HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Aquamicrobium lusatiense (GCA_022359935.1)

Select a Genome:
BAKTA Annotations for GCA_022359935.1
Genome Selected: Aquamicrobium lusatiense
ContigsBases CDSrRNA tmRNAtRNA
12 5,201,486 4934 6 1 49
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 10050 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 10050 [21 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
1 JAKSED010000001.1 GCA022359935_00993 gene open 1000392-1000729 ssrA
2 JAKSED010000001.1 GCA022359935_00993 tmRNA open 1000392-1000729 ssrA transfer-messenger RNA%2C SsrA
3 JAKSED010000001.1 GCA022359935_00514 gene open 504952-505069 ar14
4 JAKSED010000001.1 GCA022359935_00515 gene open 505095-505214 ar14
5 JAKSED010000001.1 GCA022359935_00725 gene open 722189-722299 Atu_C6
6 JAKSED010000001.1 GCA022359935_00904 gene open 913997-914144 ar9
7 JAKSED010000001.1 GCA022359935_00974 gene open 984047-984165 Atu_C8
8 JAKSED010000001.1 GCA022359935_01047 gene open 1061909-1062306 RNaseP_bact_a
9 JAKSED010000001.1 GCA022359935_01192 gene open 1217301-1217413 ar15
10 JAKSED010000001.1 GCA022359935_01431 gene open 1450254-1450402 ar45
11 JAKSED010000001.1 GCA022359935_01546 gene open 1566478-1566621 ar7
12 JAKSED010000001.1 GCA022359935_01582 gene open 1602142-1602256 rrf
13 JAKSED010000001.1 GCA022359935_01583 gene open 1602435-1605240 rrl
14 JAKSED010000001.1 GCA022359935_01586 gene open 1606029-1607515 rrs
15 JAKSED010000001.1 GCA022359935_01588 gene open 1608009-1608123 rrf
16 JAKSED010000001.1 GCA022359935_01589 gene open 1608302-1611107 rrl
17 JAKSED010000001.1 GCA022359935_01592 gene open 1611896-1613382 rrs
18 JAKSED010000001.1 GCA022359935_02042 gene open 2044970-2045111 BjrC1505
19 JAKSED010000001.1 GCA022359935_02065 gene open 2064167-2064323 6S
20 JAKSED010000001.1 GCA022359935_02136 gene open 2134334-2134457 ar14
21 JAKSED010000001.1 GCA022359935_02304 gene open 2310818-2310953 ar35
22 JAKSED010000001.1 GCA022359935_02398 gene open 2416866-2416917 ffh
23 JAKSED010000001.1 GCA022359935_02555 gene open 2589454-2589560 Atu_At1
24 JAKSED010000001.1 GCA022359935_02560 gene open 2591551-2591683 ar35
25 JAKSED010000001.1 GCA022359935_02668 gene open 2702502-2702598 Bacteria_small_SRP
26 JAKSED010000001.1 GCA022359935_02705 gene open 2737258-2737353 ar15
27 JAKSED010000001.1 GCA022359935_00514 ncRNA open 504952-505069 Alphaproteobacterial ar14
28 JAKSED010000001.1 GCA022359935_00515 ncRNA open 505095-505214 Alphaproteobacterial ar14
29 JAKSED010000001.1 GCA022359935_00725 ncRNA open 722189-722299 EcpR1
30 JAKSED010000001.1 GCA022359935_00904 ncRNA open 913997-914144 Alphaproteobacterial sRNA ar9
31 JAKSED010000001.1 GCA022359935_00974 ncRNA open 984047-984165 Rhizobiales sRNA Atu_C8
32 JAKSED010000001.1 GCA022359935_01047 ncRNA open 1061909-1062306 Bacterial RNase P class A
33 JAKSED010000001.1 GCA022359935_01192 ncRNA open 1217301-1217413 Alphaproteobacterial ar15
34 JAKSED010000001.1 GCA022359935_01431 ncRNA open 1450254-1450402 Alphaproteobacterial sRNA ar45
35 JAKSED010000001.1 GCA022359935_01546 ncRNA open 1566478-1566621 Alphaproteobacterial sRNA ar7
36 JAKSED010000001.1 GCA022359935_02042 ncRNA open 2044970-2045111 Alphaproteobacterial sRNA BjrC1505
37 JAKSED010000001.1 GCA022359935_02065 ncRNA open 2064167-2064323 6S / SsrS RNA
38 JAKSED010000001.1 GCA022359935_02136 ncRNA open 2134334-2134457 Alphaproteobacterial ar14
39 JAKSED010000001.1 GCA022359935_02304 ncRNA open 2310818-2310953 Alphaproteobacterial sRNA ar35
