protein |
| 16 | JAEMBP010000001.1 | GCA021406795_00801 | CDS | open | 18980-19855 | _na 291_aa | GLPGLI family protein | |
| 17 | JAEMBP010000001.1 | GCA021406795_00802 | CDS | open | 19876-20748 | _na 290_aa | GLPGLI family protein | |
| 18 | JAEMBP010000001.1 | GCA021406795_00803 | CDS | open | 20880-21806 | _na 308_aa | wza | Polysaccharide export protein%2C BexD/CtrA/VexA family |
| 19 | JAEMBP010000001.1 | GCA021406795_00804 | CDS | open | 21813-24278 | _na 821_aa | ptk1 | polysaccharide biosynthesis tyrosine autokinase Ptk1 |
| 20 | JAEMBP010000001.1 | GCA021406795_00805 | CDS | open | 24288-25031 | _na 247_aa | php1 | polysaccharide biosynthesis protein-tyrosine phosphatase Php1 |
| 21 | JAEMBP010000001.1 | GCA021406795_00806 | CDS | open | 25190-26305 | _na 371_aa | Nudix hydrolase domain-containing protein | |
| 22 | JAEMBP010000001.1 | GCA021406795_00807 | CDS | open | 26342-27055 | _na 237_aa | rsmI | Tetrapyrrole methylase domain-containing protein |
| 23 | JAEMBP010000001.1 | GCA021406795_00808 | CDS | open | 27059-28465 | _na 468_aa | ncl1 | SAM-dependent MTase RsmB/NOP-type domain-containing protein |
| 24 | JAEMBP010000001.1 | GCA021406795_00809 | CDS | open | 28695-29732 | _na 345_aa | porB | Oxidoreductase%2C putative |
| 25 | JAEMBP010000001.1 | GCA021406795_00810 | CDS | open | 29729-31588 | _na 619_aa | porG | Pyruvate synthase |
| 26 | JAEMBP010000001.1 | GCA021406795_00811 | CDS | open | 31703-31879 | _na 58_aa | hypothetical protein | |
| 27 | JAEMBP010000001.1 | GCA021406795_00812 | CDS | open | 32109-32306 | _na 65_aa | DUF1661 domain-containing protein | |
| 28 | JAEMBP010000001.1 | GCA021406795_00813 | CDS | open | 32488-33216 | _na 242_aa | Putative carbonic anhydrase | |
| 29 | JAEMBP010000001.1 | GCA021406795_00814 | CDS | open | 33519-34586 | _na 355_aa | Lipoprotein | |
| 30 | JAEMBP010000001.1 | GCA021406795_00815 | CDS | open | 34675-35727 | _na 350_aa | Lipoprotein | |
| 31 | JAEMBP010000001.1 | GCA021406795_00816 | CDS | open | 35881-36921 | _na 346_aa | Lipoprotein | |
| 32 | JAEMBP010000001.1 | GCA021406795_00817 | CDS | open | 36940-38040 | _na 366_aa | putative cation efflux system protein | |
| 33 | JAEMBP010000001.1 | GCA021406795_00818 | CDS | open | 38075-41146 | _na 1023_aa | Putative cation efflux system | |
| 34 | JAEMBP010000001.1 | GCA021406795_00819 | CDS | open | 41124-42614 | _na 496_aa | Putative ABC transport system exported protein | |
| 35 | JAEMBP010000001.1 | GCA021406795_00820 | CDS | open | 42654-45821 | _na 1055_aa | RND transporter%2C HAE1/HME family%2C permease protein | |
| 36 | JAEMBP010000001.1 | GCA021406795_00821 | CDS | open | 45927-46157 | _na 76_aa | hypothetical protein | |
| 37 | JAEMBP010000001.1 | GCA021406795_00822 | CDS | open | 46154-46993 | _na 279_aa | frmB | Alpha/beta hydrolase family protein |
| 38 | JAEMBP010000001.1 | GCA021406795_00823 | CDS | open | 47029-47688 | _na 219_aa | Orthopoxovirus protein%2C PF05708 family | |
| 39 | JAEMBP010000001.1 | GCA021406795_00824 | CDS | open | 47669-48013 | _na 114_aa | DUF4878 domain-containing protein | |
| 40 | JAEMBP010000001.1 | GCA021406795_00825 | CDS | open | 48519-49376 | _na 285_aa | Putative auto-transporter adhesin head GIN domain-containing protein | |
| 41 | JAEMBP010000001.1 | GCA021406795_00826 | CDS | open | 49647-50507 | _na 286_aa | Putative auto-transporter adhesin head GIN domain-containing protein | |
| 42 | JAEMBP010000001.1 | GCA021406795_00827 | CDS | open | 50863-51549 | _na 228_aa | clpP | ATP-dependent Clp endopeptidase proteolytic subunit ClpP |
| 43 | JAEMBP010000001.1 | GCA021406795_00828 | CDS | open | 51586-52821 | _na 411_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 44 | JAEMBP010000001.1 | GCA021406795_00829 | CDS | open | 52902-55079 | _na 725_aa | recQ | DNA helicase RecQ |
| 45 | JAEMBP010000001.1 | GCA021406795_00830 | CDS | open | 55131-56498 | _na 455_aa | surA | Peptidylprolyl isomerase |
| 46 | JAEMBP010000001.1 | GCA021406795_00831 | CDS | open | 56560-58440 | _na 626_aa | Organic solvent tolerance-like N-terminal domain-containing protein | |
| 47 | JAEMBP010000001.1 | GCA021406795_00832 | CDS | open | 58431-58775 | _na 114_aa | Ubiquitin carboxyl-hydrolase | |
| 48 | JAEMBP010000001.1 | GCA021406795_00833 | CDS | open | 58772-60628 | _na 618_aa | mutL | DNA mismatch repair endonuclease MutL |
| 49 | JAEMBP010000001.1 | GCA021406795_00834 | CDS | open | 60883-63648 | _na 921_aa | cTD-A | Cleaved adhesin domain-containing protein |
| 50 | JAEMBP010000001.1 | GCA021406795_00835 | CDS | open | 64015-64836 | _na 273_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 51 | JAEMBP010000001.1 | GCA021406795_00836 | CDS | open | 64880-65194 | _na 104_aa | hypothetical protein | |
| 52 | JAEMBP010000001.1 | GCA021406795_00837 | CDS | open | 66230-66568 | _na 112_aa | Phenylalanyl-tRNA synthetase subunit beta | |
| 53 | JAEMBP010000001.1 | GCA021406795_00838 | CDS | open | 66575-66883 | _na 102_aa | zapA | Cell division protein ZapA |
| 54 | JAEMBP010000001.1 | GCA021406795_00839 | CDS | open | 67030-68571 | _na 513_aa | rny | ribonuclease Y |
| 55 | JAEMBP010000001.1 | GCA021406795_00840 | CDS | open | 68679-70091 | _na 470_aa | yaaT | PSP1 C-terminal domain-containing protein |
| 56 | JAEMBP010000001.1 | GCA021406795_00841 | CDS | open | 70099-70629 | _na 176_aa | gldH | Gliding motility protein GldH |
| 57 | JAEMBP010000001.1 | GCA021406795_00842 | CDS | open | 70626-71720 | _na 364_aa | recF | DNA replication/repair protein RecF |
| 58 | JAEMBP010000001.1 | GCA021406795_00843 | CDS | open | 71734-72024 | _na 96_aa | DUF721 domain-containing protein | |
| 59 | JAEMBP010000001.1 | GCA021406795_00844 | CDS | open | 72073-72771 | _na 232_aa | crp | Transcriptional regulator%2C Crp/Fnr family |
| 60 | JAEMBP010000001.1 | GCA021406795_00845 | CDS | open | 73059-77360 | _na 1433_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 61 | JAEMBP010000001.1 | GCA021406795_00846 | CDS | open | 77426-81235 | _na 1269_aa | rpoB | DNA-directed RNA polymerase subunit beta |
| 62 | JAEMBP010000001.1 | GCA021406795_00847 | CDS | open | 81347-81724 | _na 125_aa | rplL | 50S ribosomal protein L7/L12 |
| 63 | JAEMBP010000001.1 | GCA021406795_00848 | CDS | open | 81766-82290 | _na 174_aa | rplJ | 50S ribosomal protein L10 |
| 64 | JAEMBP010000001.1 | GCA021406795_00849 | CDS | open | 82306-83004 | _na 232_aa | rplA | 50S ribosomal protein L1 |
| 65 | JAEMBP010000001.1 | GCA021406795_00850 | CDS | open | 83025-83462 | _na 145_aa | rplK | 50S ribosomal protein L11 |
| 66 | JAEMBP010000001.1 | GCA021406795_00851 | CDS | open | 83531-84070 | _na 179_aa | nusG | transcription termination/antitermination protein NusG |
| 67 | JAEMBP010000001.1 | GCA021406795_00852 | CDS | open | 84092-84295 | _na 67_aa | secE | preprotein translocase subunit SecE |
| 68 | JAEMBP010000001.1 | GCA021406795_00854 | CDS | open | 84454-85641 | _na 395_aa | tuf | elongation factor Tu |
| 69 | JAEMBP010000001.1 | GCA021406795_00857 | CDS | open | 86035-87240 | _na 401_aa | hpf | ribosome hibernation-promoting factor%2C HPF/YfiA family |
| 70 | JAEMBP010000001.1 | GCA021406795_00858 | CDS | open | 87317-87508 | _na 63_aa | rpsU | 30S ribosomal protein S21 |
| 71 | JAEMBP010000001.1 | GCA021406795_00859 | CDS | open | 87670-90192 | _na 840_aa | rqcU | endonuclease MutS2 |
| 72 | JAEMBP010000001.1 | GCA021406795_00860 | CDS | open | 90202-91521 | _na 439_aa | rseP | RIP metalloprotease RseP |
| 73 | JAEMBP010000001.1 | GCA021406795_00861 | CDS | open | 91999-93519 | _na 506_aa | nhaP2 | potassium/proton antiporter |
| 74 | JAEMBP010000001.1 | GCA021406795_00862 | CDS | open | 93516-95552 | _na 678_aa | uvrB | excinuclease ABC subunit UvrB |
| 75 | JAEMBP010000001.1 | GCA021406795_00863 | CDS | open | 95926-96750 | _na 274_aa | tsf | translation elongation factor Ts |
| 76 | JAEMBP010000001.1 | GCA021406795_00864 | CDS | open | 96889-97734 | _na 281_aa | rpsB | 30S ribosomal protein S2 |
| 77 | JAEMBP010000001.1 | GCA021406795_00865 | CDS | open | 97869-98255 | _na 128_aa | rpsI | 30S ribosomal protein S9 |
| 78 | JAEMBP010000001.1 | GCA021406795_00866 | CDS | open | 98265-98720 | _na 151_aa | rplM | 50S ribosomal protein L13 |
| 79 | JAEMBP010000001.1 | GCA021406795_00867 | CDS | open | 99283-99951 | _na 222_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 80 | JAEMBP010000001.1 | GCA021406795_00868 | CDS | open | 100987-101448 | _na 153_aa | coaD | pantetheine-phosphate adenylyltransferase |
| 81 | JAEMBP010000001.1 | GCA021406795_00869 | CDS | open | 101479-103413 | _na 644_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) |
| 82 | JAEMBP010000001.1 | GCA021406795_00870 | CDS | open | 103892-104452 | _na 186_aa | DUF5063 domain-containing protein | |
| 83 | JAEMBP010000001.1 | GCA021406795_00871 | CDS | open | 104493-105095 | _na 200_aa | rnd | 3'-5' exonuclease domain protein |
| 84 | JAEMBP010000001.1 | GCA021406795_00872 | CDS | open | 105092-106297 | _na 401_aa | rlmK | PUA domain-containing protein |
| 85 | JAEMBP010000001.1 | GCA021406795_00873 | CDS | open | 106360-107181 | _na 273_aa | mltF | Solute-binding protein family 3/N-terminal domain-containing protein |
| 86 | JAEMBP010000001.1 | GCA021406795_00874 | CDS | open | 107188-109311 | _na 707_aa | TonB-dependent receptor | |
| 87 | JAEMBP010000001.1 | GCA021406795_00875 | CDS | open | 109256-110563 | _na 435_aa | rPS27A | TPM domain-containing protein |
| 88 | JAEMBP010000001.1 | GCA021406795_00876 | CDS | open | 110585-111175 | _na 196_aa | lemA | LemA protein |
| 89 | JAEMBP010000001.1 | GCA021406795_00877 | CDS | open | 111219-111806 | _na 195_aa | rutF | Putative flavoredoxin |
| 90 | JAEMBP010000001.1 | GCA021406795_00878 | CDS | open | 111835-112275 | _na 146_aa | pyrI | aspartate carbamoyltransferase regulatory subunit |
| 91 | JAEMBP010000001.1 | GCA021406795_00879 | CDS | open | 112303-113217 | _na 304_aa | pyrB | aspartate carbamoyltransferase |
| 92 | JAEMBP010000001.1 | GCA021406795_00880 | CDS | open | 113264-114001 | _na 245_aa | sIMPL | SIMPL domain-containing protein |
| 93 | JAEMBP010000001.1 | GCA021406795_00881 | CDS | open | 114030-114956 | _na 308_aa | Outer membrane insertion signal domain protein | |
| 94 | JAEMBP010000001.1 | GCA021406795_00882 | CDS | open | 115391-116971 | _na 526_aa | nanH | exo-alpha-sialidase |
| 95 | JAEMBP010000001.1 | GCA021406795_00883 | CDS | open | 117398-118792 | _na 464_aa | yopM | Internalin |
| 96 | JAEMBP010000001.1 | GCA021406795_00884 | CDS | open | 118887-119639 | _na 250_aa | ycjU | Hydrolase%2C haloacid dehalogenase-like family |
| 97 | JAEMBP010000001.1 | GCA021406795_00885 | CDS | open | 119657-121753 | _na 698_aa | recG | ATP-dependent DNA helicase RecG |
| 98 | JAEMBP010000001.1 | GCA021406795_00886 | CDS | open | 121796-122824 | _na 342_aa | galE | UDP-glucose 4-epimerase GalE |
| 99 | JAEMBP010000001.1 | GCA021406795_00887 | CDS | open | 122834-123439 | _na 201_aa | yihA | ribosome biogenesis GTP-binding protein YihA/YsxC |
| 100 | JAEMBP010000001.1 | GCA021406795_00888 | CDS | open | 123540-124133 | _na 197_aa | Histidine kinase | |
| 101 | JAEMBP010000001.1 | GCA021406795_00889 | CDS | open | 124136-125605 | _na 489_aa | cpdA | Metallophosphoesterase family protein |
| 102 | JAEMBP010000001.1 | GCA021406795_00890 | CDS | open | 125786-126967 | _na 393_aa | megL | methionine gamma-lyase |
| 103 | JAEMBP010000001.1 | GCA021406795_00891 | CDS | open | 127049-127294 | _na 81_aa | hypothetical protein | |
| 104 | JAEMBP010000001.1 | GCA021406795_00892 | CDS | open | 128290-128832 | _na 180_aa | csx28 | CRISPR-associated protein Csx28 |
| 105 | JAEMBP010000001.1 | GCA021406795_00893 | CDS | open | 128840-132367 | _na 1175_aa | cas13b | type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b |
| 106 | JAEMBP010000001.1 | GCA021406795_00894 | CDS | open | 132655-133224 | _na 189_aa | Plasmid pRiA4b Orf3-like domain-containing protein | |
| 107 | JAEMBP010000001.1 | GCA021406795_00895 | CDS | open | 133240-134142 | _na 300_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 108 | JAEMBP010000001.1 | GCA021406795_00896 | CDS | open | 134195-135154 | _na 319_aa | wcaA | Glycosyl transferase%2C group 2 family protein |
| 109 | JAEMBP010000001.1 | GCA021406795_00897 | CDS | open | 135165-136073 | _na 302_aa | rhaT | EamA domain-containing protein |
| 110 | JAEMBP010000001.1 | GCA021406795_00898 | CDS | open | 136301-138277 | _na 658_aa | rho | transcription termination factor Rho |
| 111 | JAEMBP010000001.1 | GCA021406795_00899 | CDS | open | 138953-139468 | _na 171_aa | hupA | DNA-binding protein%2C histone-like family |
| 112 | JAEMBP010000001.1 | GCA021406795_00900 | CDS | open | 139517-140419 | _na 300_aa | ftcD | glutamate formimidoyltransferase |
| 113 | JAEMBP010000001.1 | GCA021406795_00901 | CDS | open | 140541-141791 | _na 416_aa | hutI | imidazolonepropionase |
| 114 | JAEMBP010000001.1 | GCA021406795_00902 | CDS | open | 141885-143039 | _na 384_aa | Nucleoside transporter/FeoB GTPase Gate domain-containing protein | |
| 115 | JAEMBP010000001.1 | GCA021406795_00903 | CDS | open | 143080-144207 | _na 375_aa | lomR | Porin |
| 116 | JAEMBP010000001.1 | GCA021406795_00904 | CDS | open | 144232-144861 | _na 209_aa | ftcD | Cyclodeaminase/cyclohydrolase domain-containing protein |
| 117 | JAEMBP010000001.1 | GCA021406795_00905 | CDS | open | 144864-146357 | _na 497_aa | hutH | histidine ammonia-lyase |