40 JAKSED010000001.1 GCA022359935_02398 ncRNA open 2416866-2416917 ffh sRNA
41 JAKSED010000001.1 GCA022359935_02555 ncRNA open 2589454-2589560 Rhizobiales sRNA Atu_At1
42 JAKSED010000001.1 GCA022359935_02560 ncRNA open 2591551-2591683 Alphaproteobacterial sRNA ar35
43 JAKSED010000001.1 GCA022359935_02668 ncRNA open 2702502-2702598 Bacterial small signal recognition particle RNA
44 JAKSED010000001.1 GCA022359935_02705 ncRNA open 2737258-2737353 Alphaproteobacterial ar15
45 JAKSED010000001.1 regulatory_region open 37107-37238 AdoCbl (Cobalamin/B12) riboswitch aptamer
46 JAKSED010000001.1 regulatory_region open 225768-225806 THF-II riboswitch (folE RNA)
47 JAKSED010000001.1 regulatory_region open 232212-232379 FMN riboswitch aptamer (RFN element)
48 JAKSED010000001.1 regulatory_region open 245612-245699 Glycine riboswitch aptamer
49 JAKSED010000001.1 regulatory_region open 839172-839233 Fluoride riboswitch aptamer (crcB RNA motif)
50 JAKSED010000001.1 regulatory_region open 942302-942503 Cobalamin riboswitch aptamer
51 JAKSED010000001.1 regulatory_region open 1204908-1204955 Guanidine-II riboswitch aptamer (mini-ykkC)
52 JAKSED010000001.1 regulatory_region open 1205754-1205802 Guanidine-II riboswitch aptamer (mini-ykkC)
53 JAKSED010000001.1 regulatory_region open 1450411-1450556 speF leader
54 JAKSED010000001.1 regulatory_region open 1559659-1559873 Cobalamin riboswitch aptamer
55 JAKSED010000001.1 regulatory_region open 1600548-1600663 TPP riboswitch aptamer (THI element)
56 JAKSED010000001.1 regulatory_region open 1827877-1827931 terC RNA
57 JAKSED010000001.1 regulatory_region open 1861162-1861359 Cobalamin riboswitch aptamer
58 JAKSED010000001.1 regulatory_region open 1884402-1884464 ybhL leader
59 JAKSED010000001.1 regulatory_region open 2015921-2016036 TPP riboswitch aptamer (THI element)
60 JAKSED010000001.1 regulatory_region open 2027626-2027678 serC leader
61 JAKSED010000001.1 regulatory_region open 2076242-2076320 Alpha-proteobacteria SAM riboswitch aptamer
62 JAKSED010000001.1 regulatory_region open 2449576-2449675 Pyrrolysine insertion sequence mttB
63 JAKSED010000001.1 regulatory_region open 2650031-2650108 Alpha-proteobacteria SAM riboswitch aptamer
64 JAKSED010000001.1 regulatory_region open 2910919-2911004 Repression of heat shock gene expression (ROSE) element
65 JAKSED010000001.1 regulatory_region open 3071260-3071362 TPP riboswitch aptamer (THI element)
66 JAKSED010000001.1 regulatory_region open 3075816-3076026 Cobalamin riboswitch aptamer
67 JAKSED010000001.1 regulatory_region open 3085522-3085740 Cobalamin riboswitch aptamer
68 JAKSED010000001.1 GCA022359935_01582 rRNA open 1602142-1602256 rrf 5S ribosomal RNA
69 JAKSED010000001.1 GCA022359935_01583 rRNA open 1602435-1605240 rrl 23S ribosomal RNA
70 JAKSED010000001.1 GCA022359935_01586 rRNA open 1606029-1607515 rrs 16S ribosomal RNA
71 JAKSED010000001.1 GCA022359935_01588 rRNA open 1608009-1608123 rrf 5S ribosomal RNA
72 JAKSED010000001.1 GCA022359935_01589 rRNA open 1608302-1611107 rrl 23S ribosomal RNA
73 JAKSED010000001.1 GCA022359935_01592 rRNA open 1611896-1613382 rrs 16S ribosomal RNA
74 JAKSED010000001.1 repeat_region open 41402-43499 CRISPR array with 32 repeats of length 32%2C consensus sequence GTTTCGATCCACGCTCCCGCGAAGGGAGCGAC and spacer length 34
75 JAKSED010000001.1 GCA022359935_00001 CDS open 311-568 _na     85_aa Secreted protein
76 JAKSED010000001.1 GCA022359935_00002 CDS open 655-1320 _na     221_aa ompR Transcriptional regulator
77 JAKSED010000001.1 GCA022359935_00003 CDS open 1386-2762 _na     458_aa histidine kinase