| 118 | JAEMBP010000001.1 | GCA021406795_00906 | CDS | open | 146558-146887 | _na 109_aa | qdoI | Cupin type-2 domain-containing protein |
| 119 | JAEMBP010000001.1 | GCA021406795_00907 | CDS | open | 147010-148188 | _na 392_aa | gltP | Serine/threonine transporter |
| 120 | JAEMBP010000001.1 | GCA021406795_00908 | CDS | open | 148217-149323 | _na 368_aa | meaB | methylmalonyl Co-A mutase-associated GTPase MeaB |
| 121 | JAEMBP010000001.1 | GCA021406795_00909 | CDS | open | 149399-150487 | _na 362_aa | DUF1573 domain-containing protein | |
| 122 | JAEMBP010000001.1 | GCA021406795_00910 | CDS | open | 150519-150902 | _na 127_aa | DUF1573 domain-containing protein | |
| 123 | JAEMBP010000001.1 | GCA021406795_00911 | CDS | open | 151108-151356 | _na 82_aa | hypothetical protein | |
| 124 | JAEMBP010000001.1 | GCA021406795_00912 | CDS | open | 151514-154174 | _na 886_aa | Peptidase family M49 | |
| 125 | JAEMBP010000001.1 | GCA021406795_00913 | CDS | open | 154187-155458 | _na 423_aa | serS | serine--tRNA ligase |
| 126 | JAEMBP010000001.1 | GCA021406795_00914 | CDS | open | 155558-155815 | _na 85_aa | rpmA | 50S ribosomal protein L27 |
| 127 | JAEMBP010000001.1 | GCA021406795_00915 | CDS | open | 155843-156160 | _na 105_aa | rplU | 50S ribosomal protein L21 |
| 128 | JAEMBP010000001.1 | GCA021406795_00916 | CDS | open | 156411-156626 | _na 71_aa | 50S ribosomal protein L28 domain protein | |
| 129 | JAEMBP010000001.1 | GCA021406795_00917 | CDS | open | 156888-157427 | _na 179_aa | DUF4199 domain-containing protein | |
| 130 | JAEMBP010000001.1 | GCA021406795_00918 | CDS | open | 157424-158377 | _na 317_aa | wcaA | Glycosyl transferase%2C group 2 family protein |
| 131 | JAEMBP010000001.1 | GCA021406795_00919 | CDS | open | 158377-158916 | _na 179_aa | nfnB | Nitroreductase family protein |
| 132 | JAEMBP010000001.1 | GCA021406795_00920 | CDS | open | 158913-159926 | _na 337_aa | apbE | FAD:protein FMN transferase |
| 133 | JAEMBP010000001.1 | GCA021406795_00921 | CDS | open | 160139-160711 | _na 190_aa | rnfA | Ion-translocating oxidoreductase complex subunit A |
| 134 | JAEMBP010000001.1 | GCA021406795_00922 | CDS | open | 160736-161326 | _na 196_aa | rnfE | Ion-translocating oxidoreductase complex subunit E |
| 135 | JAEMBP010000001.1 | GCA021406795_00923 | CDS | open | 161323-162000 | _na 225_aa | rnfG | Ion-translocating oxidoreductase complex subunit G |
| 136 | JAEMBP010000001.1 | GCA021406795_00924 | CDS | open | 161997-162980 | _na 327_aa | rnfD | Ion-translocating oxidoreductase complex subunit D |
| 137 | JAEMBP010000001.1 | GCA021406795_00925 | CDS | open | 162996-164327 | _na 443_aa | rsxC | electron transport complex subunit RsxC |
| 138 | JAEMBP010000001.1 | GCA021406795_00926 | CDS | open | 164363-165235 | _na 290_aa | rnfB | Fe-S cluster domain-containing protein |
| 139 | JAEMBP010000001.1 | GCA021406795_00927 | CDS | open | 165245-165667 | _na 140_aa | rseC | Positive regulator of sigma(E)%2C RseC/MucC |
| 140 | JAEMBP010000001.1 | GCA021406795_00928 | CDS | open | 166024-167316 | _na 430_aa | cpoB | TPR domain protein |
| 141 | JAEMBP010000001.1 | GCA021406795_00787 | gene | open | 546-761 | |||
| 142 | JAEMBP010000001.1 | GCA021406795_00788 | gene | open | 1122-2396 | mgtC | ||
| 143 | JAEMBP010000001.1 | GCA021406795_00789 | gene | open | 2685-4832 | |||
| 144 | JAEMBP010000001.1 | GCA021406795_00790 | gene | open | 4939-6192 | mpfA | ||
| 145 | JAEMBP010000001.1 | GCA021406795_00791 | gene | open | 6189-6893 | lptC | ||
| 146 | JAEMBP010000001.1 | GCA021406795_00792 | gene | open | 6924-8276 | bepA | ||
| 147 | JAEMBP010000001.1 | GCA021406795_00793 | gene | open | 8318-9622 | |||
| 148 | JAEMBP010000001.1 | GCA021406795_00794 | gene | open | 9615-10349 | coaX | ||
| 149 | JAEMBP010000001.1 | GCA021406795_00795 | gene | open | 10405-11154 | thiF | ||
| 150 | JAEMBP010000001.1 | GCA021406795_00796 | gene | open | 11242-12459 | pepT | ||
| 151 | JAEMBP010000001.1 | GCA021406795_00797 | gene | open | 12476-14455 | oPT | ||
| 152 | JAEMBP010000001.1 | GCA021406795_00798 | gene | open | 14644-15663 | |||
| 153 | JAEMBP010000001.1 | GCA021406795_00799 | gene | open | 15869-16231 | |||
| 154 | JAEMBP010000001.1 | GCA021406795_00800 | gene | open | 16343-18973 | cirA | ||
| 155 | JAEMBP010000001.1 | GCA021406795_00801 | gene | open | 18980-19855 | |||
| 156 | JAEMBP010000001.1 | GCA021406795_00802 | gene | open | 19876-20748 | |||
| 157 | JAEMBP010000001.1 | GCA021406795_00803 | gene | open | 20880-21806 | wza | ||
| 158 | JAEMBP010000001.1 | GCA021406795_00804 | gene | open | 21813-24278 | ptk1 | ||
| 159 | JAEMBP010000001.1 | GCA021406795_00805 | gene | open | 24288-25031 | php1 | ||
| 160 | JAEMBP010000001.1 | GCA021406795_00806 | gene | open | 25190-26305 | |||
| 161 | JAEMBP010000001.1 | GCA021406795_00807 | gene | open | 26342-27055 | rsmI | ||
| 162 | JAEMBP010000001.1 | GCA021406795_00808 | gene | open | 27059-28465 | ncl1 | ||
| 163 | JAEMBP010000001.1 | GCA021406795_00809 | gene | open | 28695-29732 | porB | ||
| 164 | JAEMBP010000001.1 | GCA021406795_00810 | gene | open | 29729-31588 | porG | ||
| 165 | JAEMBP010000001.1 | GCA021406795_00811 | gene | open | 31703-31879 | |||
| 166 | JAEMBP010000001.1 | GCA021406795_00812 | gene | open | 32109-32306 | |||
| 167 | JAEMBP010000001.1 | GCA021406795_00813 | gene | open | 32488-33216 | |||
| 168 | JAEMBP010000001.1 | GCA021406795_00814 | gene | open | 33519-34586 | |||
| 169 | JAEMBP010000001.1 | GCA021406795_00815 | gene | open | 34675-35727 | |||
| 170 | JAEMBP010000001.1 | GCA021406795_00816 | gene | open | 35881-36921 | |||
| 171 | JAEMBP010000001.1 | GCA021406795_00817 | gene | open | 36940-38040 | |||
| 172 | JAEMBP010000001.1 | GCA021406795_00818 | gene | open | 38075-41146 | |||
| 173 | JAEMBP010000001.1 | GCA021406795_00819 | gene | open | 41124-42614 | |||
| 174 | JAEMBP010000001.1 | GCA021406795_00820 | gene | open | 42654-45821 | |||
| 175 | JAEMBP010000001.1 | GCA021406795_00821 | gene | open | 45927-46157 | |||
| 176 | JAEMBP010000001.1 | GCA021406795_00822 | gene | open | 46154-46993 | frmB | ||
| 177 | JAEMBP010000001.1 | GCA021406795_00823 | gene | open | 47029-47688 | |||
| 178 | JAEMBP010000001.1 | GCA021406795_00824 | gene | open | 47669-48013 | |||
| 179 | JAEMBP010000001.1 | GCA021406795_00825 | gene | open | 48519-49376 | |||
| 180 | JAEMBP010000001.1 | GCA021406795_00826 | gene | open | 49647-50507 | |||
| 181 | JAEMBP010000001.1 | GCA021406795_00827 | gene | open | 50863-51549 | clpP | ||
| 182 | JAEMBP010000001.1 | GCA021406795_00828 | gene | open | 51586-52821 | clpX | ||
| 183 | JAEMBP010000001.1 | GCA021406795_00829 | gene | open | 52902-55079 | recQ | ||
| 184 | JAEMBP010000001.1 | GCA021406795_00830 | gene | open | 55131-56498 | surA | ||