78 JAKSED010000001.1 GCA022359935_00004 CDS open 2856-3275 _na     139_aa Surface antigen
79 JAKSED010000001.1 GCA022359935_00005 CDS open 3373-3687 _na     104_aa ccmI c-type cytochrome biogenesis protein CcmI
80 JAKSED010000001.1 GCA022359935_00006 CDS open 3669-4487 _na     272_aa ccmI c-type cytochrome biogenesis protein CcmI
81 JAKSED010000001.1 GCA022359935_00007 CDS open 4493-4930 _na     145_aa ccmE cytochrome c maturation protein CcmE
82 JAKSED010000001.1 GCA022359935_00008 CDS open 4939-6927 _na     662_aa cycK Cytochrome c-type biogenesis protein CycK
83 JAKSED010000001.1 GCA022359935_00009 CDS open 6929-7405 _na     158_aa Cytochrome c-type biogenesis protein
84 JAKSED010000001.1 GCA022359935_00010 CDS open 7506-9038 _na     510_aa putative periplasmic serine endoprotease DegP-like
85 JAKSED010000001.1 GCA022359935_00011 CDS open 9118-9411 _na     97_aa hypothetical protein
86 JAKSED010000001.1 GCA022359935_00012 CDS open 9631-9819 _na     62_aa copR Transcriptional activator protein CopR
87 JAKSED010000001.1 GCA022359935_00013 CDS open 10584-11264 _na     226_aa HAMP domain-containing sensor histidine kinase
88 JAKSED010000001.1 GCA022359935_00014 CDS open 11271-14234 _na     987_aa bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase
89 JAKSED010000001.1 GCA022359935_00015 CDS open 14235-16544 _na     769_aa histidine kinase
90 JAKSED010000001.1 GCA022359935_00016 CDS open 16679-19312 _na     877_aa pepN aminopeptidase N
91 JAKSED010000001.1 GCA022359935_00017 CDS open 19471-20418 _na     315_aa Drug/metabolite transporter (DMT)-like permease
92 JAKSED010000001.1 GCA022359935_00018 CDS open 20448-21308 _na     286_aa Type-4 uracil-DNA glycosylase
93 JAKSED010000001.1 GCA022359935_00019 CDS open 21345-21992 _na     215_aa DUF4352 domain-containing protein
94 JAKSED010000001.1 GCA022359935_00020 CDS open 22286-23965 _na     559_aa Electron transfer flavoprotein-ubiquinone oxidoreductase
95 JAKSED010000001.1 GCA022359935_00021 CDS open 24033-25040 _na     335_aa yafD Endonuclease/exonuclease/phosphatase (EEP) superfamily protein YafD
96 JAKSED010000001.1 GCA022359935_00022 CDS open 25169-25741 _na     190_aa Putative secreted Zn-dependent protease
97 JAKSED010000001.1 GCA022359935_00023 CDS open 25818-27317 _na     499_aa AMP nucleosidase
98 JAKSED010000001.1 GCA022359935_00024 CDS open 27381-27575 _na     64_aa fliP Flagellar biosynthetic protein FliP
99 JAKSED010000001.1 GCA022359935_00025 CDS open 27598-27753 _na     51_aa yeiB Putative membrane protein YeiB
100 JAKSED010000001.1 GCA022359935_00026 CDS open 27931-28653 _na     240_aa GST-like protein
101 JAKSED010000001.1 GCA022359935_00027 CDS open 28735-29076 _na     113_aa Glycerol-3-phosphate ABC transporter ATP-binding protein
102 JAKSED010000001.1 GCA022359935_00028 CDS open 29479-29745 _na     88_aa Sel1 repeat family protein
103 JAKSED010000001.1 GCA022359935_00029 CDS open 30053-32011 _na     652_aa 3-methylcrotonyl-CoA carboxylase alpha subunit
104 JAKSED010000001.1 GCA022359935_00030 CDS open 32020-33627 _na     535_aa 3-methylcrotonyl-CoA carboxylase beta subunit
105 JAKSED010000001.1 GCA022359935_00031 CDS open 33629-34792 _na     387_aa Isovaleryl-CoA dehydrogenase%2C mitochondrial
106 JAKSED010000001.1 GCA022359935_00032 CDS open 34761-35402 _na     213_aa acrR AcrR family transcriptional regulator
107 JAKSED010000001.1 GCA022359935_00033 CDS open 35498-36130 _na     210_aa Transmembrane protein
108 JAKSED010000001.1 GCA022359935_00034 CDS open 36134-36868 _na     244_aa cbtA Cobalt transporter CbtA