| 185 | JAEMBP010000001.1 | GCA021406795_00831 | gene | open | 56560-58440 | |||
| 186 | JAEMBP010000001.1 | GCA021406795_00832 | gene | open | 58431-58775 | |||
| 187 | JAEMBP010000001.1 | GCA021406795_00833 | gene | open | 58772-60628 | mutL | ||
| 188 | JAEMBP010000001.1 | GCA021406795_00834 | gene | open | 60883-63648 | cTD-A | ||
| 189 | JAEMBP010000001.1 | GCA021406795_00835 | gene | open | 64015-64836 | |||
| 190 | JAEMBP010000001.1 | GCA021406795_00836 | gene | open | 64880-65194 | |||
| 191 | JAEMBP010000001.1 | GCA021406795_00837 | gene | open | 66230-66568 | |||
| 192 | JAEMBP010000001.1 | GCA021406795_00838 | gene | open | 66575-66883 | zapA | ||
| 193 | JAEMBP010000001.1 | GCA021406795_00839 | gene | open | 67030-68571 | rny | ||
| 194 | JAEMBP010000001.1 | GCA021406795_00840 | gene | open | 68679-70091 | yaaT | ||
| 195 | JAEMBP010000001.1 | GCA021406795_00841 | gene | open | 70099-70629 | gldH | ||
| 196 | JAEMBP010000001.1 | GCA021406795_00842 | gene | open | 70626-71720 | recF | ||
| 197 | JAEMBP010000001.1 | GCA021406795_00843 | gene | open | 71734-72024 | |||
| 198 | JAEMBP010000001.1 | GCA021406795_00844 | gene | open | 72073-72771 | crp | ||
| 199 | JAEMBP010000001.1 | GCA021406795_00845 | gene | open | 73059-77360 | rpoC | ||
| 200 | JAEMBP010000001.1 | GCA021406795_00846 | gene | open | 77426-81235 | rpoB | ||
| 201 | JAEMBP010000001.1 | GCA021406795_00847 | gene | open | 81347-81724 | rplL | ||
| 202 | JAEMBP010000001.1 | GCA021406795_00848 | gene | open | 81766-82290 | rplJ | ||
| 203 | JAEMBP010000001.1 | GCA021406795_00849 | gene | open | 82306-83004 | rplA | ||
| 204 | JAEMBP010000001.1 | GCA021406795_00850 | gene | open | 83025-83462 | rplK | ||
| 205 | JAEMBP010000001.1 | GCA021406795_00851 | gene | open | 83531-84070 | nusG | ||
| 206 | JAEMBP010000001.1 | GCA021406795_00852 | gene | open | 84092-84295 | secE | ||
| 207 | JAEMBP010000001.1 | GCA021406795_00854 | gene | open | 84454-85641 | tuf | ||
| 208 | JAEMBP010000001.1 | GCA021406795_00857 | gene | open | 86035-87240 | hpf | ||
| 209 | JAEMBP010000001.1 | GCA021406795_00858 | gene | open | 87317-87508 | rpsU | ||
| 210 | JAEMBP010000001.1 | GCA021406795_00859 | gene | open | 87670-90192 | rqcU | ||
| 211 | JAEMBP010000001.1 | GCA021406795_00860 | gene | open | 90202-91521 | rseP | ||
| 212 | JAEMBP010000001.1 | GCA021406795_00861 | gene | open | 91999-93519 | nhaP2 | ||
| 213 | JAEMBP010000001.1 | GCA021406795_00862 | gene | open | 93516-95552 | uvrB | ||
| 214 | JAEMBP010000001.1 | GCA021406795_00863 | gene | open | 95926-96750 | tsf | ||
| 215 | JAEMBP010000001.1 | GCA021406795_00864 | gene | open | 96889-97734 | rpsB | ||
| 216 | JAEMBP010000001.1 | GCA021406795_00865 | gene | open | 97869-98255 | rpsI | ||
| 217 | JAEMBP010000001.1 | GCA021406795_00866 | gene | open | 98265-98720 | rplM | ||
| 218 | JAEMBP010000001.1 | GCA021406795_00867 | gene | open | 99283-99951 | |||
| 219 | JAEMBP010000001.1 | GCA021406795_00868 | gene | open | 100987-101448 | coaD | ||
| 220 | JAEMBP010000001.1 | GCA021406795_00869 | gene | open | 101479-103413 | gyrB | ||
| 221 | JAEMBP010000001.1 | GCA021406795_00870 | gene | open | 103892-104452 | |||
| 222 | JAEMBP010000001.1 | GCA021406795_00871 | gene | open | 104493-105095 | rnd | ||
| 223 | JAEMBP010000001.1 | GCA021406795_00872 | gene | open | 105092-106297 | rlmK | ||
| 224 | JAEMBP010000001.1 | GCA021406795_00873 | gene | open | 106360-107181 | mltF | ||
| 225 | JAEMBP010000001.1 | GCA021406795_00874 | gene | open | 107188-109311 | |||
| 226 | JAEMBP010000001.1 | GCA021406795_00875 | gene | open | 109256-110563 | rPS27A | ||
| 227 | JAEMBP010000001.1 | GCA021406795_00876 | gene | open | 110585-111175 | lemA | ||
| 228 | JAEMBP010000001.1 | GCA021406795_00877 | gene | open | 111219-111806 | rutF | ||
| 229 | JAEMBP010000001.1 | GCA021406795_00878 | gene | open | 111835-112275 | pyrI | ||
| 230 | JAEMBP010000001.1 | GCA021406795_00879 | gene | open | 112303-113217 | pyrB | ||
| 231 | JAEMBP010000001.1 | GCA021406795_00880 | gene | open | 113264-114001 | sIMPL | ||
| 232 | JAEMBP010000001.1 | GCA021406795_00881 | gene | open | 114030-114956 | |||
| 233 | JAEMBP010000001.1 | GCA021406795_00882 | gene | open | 115391-116971 | nanH | ||
| 234 | JAEMBP010000001.1 | GCA021406795_00883 | gene | open | 117398-118792 | yopM | ||
| 235 | JAEMBP010000001.1 | GCA021406795_00884 | gene | open | 118887-119639 | ycjU | ||
| 236 | JAEMBP010000001.1 | GCA021406795_00885 | gene | open | 119657-121753 | recG | ||
| 237 | JAEMBP010000001.1 | GCA021406795_00886 | gene | open | 121796-122824 | galE | ||
| 238 | JAEMBP010000001.1 | GCA021406795_00887 | gene | open | 122834-123439 | yihA | ||
| 239 | JAEMBP010000001.1 | GCA021406795_00888 | gene | open | 123540-124133 | |||
| 240 | JAEMBP010000001.1 | GCA021406795_00889 | gene | open | 124136-125605 | cpdA | ||
| 241 | JAEMBP010000001.1 | GCA021406795_00890 | gene | open | 125786-126967 | megL | ||
| 242 | JAEMBP010000001.1 | GCA021406795_00891 | gene | open | 127049-127294 | |||
| 243 | JAEMBP010000001.1 | GCA021406795_00892 | gene | open | 128290-128832 | csx28 | ||
| 244 | JAEMBP010000001.1 | GCA021406795_00893 | gene | open | 128840-132367 | cas13b | ||
| 245 | JAEMBP010000001.1 | GCA021406795_00894 | gene | open | 132655-133224 | |||
| 246 | JAEMBP010000001.1 | GCA021406795_00895 | gene | open | 133240-134142 | miaA | ||
| 247 | JAEMBP010000001.1 | GCA021406795_00896 | gene | open | 134195-135154 | wcaA | ||
| 248 | JAEMBP010000001.1 | GCA021406795_00897 | gene | open | 135165-136073 | rhaT | ||
| 249 | JAEMBP010000001.1 | GCA021406795_00898 | gene | open | 136301-138277 | rho | ||
| 250 | JAEMBP010000001.1 | GCA021406795_00899 | gene | open | 138953-139468 | hupA | ||
| 251 | JAEMBP010000001.1 | GCA021406795_00900 | gene | open | 139517-140419 | ftcD | ||
| 252 | JAEMBP010000001.1 | GCA021406795_00901 | gene | open | 140541-141791 | hutI | ||
| 253 | JAEMBP010000001.1 | GCA021406795_00902 | gene | open | 141885-143039 | |||
| 254 | JAEMBP010000001.1 | GCA021406795_00903 | gene | open | 143080-144207 | lomR | ||
| 255 | JAEMBP010000001.1 | GCA021406795_00904 | gene | open | 144232-144861 | ftcD | ||
| 256 | JAEMBP010000001.1 | GCA021406795_00905 | gene | open | 144864-146357 | hutH | ||
| 257 | JAEMBP010000001.1 | GCA021406795_00906 | gene | open | 146558-146887 | qdoI | ||
| 258 | JAEMBP010000001.1 | GCA021406795_00907 | gene | open | 147010-148188 | gltP | ||
| 259 | JAEMBP010000001.1 | GCA021406795_00908 | gene | open | 148217-149323 | meaB | ||
| 260 | JAEMBP010000001.1 | GCA021406795_00909 | gene | open | 149399-150487 | |||
| 261 | JAEMBP010000001.1 | GCA021406795_00910 | gene | open | 150519-150902 | |||