109 JAKSED010000001.1 GCA022359935_00035 CDS open 36881-37090 _na     69_aa Cobalt transporter
110 JAKSED010000001.1 GCA022359935_00036 CDS open 37289-37840 _na     183_aa phoE Broad specificity phosphatase PhoE
111 JAKSED010000001.1 GCA022359935_00037 CDS open 37850-39052 _na     400_aa pyridoxal phosphate-dependent aminotransferase
112 JAKSED010000001.1 GCA022359935_00038 CDS open 39383-39763 _na     126_aa Catechol 2%2C3-dioxygenase-like lactoylglutathione lyase family enzyme
113 JAKSED010000001.1 GCA022359935_00040 CDS open 40271-41155 _na     294_aa purU formyltetrahydrofolate deformylase
114 JAKSED010000001.1 GCA022359935_00041 CDS open 43688-43978 _na     96_aa cas2 CRISPR-associated endonuclease Cas2
115 JAKSED010000001.1 GCA022359935_00042 CDS open 43980-45014 _na     344_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
116 JAKSED010000001.1 GCA022359935_00043 CDS open 45011-45661 _na     216_aa cas4 CRISPR-associated protein Cas4
117 JAKSED010000001.1 GCA022359935_00044 CDS open 45664-46617 _na     317_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
118 JAKSED010000001.1 GCA022359935_00045 CDS open 46614-48377 _na     587_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
119 JAKSED010000001.1 GCA022359935_00046 CDS open 48374-49075 _na     233_aa cas5c type I-C CRISPR-associated protein Cas5c
120 JAKSED010000001.1 GCA022359935_00047 CDS open 49209-51437 _na     742_aa CRISPR-associated helicase Cas3'
121 JAKSED010000001.1 GCA022359935_00048 CDS open 51497-52522 _na     341_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
122 JAKSED010000001.1 GCA022359935_00049 CDS open 52548-53027 _na     159_aa smpB SsrA-binding protein SmpB
123 JAKSED010000001.1 GCA022359935_00050 CDS open 53077-53727 _na     216_aa Type-5 uracil-DNA glycosylase
124 JAKSED010000001.1 GCA022359935_00051 CDS open 53739-54320 _na     193_aa putative LabA/DUF88 family protein
125 JAKSED010000001.1 GCA022359935_00052 CDS open 54594-54986 _na     130_aa rpoZ DNA-directed RNA polymerase subunit omega
126 JAKSED010000001.1 GCA022359935_00053 CDS open 55096-57321 _na     741_aa GTP pyrophosphokinase rsh
127 JAKSED010000001.1 GCA022359935_00054 CDS open 57361-57939 _na     192_aa pyrE orotate phosphoribosyltransferase
128 JAKSED010000001.1 GCA022359935_00055 CDS open 57946-58383 _na     145_aa holo-ACP synthase
129 JAKSED010000001.1 GCA022359935_00056 CDS open 58484-59233 _na     249_aa lepB signal peptidase I
130 JAKSED010000001.1 GCA022359935_00057 CDS open 59238-59963 _na     241_aa rnc ribonuclease III
131 JAKSED010000001.1 GCA022359935_00058 CDS open 59960-60874 _na     304_aa era GTPase Era
132 JAKSED010000001.1 GCA022359935_00059 CDS open 60921-61682 _na     253_aa recO DNA repair protein RecO
133 JAKSED010000001.1 GCA022359935_00060 CDS open 61736-64435 _na     899_aa Putative membrane protein
134 JAKSED010000001.1 GCA022359935_00061 CDS open 64440-65099 _na     219_aa Glutathione S-transferase
135 JAKSED010000001.1 GCA022359935_00062 CDS open 65076-65711 _na     211_aa Hydrolase
136 JAKSED010000001.1 GCA022359935_00063 CDS open 65711-66580 _na     289_aa Aminomethyltransferase folate-binding domain-containing protein
137 JAKSED010000001.1 GCA022359935_00064 CDS open 66703-67503 _na     266_aa Fibronectin attachment protein
138 JAKSED010000001.1 GCA022359935_00065 CDS open 67643-67900 _na     85_aa hypothetical protein
139 JAKSED010000001.1 GCA022359935_00066 CDS open 68039-68416 _na     125_aa putative protein (TIGR02301 family)
140 JAKSED010000001.1 GCA022359935_00067 CDS open 68413-68862 _na     149_aa yjhB ADP-ribose pyrophosphatase YjhB (NUDIX family)
141 JAKSED010000001.1 GCA022359935_00068 CDS open 68993-69787 _na     264_aa Abasic site processing protein
142 JAKSED010000001.1 GCA022359935_00069 CDS open 69878-70030 _na     50_aa Transcriptional regulator
143 JAKSED010000001.1 GCA022359935_00070 CDS open 70413-71849 _na     478_aa cysS cysteine--tRNA ligase
144 JAKSED010000001.1 GCA022359935_00071 CDS open 71846-72229 _na     127_aa Catechol 2%2C3-dioxygenase-like lactoylglutathione lyase family enzyme
145 JAKSED010000001.1 GCA022359935_00072 CDS open 72236-72730 _na     164_aa CENP-V/GFA domain-containing protein
146 JAKSED010000001.1 GCA022359935_00073 CDS open 72727-73686 _na     319_aa pip prolyl aminopeptidase
147 JAKSED010000001.1 GCA022359935_00074 CDS open 73750-75363 _na     537_aa cimA citramalate synthase
148 JAKSED010000001.1 GCA022359935_00075 CDS open 75428-76390 _na     320_aa rarD EamA family transporter RarD
149 JAKSED010000001.1 GCA022359935_00076 CDS open 76374-76985 _na     203_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
150 JAKSED010000001.1 GCA022359935_00077 CDS open 77179-78555 _na     458_aa ygaU Nucleoid-associated protein YgaU
151 JAKSED010000001.1 GCA022359935_00078 CDS open 78613-78975 _na     120_aa arsR DNA-binding transcriptional ArsR family regulator
152 JAKSED010000001.1 GCA022359935_00079 CDS open 79032-80918 _na     628_aa ATP-binding cassette subfamily B protein
153 JAKSED010000001.1 GCA022359935_00080 CDS open 81019-81717 _na     232_aa phosphatidylserine decarboxylase
154 JAKSED010000001.1 GCA022359935_00081 CDS open 81727-82551 _na     274_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
155 JAKSED010000001.1 GCA022359935_00082 CDS open 82772-85000 _na     742_aa Acyl-[acyl-carrier-protein]-phospholipid O-acyltransferase/long-chain-fatty-acid--[acyl-carrier-protein] ligase
156 JAKSED010000001.1 GCA022359935_00083 CDS open 85279-86034 _na     251_aa NAD(P)-dependent dehydrogenase (Short-subunit alcohol dehydrogenase family)
157 JAKSED010000001.1 GCA022359935_00084 CDS open 86063-87547 _na     494_aa purF amidophosphoribosyltransferase
158 JAKSED010000001.1 GCA022359935_00085 CDS open 87639-88262 _na     207_aa Membrane protein required for colicin V production
159 JAKSED010000001.1 GCA022359935_00086 CDS open 88290-89708 _na     472_aa radA DNA repair protein RadA
160 JAKSED010000001.1 GCA022359935_00087 CDS open 89774-91264 _na     496_aa replicative DNA helicase
161 JAKSED010000001.1 GCA022359935_00088 CDS open 91482-92453 _na     323_aa Ribosomal protein RSM22 (putative rRNA methylase)
162 JAKSED010000001.1 GCA022359935_00089 CDS open 92456-92779 _na     107_aa ynfA YnfA family protein
163 JAKSED010000001.1 GCA022359935_00090 CDS open 92871-94172 _na     433_aa Cyclopropane-fatty-acyl-phospholipid synthase
164 JAKSED010000001.1 GCA022359935_00091 CDS open 94401-94985 _na     194_aa rplI 50S ribosomal protein L9
165 JAKSED010000001.1 GCA022359935_00092 CDS open 95202-95450 _na     82_aa rpsR 30S ribosomal protein S18
166 JAKSED010000001.1 GCA022359935_00093 CDS open 95454-95909 _na     151_aa rpsF 30S ribosomal protein S6
167 JAKSED010000001.1 GCA022359935_00094 CDS open 96195-96806 _na     203_aa Transposase
168 JAKSED010000001.1 GCA022359935_00095 CDS open 96803-97987 _na     394_aa MFS family permease
169 JAKSED010000001.1 GCA022359935_00096 CDS open 98070-98810 _na     246_aa mutT 8-oxo-dGTP pyrophosphatase MutT (NUDIX family)