| 262 | JAEMBP010000001.1 | GCA021406795_00911 | gene | open | 151108-151356 | |||
| 263 | JAEMBP010000001.1 | GCA021406795_00912 | gene | open | 151514-154174 | |||
| 264 | JAEMBP010000001.1 | GCA021406795_00913 | gene | open | 154187-155458 | serS | ||
| 265 | JAEMBP010000001.1 | GCA021406795_00914 | gene | open | 155558-155815 | rpmA | ||
| 266 | JAEMBP010000001.1 | GCA021406795_00915 | gene | open | 155843-156160 | rplU | ||
| 267 | JAEMBP010000001.1 | GCA021406795_00916 | gene | open | 156411-156626 | |||
| 268 | JAEMBP010000001.1 | GCA021406795_00917 | gene | open | 156888-157427 | |||
| 269 | JAEMBP010000001.1 | GCA021406795_00918 | gene | open | 157424-158377 | wcaA | ||
| 270 | JAEMBP010000001.1 | GCA021406795_00919 | gene | open | 158377-158916 | nfnB | ||
| 271 | JAEMBP010000001.1 | GCA021406795_00920 | gene | open | 158913-159926 | apbE | ||
| 272 | JAEMBP010000001.1 | GCA021406795_00921 | gene | open | 160139-160711 | rnfA | ||
| 273 | JAEMBP010000001.1 | GCA021406795_00922 | gene | open | 160736-161326 | rnfE | ||
| 274 | JAEMBP010000001.1 | GCA021406795_00923 | gene | open | 161323-162000 | rnfG | ||
| 275 | JAEMBP010000001.1 | GCA021406795_00924 | gene | open | 161997-162980 | rnfD | ||
| 276 | JAEMBP010000001.1 | GCA021406795_00925 | gene | open | 162996-164327 | rsxC | ||
| 277 | JAEMBP010000001.1 | GCA021406795_00926 | gene | open | 164363-165235 | rnfB | ||
| 278 | JAEMBP010000001.1 | GCA021406795_00927 | gene | open | 165245-165667 | rseC | ||
| 279 | JAEMBP010000001.1 | GCA021406795_00928 | gene | open | 166024-167316 | cpoB | ||
| 280 | JAEMBP010000001.1 | GCA021406795_00853 | gene | open | 84311-84383 | trnW | ||
| 281 | JAEMBP010000001.1 | GCA021406795_00855 | gene | open | 85709-85780 | trnT | ||
| 282 | JAEMBP010000001.1 | GCA021406795_00856 | gene | open | 85813-85895 | trnY | ||
| 283 | JAEMBP010000001.1 | GCA021406795_00853 | tRNA | open | 84311-84383 | trnW | tRNA-Trp(cca) | |
| 284 | JAEMBP010000001.1 | GCA021406795_00855 | tRNA | open | 85709-85780 | trnT | tRNA-Thr(ggt) | |
| 285 | JAEMBP010000001.1 | GCA021406795_00856 | tRNA | open | 85813-85895 | trnY | tRNA-Tyr(gta) | |
| 286 | JAEMBP010000002.1 | rep_origin | open | 53505-53981 | ||||
| 287 | JAEMBP010000002.1 | GCA021406795_01413 | CDS | open | 201-3425 | _na 1074_aa | DNA 3'-5' helicase | |
| 288 | JAEMBP010000002.1 | GCA021406795_01414 | CDS | open | 3422-4282 | _na 286_aa | alr0228 | Putative acyltransferase ACT14924-like acyltransferase domain-containing protein |
| 289 | JAEMBP010000002.1 | GCA021406795_01415 | CDS | open | 4327-5253 | _na 308_aa | pgsA | CDP-alcohol phosphatidyltransferase |
| 290 | JAEMBP010000002.1 | GCA021406795_01416 | CDS | open | 5265-5996 | _na 243_aa | fabG | Oxidoreductase%2C short chain dehydrogenase/reductase family |
| 291 | JAEMBP010000002.1 | GCA021406795_01417 | CDS | open | 6002-6460 | _na 152_aa | tagD | Glycerol-3-phosphate cytidylyltransferase |
| 292 | JAEMBP010000002.1 | GCA021406795_01418 | CDS | open | 6482-7579 | _na 365_aa | pdxA | 4-hydroxythreonine-4-phosphate dehydrogenase PdxA |
| 293 | JAEMBP010000002.1 | GCA021406795_01419 | CDS | open | 7623-8678 | _na 351_aa | Lipoprotein | |
| 294 | JAEMBP010000002.1 | GCA021406795_01420 | CDS | open | 8769-9782 | _na 337_aa | rlmN | 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN |
| 295 | JAEMBP010000002.1 | GCA021406795_01421 | CDS | open | 10457-11794 | _na 445_aa | hisS | histidine--tRNA ligase |
| 296 | JAEMBP010000002.1 | GCA021406795_01422 | CDS | open | 11882-12370 | _na 162_aa | folA | Dihydrofolate reductase |
| 297 | JAEMBP010000002.1 | GCA021406795_01423 | CDS | open | 12416-13210 | _na 264_aa | thyA | thymidylate synthase |
| 298 | JAEMBP010000002.1 | GCA021406795_01424 | CDS | open | 13443-14240 | _na 265_aa | bepA | Peptidase M48 domain-containing protein |
| 299 | JAEMBP010000002.1 | GCA021406795_01425 | CDS | open | 14191-14328 | _na 45_aa | hypothetical protein | |
| 300 | JAEMBP010000002.1 | GCA021406795_01426 | CDS | open | 14451-15332 | _na 293_aa | Peptidase | |
| 301 | JAEMBP010000002.1 | GCA021406795_01427 | CDS | open | 15574-17511 | _na 645_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 302 | JAEMBP010000002.1 | GCA021406795_01428 | CDS | open | 17508-19595 | _na 695_aa | pilF | TPR domain protein |
| 303 | JAEMBP010000002.1 | GCA021406795_01429 | CDS | open | 19631-20308 | _na 225_aa | def | peptide deformylase |
| 304 | JAEMBP010000002.1 | GCA021406795_01430 | CDS | open | 20305-20943 | _na 212_aa | ruvX | Holliday junction resolvase RuvX |
| 305 | JAEMBP010000002.1 | GCA021406795_01431 | CDS | open | 21223-26946 | _na 1907_aa | yfaS | Alpha-2-macroglobulin domain-containing protein |
| 306 | JAEMBP010000002.1 | GCA021406795_01432 | CDS | open | 26960-27904 | _na 314_aa | panE | 2-dehydropantoate 2-reductase |
| 307 | JAEMBP010000002.1 | GCA021406795_01433 | CDS | open | 28040-29656 | _na 538_aa | uup | ABC transporter%2C ATP-binding protein |
| 308 | JAEMBP010000002.1 | GCA021406795_01434 | CDS | open | 29932-30951 | _na 339_aa | wcaG | 3-beta hydroxysteroid dehydrogenase/isomerase domain-containing protein |
| 309 | JAEMBP010000002.1 | GCA021406795_01435 | CDS | open | 31201-31455 | _na 84_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 310 | JAEMBP010000002.1 | GCA021406795_01436 | CDS | open | 31483-34341 | _na 952_aa | uvrA | excinuclease ABC subunit UvrA |
| 311 | JAEMBP010000002.1 | GCA021406795_01440 | CDS | open | 35380-35562 | _na 60_aa | nirB | Bacterioferritin-associated ferredoxin |
| 312 | JAEMBP010000002.1 | GCA021406795_01441 | CDS | open | 35834-37108 | _na 424_aa | DUF2851 domain-containing protein | |
| 313 | JAEMBP010000002.1 | GCA021406795_01442 | CDS | open | 37143-38228 | _na 361_aa | cpsB | Mannose-1-phosphate guanylyltransferase |
| 314 | JAEMBP010000002.1 | GCA021406795_01443 | CDS | open | 38332-40032 | _na 566_aa | cTD-A | GLUG domain-containing protein |
| 315 | JAEMBP010000002.1 | GCA021406795_01444 | CDS | open | 40208-42109 | _na 633_aa | dxs | 1-deoxy-D-xylulose-5-phosphate synthase |
| 316 | JAEMBP010000002.1 | GCA021406795_01445 | CDS | open | 42162-43502 | _na 446_aa | trkA | Trk system potassium transporter TrkA |
| 317 | JAEMBP010000002.1 | GCA021406795_01446 | CDS | open | 43529-44992 | _na 487_aa | trkH | Potassium uptake protein TrkH |
| 318 | JAEMBP010000002.1 | GCA021406795_01448 | CDS | open | 46013-47404 | _na 463_aa | mtaB | tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB |
| 319 | JAEMBP010000002.1 | GCA021406795_01449 | CDS | open | 47401-48318 | _na 305_aa | lpxP | Acyltransferase%2C HtrB/MsbB family |
| 320 | JAEMBP010000002.1 | GCA021406795_01450 | CDS | open | 48315-49325 | _na 336_aa | wcaE | Glycosyltransferase 2-like domain-containing protein |
| 321 | JAEMBP010000002.1 | GCA021406795_01451 | CDS | open | 49468-50064 | _na 198_aa | terC | TerC family integral membrane protein |
| 322 | JAEMBP010000002.1 | GCA021406795_01452 | CDS | open | 50057-50353 | _na 98_aa | marR | Winged helix DNA-binding domain-containing protein |
| 323 | JAEMBP010000002.1 | GCA021406795_01453 | CDS | open | 50433-52655 | _na 740_aa | fepA | Collagen-binding protein |
| 324 | JAEMBP010000002.1 | GCA021406795_01454 | CDS | open | 52652-53308 | _na 218_aa | TPR domain protein | |
| 325 | JAEMBP010000002.1 | GCA021406795_01455 | CDS | open | 53982-55403 | _na 473_aa | dnaA | chromosomal replication initiator protein DnaA |
| 326 | JAEMBP010000002.1 | GCA021406795_01456 | CDS | open | 55416-55988 | _na 190_aa | wbbJ | Hexapeptide transferase family protein |
| 327 | JAEMBP010000002.1 | GCA021406795_01457 | CDS | open | 55990-57009 | _na 339_aa | wecH | Acyltransferase 3 domain-containing protein |
| 328 | JAEMBP010000002.1 | GCA021406795_01458 | CDS | open | 57089-57796 | _na 235_aa | sIR2 | NAD-dependent protein deacylase |
| 329 | JAEMBP010000002.1 | GCA021406795_01459 | CDS | open | 57870-59024 | _na 384_aa | yaeI | Calcineurin-like phosphoesterase domain-containing protein |
| 330 | JAEMBP010000002.1 | GCA021406795_01460 | CDS | open | 59077-60456 | _na 459_aa | norM | Multidrug export protein MepA |
| 331 | JAEMBP010000002.1 | GCA021406795_01463 | CDS | open | 60941-61363 | _na 140_aa | DUF1661 domain-containing protein | |
| 332 | JAEMBP010000002.1 | GCA021406795_01464 | CDS | open | 61383-63962 | _na 859_aa | clpC | ATP-dependent Clp protease%2C ATP-binding subunit ClpC |
| 333 | JAEMBP010000002.1 | GCA021406795_01465 | CDS | open | 64102-67113 | _na 1003_aa | ampC | beta-N-acetylhexosaminidase |
| 334 | JAEMBP010000002.1 | GCA021406795_01466 | CDS | open | 67161-68189 | _na 342_aa | hisC | L-threonine-O-3-phosphate decarboxylase%2C putative |
| 335 | JAEMBP010000002.1 | GCA021406795_01467 | CDS | open | 68199-68969 | _na 256_aa | comB | putative 2-phosphosulfolactate phosphatase |
| 336 | JAEMBP010000002.1 | GCA021406795_01468 | CDS | open | 69514-70863 | _na 449_aa | atoC | Sigma-54 dependent DNA-binding response regulator |
| 337 | JAEMBP010000002.1 | GCA021406795_01469 | CDS | open | 70874-72211 | _na 445_aa | histidine kinase | |
| 338 | JAEMBP010000002.1 | GCA021406795_01470 | CDS | open | 72215-74461 | _na 748_aa | Lipoprotein | |
| 339 | JAEMBP010000002.1 | GCA021406795_01471 | CDS | open | 74546-75250 | _na 234_aa | marR | Transcriptional regulator%2C MarR family |
| 340 | JAEMBP010000002.1 | GCA021406795_01472 | CDS | open | 75236-76237 | _na 333_aa | dusB | tRNA dihydrouridine synthase DusB |
| 341 | JAEMBP010000002.1 | GCA021406795_01473 | CDS | open | 76234-77910 | _na 558_aa | sUL1 | Sulfate permease |
| 342 | JAEMBP010000002.1 | GCA021406795_01474 | CDS | open | 78119-78229 | _na 36_aa | hypothetical protein | |
| 343 | JAEMBP010000002.1 | GCA021406795_01475 | CDS | open | 78207-78989 | _na 260_aa | DUF2971 domain-containing protein | |
| 344 | JAEMBP010000002.1 | GCA021406795_01476 | CDS | open | 79247-79633 | _na 128_aa | DUF2971 domain-containing protein | |
| 345 | JAEMBP010000002.1 | GCA021406795_01477 | CDS | open | 80782-80937 | _na 51_aa | hypothetical protein | |
| 346 | JAEMBP010000002.1 | GCA021406795_01478 | CDS | open | 80957-81613 | _na 218_aa | rex | redox-sensing transcriptional repressor Rex |
| 347 | JAEMBP010000002.1 | GCA021406795_01479 | CDS | open | 81682-82341 | _na 219_aa | ycgM | 2-hydroxyhepta-2%2C4-diene-1%2C7-dioate isomerase |
| 348 | JAEMBP010000002.1 | GCA021406795_01480 | CDS | open | 82354-85830 | _na 1158_aa | porU | Por secretion system protein porU |
| 349 | JAEMBP010000002.1 | GCA021406795_01481 | CDS | open | 85906-87081 | _na 391_aa | porV | type IX secretion system outer membrane channel protein PorV |
| 350 | JAEMBP010000002.1 | GCA021406795_01482 | CDS | open | 87088-87576 | _na 162_aa | ispF | 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase |
| 351 | JAEMBP010000002.1 | GCA021406795_01483 | CDS | open | 87679-88263 | _na 194_aa | spoU | RNA methyltransferase%2C TrmH family |
| 352 | JAEMBP010000002.1 | GCA021406795_01485 | CDS | open | 89070-89546 | _na 158_aa | cdd | cytidine deaminase |
| 353 | JAEMBP010000002.1 | GCA021406795_01413 | gene | open | 201-3425 | |||
| 354 | JAEMBP010000002.1 | GCA021406795_01414 | gene | open | 3422-4282 | alr0228 | ||
| 355 | JAEMBP010000002.1 | GCA021406795_01415 | gene | open | 4327-5253 | pgsA | ||
| 356 | JAEMBP010000002.1 | GCA021406795_01416 | gene | open | 5265-5996 | fabG | ||
| 357 | JAEMBP010000002.1 | GCA021406795_01417 | gene | open | 6002-6460 | tagD | ||
| 358 | JAEMBP010000002.1 | GCA021406795_01418 | gene | open | 6482-7579 | pdxA | ||
| 359 | JAEMBP010000002.1 | GCA021406795_01419 | gene | open | 7623-8678 | |||
| 360 | JAEMBP010000002.1 | GCA021406795_01420 | gene | open | 8769-9782 | rlmN | ||
| 361 | JAEMBP010000002.1 | GCA021406795_01421 | gene | open | 10457-11794 | hisS | ||
| 362 | JAEMBP010000002.1 | GCA021406795_01422 | gene | open | 11882-12370 | folA | ||
| 363 | JAEMBP010000002.1 | GCA021406795_01423 | gene | open | 12416-13210 | thyA | ||
| 364 | JAEMBP010000002.1 | GCA021406795_01424 | gene | open | 13443-14240 | bepA | ||
| 365 | JAEMBP010000002.1 | GCA021406795_01425 | gene | open | 14191-14328 | |||
| 366 | JAEMBP010000002.1 | GCA021406795_01426 | gene | open | 14451-15332 | |||
| 367 | JAEMBP010000002.1 | GCA021406795_01427 | gene | open | 15574-17511 | abc-f | ||
| 368 | JAEMBP010000002.1 | GCA021406795_01428 | gene | open | 17508-19595 | pilF | ||
| 369 | JAEMBP010000002.1 | GCA021406795_01429 | gene | open | 19631-20308 | def | ||
| 370 | JAEMBP010000002.1 | GCA021406795_01430 | gene | open | 20305-20943 | ruvX | ||
| 371 | JAEMBP010000002.1 | GCA021406795_01431 | gene | open | 21223-26946 | yfaS | ||
| 372 | JAEMBP010000002.1 | GCA021406795_01432 | gene | open | 26960-27904 | panE | ||
| 373 | JAEMBP010000002.1 | GCA021406795_01433 | gene | open | 28040-29656 | uup | ||
| 374 | JAEMBP010000002.1 | GCA021406795_01434 | gene | open | 29932-30951 | wcaG | ||
| 375 | JAEMBP010000002.1 | GCA021406795_01435 | gene | open | 31201-31455 | |||
| 376 | JAEMBP010000002.1 | GCA021406795_01436 | gene | open | 31483-34341 | uvrA | ||
| 377 | JAEMBP010000002.1 | GCA021406795_01440 | gene | open | 35380-35562 | nirB | ||
| 378 | JAEMBP010000002.1 | GCA021406795_01441 | gene | open | 35834-37108 | |||
| 379 | JAEMBP010000002.1 | GCA021406795_01442 | gene | open | 37143-38228 | cpsB | ||
| 380 | JAEMBP010000002.1 | GCA021406795_01443 | gene | open | 38332-40032 | cTD-A | ||
| 381 | JAEMBP010000002.1 | GCA021406795_01444 | gene | open | 40208-42109 | dxs | ||
| 382 | JAEMBP010000002.1 | GCA021406795_01445 | gene | open | 42162-43502 | trkA | ||
| 383 | JAEMBP010000002.1 | GCA021406795_01446 | gene | open | 43529-44992 | trkH | ||
| 384 | JAEMBP010000002.1 | GCA021406795_01448 | gene | open | 46013-47404 | mtaB | ||
| 385 | JAEMBP010000002.1 | GCA021406795_01449 | gene | open | 47401-48318 | lpxP | ||
| 386 | JAEMBP010000002.1 | GCA021406795_01450 | gene | open | 48315-49325 | wcaE | ||
| 387 | JAEMBP010000002.1 | GCA021406795_01451 | gene | open | 49468-50064 | terC | ||
| 388 | JAEMBP010000002.1 | GCA021406795_01452 | gene | open | 50057-50353 | marR | ||
| 389 | JAEMBP010000002.1 | GCA021406795_01453 | gene | open | 50433-52655 | fepA | ||
| 390 | JAEMBP010000002.1 | GCA021406795_01454 | gene | open | 52652-53308 | |||
| 391 | JAEMBP010000002.1 | GCA021406795_01455 | gene | open | 53982-55403 | dnaA | ||
| 392 | JAEMBP010000002.1 | GCA021406795_01456 | gene | open | 55416-55988 | wbbJ | ||
| 393 | JAEMBP010000002.1 | GCA021406795_01457 | gene | open | 55990-57009 | wecH | ||
| 394 | JAEMBP010000002.1 | GCA021406795_01458 | gene | open | 57089-57796 | sIR2 | ||
| 395 | JAEMBP010000002.1 | GCA021406795_01459 | gene | open | 57870-59024 | yaeI | ||
| 396 | JAEMBP010000002.1 | GCA021406795_01460 | gene | open | 59077-60456 | norM | ||
| 397 | JAEMBP010000002.1 | GCA021406795_01463 | gene | open | 60941-61363 | |||
| 398 | JAEMBP010000002.1 | GCA021406795_01464 | gene | open | 61383-63962 | clpC | ||
| 399 | JAEMBP010000002.1 | GCA021406795_01465 | gene | open | 64102-67113 | ampC | ||
| 400 | JAEMBP010000002.1 | GCA021406795_01466 | gene | open | 67161-68189 | hisC | ||
| 401 | JAEMBP010000002.1 | GCA021406795_01467 | gene | open | 68199-68969 | comB | ||
| 402 | JAEMBP010000002.1 | GCA021406795_01468 | gene | open | 69514-70863 | atoC | ||
| 403 | JAEMBP010000002.1 | GCA021406795_01469 | gene | open | 70874-72211 | |||
| 404 | JAEMBP010000002.1 | GCA021406795_01470 | gene | open | 72215-74461 | |||
| 405 | JAEMBP010000002.1 | GCA021406795_01471 | gene | open | 74546-75250 | marR | ||
| 406 | JAEMBP010000002.1 | GCA021406795_01472 | gene | open | 75236-76237 | dusB | ||
| 407 | JAEMBP010000002.1 | GCA021406795_01473 | gene | open | 76234-77910 | sUL1 | ||
| 408 | JAEMBP010000002.1 | GCA021406795_01474 | gene | open | 78119-78229 | |||
| 409 | JAEMBP010000002.1 | GCA021406795_01475 | gene | open | 78207-78989 | |||
| 410 | JAEMBP010000002.1 | GCA021406795_01476 | gene | open | 79247-79633 | |||
| 411 | JAEMBP010000002.1 | GCA021406795_01477 | gene | open | 80782-80937 | |||
| 412 | JAEMBP010000002.1 | GCA021406795_01478 | gene | open | 80957-81613 | rex | ||
| 413 | JAEMBP010000002.1 | GCA021406795_01479 | gene | open | 81682-82341 | ycgM | ||
| 414 | JAEMBP010000002.1 | GCA021406795_01480 | gene | open | 82354-85830 | porU | ||
| 415 | JAEMBP010000002.1 | GCA021406795_01481 | gene | open | 85906-87081 | porV | ||
| 416 | JAEMBP010000002.1 | GCA021406795_01482 | gene | open | 87088-87576 | ispF | ||
| 417 | JAEMBP010000002.1 | GCA021406795_01483 | gene | open | 87679-88263 | spoU | ||
| 418 | JAEMBP010000002.1 | GCA021406795_01485 | gene | open | 89070-89546 | cdd | ||
| 419 | JAEMBP010000002.1 | GCA021406795_01437 | gene | open | 34465-34548 | trnL | ||
| 420 | JAEMBP010000002.1 | GCA021406795_01438 | gene | open | 34582-34664 | trnL | ||
| 421 | JAEMBP010000002.1 | GCA021406795_01439 | gene | open | 34752-34827 | trnG | ||
| 422 | JAEMBP010000002.1 | GCA021406795_01447 | gene | open | 45184-45254 | trnC | ||
| 423 | JAEMBP010000002.1 | GCA021406795_01461 | gene | open | 60587-60660 | trnN | ||
| 424 | JAEMBP010000002.1 | GCA021406795_01462 | gene | open | 60683-60756 | trnN | ||
| 425 | JAEMBP010000002.1 | GCA021406795_01484 | gene | open | 88733-88803 | trnQ | ||
| 426 | JAEMBP010000002.1 | GCA021406795_01437 | tRNA | open | 34465-34548 | trnL | tRNA-Leu(gag) | |
| 427 | JAEMBP010000002.1 | GCA021406795_01438 | tRNA | open | 34582-34664 | trnL | tRNA-Leu(cag) | |
| 428 | JAEMBP010000002.1 | GCA021406795_01439 | tRNA | open | 34752-34827 | trnG | tRNA-Gly(gcc) | |
| 429 | JAEMBP010000002.1 | GCA021406795_01447 | tRNA | open | 45184-45254 | trnC | tRNA-Cys(gca) | |
| 430 | JAEMBP010000002.1 | GCA021406795_01461 | tRNA | open | 60587-60660 | trnN | tRNA-Asn(gtt) | |
| 431 | JAEMBP010000002.1 | GCA021406795_01462 | tRNA | open | 60683-60756 | trnN | tRNA-Asn(gtt) | |
| 432 | JAEMBP010000002.1 | GCA021406795_01484 | tRNA | open | 88733-88803 | trnQ | tRNA-Gln(ttg) | |
| 433 | JAEMBP010000003.1 | GCA021406795_01095 | CDS | open | 135-308 | _na 57_aa | hypothetical protein | |
| 434 | JAEMBP010000003.1 | GCA021406795_01096 | CDS | open | 1193-2713 | _na 506_aa | dacB | D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase |
| 435 | JAEMBP010000003.1 | GCA021406795_01097 | CDS | open | 2936-4606 | _na 556_aa | cTD-A | peptidylarginine deiminase PPAD |
| 436 | JAEMBP010000003.1 | GCA021406795_01098 | CDS | open | 5754-8285 | _na 843_aa | cTD-A | Thiol protease/hemagglutinin PrtT%2C putative |
| 437 | JAEMBP010000003.1 | GCA021406795_01099 | CDS | open | 8425-8910 | _na 161_aa | ribH | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 438 | JAEMBP010000003.1 | GCA021406795_01100 | CDS | open | 9002-9688 | _na 228_aa | cpoB | TPR domain protein |
| 439 | JAEMBP010000003.1 | GCA021406795_01101 | CDS | open | 9874-10557 | _na 227_aa | citB | FimR protein |
| 440 | JAEMBP010000003.1 | GCA021406795_01102 | CDS | open | 10570-12486 | _na 638_aa | pilF | histidine kinase |
| 441 | JAEMBP010000003.1 | GCA021406795_01103 | CDS | open | 12768-12962 | _na 64_aa | xseB | exodeoxyribonuclease VII small subunit |
| 442 | JAEMBP010000003.1 | GCA021406795_01104 | CDS | open | 12959-13627 | _na 222_aa | ispD | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase |
| 443 | JAEMBP010000003.1 | GCA021406795_01106 | CDS | open | 15052-15879 | _na 275_aa | ftsX | Cell division protein FtsX |
| 444 | JAEMBP010000003.1 | GCA021406795_01107 | CDS | open | 15926-16153 | _na 75_aa | DUF3098 domain-containing protein | |
| 445 | JAEMBP010000003.1 | GCA021406795_01108 | CDS | open | 16261-17103 | _na 280_aa | uppP | undecaprenyl-diphosphate phosphatase |
| 446 | JAEMBP010000003.1 | GCA021406795_01109 | CDS | open | 17113-17889 | _na 258_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 447 | JAEMBP010000003.1 | GCA021406795_01110 | CDS | open | 17907-18959 | _na 350_aa | queA | tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA |
| 448 | JAEMBP010000003.1 | GCA021406795_01111 | CDS | open | 18962-19405 | _na 147_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 449 | JAEMBP010000003.1 | GCA021406795_01112 | CDS | open | 19418-20662 | _na 414_aa | prtC | Collagenase |
| 450 | JAEMBP010000003.1 | GCA021406795_01113 | CDS | open | 20718-21137 | _na 139_aa | fadM | Thioesterase family protein |
| 451 | JAEMBP010000003.1 | GCA021406795_01114 | CDS | open | 21222-21992 | _na 256_aa | yaaA | peroxide stress protein YaaA |
| 452 | JAEMBP010000003.1 | GCA021406795_01115 | CDS | open | 22129-22704 | _na 191_aa | sodB | Superoxide dismutase [Mn/Fe] |
| 453 | JAEMBP010000003.1 | GCA021406795_01116 | CDS | open | 22893-23246 | _na 117_aa | hypothetical protein | |
| 454 | JAEMBP010000003.1 | GCA021406795_01118 | CDS | open | 23472-25994 | _na 840_aa | prtT | Thiol protease/hemagglutinin PrtT |
| 455 | JAEMBP010000003.1 | GCA021406795_01119 | CDS | open | 26385-26525 | _na 46_aa | hypothetical protein | |
| 456 | JAEMBP010000003.1 | GCA021406795_01120 | CDS | open | 26684-26815 | _na 43_aa | hypothetical protein | |
| 457 | JAEMBP010000003.1 | GCA021406795_01121 | CDS | open | 26844-27494 | _na 216_aa | hmuY | HmuY protein |
| 458 | JAEMBP010000003.1 | GCA021406795_01122 | CDS | open | 27509-29449 | _na 646_aa | hmuR | TonB-dependent receptor HmuR |
| 459 | JAEMBP010000003.1 | GCA021406795_01123 | CDS | open | 29486-33895 | _na 1469_aa | cobN | Putative cobalamin biosynthesis-related protein |
| 460 | JAEMBP010000003.1 | GCA021406795_01124 | CDS | open | 33892-34569 | _na 225_aa | hypothetical protein | |
| 461 | JAEMBP010000003.1 | GCA021406795_01125 | CDS | open | 34639-35217 | _na 192_aa | tolQ | MotA/TolQ/ExbB proton channel domain-containing protein |
| 462 | JAEMBP010000003.1 | GCA021406795_01126 | CDS | open | 35223-35549 | _na 108_aa | DUF2149 domain-containing protein | |
| 463 | JAEMBP010000003.1 | GCA021406795_01127 | CDS | open | 36252-37340 | _na 362_aa | gcvT | glycine cleavage system aminomethyltransferase GcvT |
| 464 | JAEMBP010000003.1 | GCA021406795_01128 | CDS | open | 37415-38479 | _na 354_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 465 | JAEMBP010000003.1 | GCA021406795_01129 | CDS | open | 38486-39343 | _na 285_aa | rfbD | dTDP-4-dehydrorhamnose reductase |
| 466 | JAEMBP010000003.1 | GCA021406795_01130 | CDS | open | 39340-39930 | _na 196_aa | rfbC | dTDP-4-dehydrorhamnose 3%2C5-epimerase |
| 467 | JAEMBP010000003.1 | GCA021406795_01131 | CDS | open | 39945-40814 | _na 289_aa | rfbA | glucose-1-phosphate thymidylyltransferase RfbA |
| 468 | JAEMBP010000003.1 | GCA021406795_01132 | CDS | open | 40929-42884 | _na 651_aa | mdoB | Sulfatase-like hydrolase/transferase |
| 469 | JAEMBP010000003.1 | GCA021406795_01133 | CDS | open | 42969-44207 | _na 412_aa | kdtA | 3-deoxy-D-manno-octulosonic acid transferase |
| 470 | JAEMBP010000003.1 | GCA021406795_01134 | CDS | open | 44232-45947 | _na 571_aa | gltX | glutamate--tRNA ligase |
| 471 | JAEMBP010000003.1 | GCA021406795_01135 | CDS | open | 46089-46337 | _na 82_aa | H repeat-associated protein N-terminal domain-containing protein | |
| 472 | JAEMBP010000003.1 | GCA021406795_01136 | CDS | open | 46906-47289 | _na 127_aa | pspE | Rhodanese domain-containing protein |
| 473 | JAEMBP010000003.1 | GCA021406795_01137 | CDS | open | 47262-48677 | _na 471_aa | pspE | Metallo-beta-lactamase superfamily protein |
| 474 | JAEMBP010000003.1 | GCA021406795_01138 | CDS | open | 48770-49576 | _na 268_aa | tauE | putative membrane transporter protein |
| 475 | JAEMBP010000003.1 | GCA021406795_01139 | CDS | open | 49641-50264 | _na 207_aa | crp | Transcriptional regulator%2C Crp family |
| 476 | JAEMBP010000003.1 | GCA021406795_01140 | CDS | open | 51409-52965 | _na 518_aa | nadB | L-aspartate oxidase |
| 477 | JAEMBP010000003.1 | GCA021406795_01141 | CDS | open | 52997-53839 | _na 280_aa | nadC | carboxylating nicotinate-nucleotide diphosphorylase |
| 478 | JAEMBP010000003.1 | GCA021406795_01142 | CDS | open | 53859-54785 | _na 308_aa | nadA | quinolinate synthase NadA |
| 479 | JAEMBP010000003.1 | GCA021406795_01143 | CDS | open | 54884-55879 | _na 331_aa | mMP0363 | ATPase%2C MoxR family |
| 480 | JAEMBP010000003.1 | GCA021406795_01144 | CDS | open | 56001-56762 | _na 253_aa | mMP0362 | DUF58 domain-containing protein |
| 481 | JAEMBP010000003.1 | GCA021406795_01145 | CDS | open | 56759-57715 | _na 318_aa | batD | Protein BatD |
| 482 | JAEMBP010000003.1 | GCA021406795_01146 | CDS | open | 57712-58695 | _na 327_aa | batA | BatA protein |
| 483 | JAEMBP010000003.1 | GCA021406795_01147 | CDS | open | 58706-59725 | _na 339_aa | batB | Putative aerotolerance-related exported protein BatB |
| 484 | JAEMBP010000003.1 | GCA021406795_01148 | CDS | open | 59722-60465 | _na 247_aa | batC | putative aerotolerance-related exported protein BatC |
| 485 | JAEMBP010000003.1 | GCA021406795_01149 | CDS | open | 60646-62448 | _na 600_aa | batD | Aerotolerance regulator BatD |
| 486 | JAEMBP010000003.1 | GCA021406795_01150 | CDS | open | 62445-63353 | _na 302_aa | batE | BatE protein |
| 487 | JAEMBP010000003.1 | GCA021406795_01151 | CDS | open | 63374-64090 | _na 238_aa | lpxF | Lipid A 4'-phosphatase |
| 488 | JAEMBP010000003.1 | GCA021406795_01152 | CDS | open | 64106-64873 | _na 255_aa | cdaA | diadenylate cyclase CdaA |
| 489 | JAEMBP010000003.1 | GCA021406795_01153 | CDS | open | 64933-65778 | _na 281_aa | folP | dihydropteroate synthase |
| 490 | JAEMBP010000003.1 | GCA021406795_01155 | CDS | open | 66575-68659 | _na 694_aa | pgpH | HD domain-containing protein |
| 491 | JAEMBP010000003.1 | GCA021406795_01156 | CDS | open | 68707-69267 | _na 186_aa | aroK | shikimate kinase |
| 492 | JAEMBP010000003.1 | GCA021406795_01157 | CDS | open | 69206-70741 | _na 511_aa | comEC | ComEC/Rec2-related protein |
| 493 | JAEMBP010000003.1 | GCA021406795_01158 | CDS | open | 70748-71404 | _na 218_aa | rpe | ribulose-phosphate 3-epimerase |
| 494 | JAEMBP010000003.1 | GCA021406795_01159 | CDS | open | 71548-71655 | _na 35_aa | hypothetical protein | |
| 495 | JAEMBP010000003.1 | GCA021406795_01160 | CDS | open | 71746-75159 | _na 1137_aa | ileS | isoleucine--tRNA ligase |
| 496 | JAEMBP010000003.1 | GCA021406795_01161 | CDS | open | 75229-75609 | _na 126_aa | dksA | DnaK suppressor protein%2C putative |
| 497 | JAEMBP010000003.1 | GCA021406795_01162 | CDS | open | 75613-76293 | _na 226_aa | lspA | lipoprotein signal peptidase |
| 498 | JAEMBP010000003.1 | GCA021406795_01163 | CDS | open | 76290-77078 | _na 262_aa | DUF4296 domain-containing protein | |
| 499 | JAEMBP010000003.1 | GCA021406795_01164 | CDS | open | 77112-78137 | _na 341_aa | Acyltransferase 3 domain-containing protein | |
| 500 | JAEMBP010000003.1 | GCA021406795_01165 | CDS | open | 78172-78945 | _na 257_aa | birA2 | Biotin--[acetyl-CoA-carboxylase] ligase |