170 JAKSED010000001.1 GCA022359935_00097 CDS open 98902-99351 _na     149_aa DUF983 domain-containing protein
171 JAKSED010000001.1 GCA022359935_00098 CDS open 99353-101653 _na     766_aa rnr ribonuclease R
172 JAKSED010000001.1 GCA022359935_00099 CDS open 101658-104285 _na     875_aa topA type I DNA topoisomerase
173 JAKSED010000001.1 GCA022359935_00100 CDS open 104576-104779 _na     67_aa hypothetical protein
174 JAKSED010000001.1 GCA022359935_00101 CDS open 104919-105314 _na     131_aa Putative lipoprotein with Yx(FWY)xxD motif
175 JAKSED010000001.1 GCA022359935_00102 CDS open 105508-106254 _na     248_aa Cytochrome C biogenesis protein
176 JAKSED010000001.1 GCA022359935_00103 CDS open 106434-107732 _na     432_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
177 JAKSED010000001.1 GCA022359935_00104 CDS open 107842-109668 _na     608_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
178 JAKSED010000001.1 GCA022359935_00105 CDS open 109781-110500 _na     239_aa Membrane protein
179 JAKSED010000001.1 GCA022359935_00106 CDS open 110452-112560 _na     702_aa recG ATP-dependent DNA helicase RecG
180 JAKSED010000001.1 GCA022359935_00107 CDS open 112809-113105 _na     98_aa sdhE FAD assembly factor SdhE
181 JAKSED010000001.1 GCA022359935_00108 CDS open 113158-116652 _na     1164_aa mfd transcription-repair coupling factor
182 JAKSED010000001.1 GCA022359935_00109 CDS open 116743-117501 _na     252_aa ygcG Putative membrane protein YgcG
183 JAKSED010000001.1 GCA022359935_00110 CDS open 117536-118213 _na     225_aa dsbA Putative DsbA family dithiol-disulfide isomerase
184 JAKSED010000001.1 GCA022359935_00111 CDS open 118237-120087 _na     616_aa Bicyclomycin resistance protein
185 JAKSED010000001.1 GCA022359935_00112 CDS open 120311-120934 _na     207_aa Invasion associated locus B family protein
186 JAKSED010000001.1 GCA022359935_00113 CDS open 121085-122146 _na     353_aa Glycerophosphoryl diester phosphodiesterase
187 JAKSED010000001.1 GCA022359935_00114 CDS open 122252-122731 _na     159_aa rpsI 30S ribosomal protein S9
188 JAKSED010000001.1 GCA022359935_00115 CDS open 122731-123195 _na     154_aa rplM 50S ribosomal protein L13
189 JAKSED010000001.1 GCA022359935_00116 CDS open 123415-123936 _na     173_aa hypothetical protein
190 JAKSED010000001.1 GCA022359935_00117 CDS open 123954-124412 _na     152_aa putative protein (TIGR00369 family)
191 JAKSED010000001.1 GCA022359935_00118 CDS open 124680-125963 _na     427_aa O-acetylhomoserine aminocarboxypropyltransferase
192 JAKSED010000001.1 GCA022359935_00119 CDS open 126025-126375 _na     116_aa (S)-ureidoglycine aminohydrolase cupin domain-containing protein
193 JAKSED010000001.1 GCA022359935_00120 CDS open 126457-127383 _na     308_aa Calcineurin-like phosphoesterase family protein
194 JAKSED010000001.1 GCA022359935_00121 CDS open 127590-128225 _na     211_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
195 JAKSED010000001.1 GCA022359935_00122 CDS open 128512-129789 _na     425_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
196 JAKSED010000001.1 GCA022359935_00123 CDS open 130119-132530 _na     803_aa lon endopeptidase La
197 JAKSED010000001.1 GCA022359935_00124 CDS open 132727-132999 _na     90_aa hupB DNA-binding protein HupB
198 JAKSED010000001.1 GCA022359935_00125 CDS open 133223-133891 _na     222_aa queH Epoxyqueuosine reductase QueH
199 JAKSED010000001.1 GCA022359935_00126 CDS open 134168-134314 _na     48_aa hypothetical protein
200 JAKSED010000001.1 GCA022359935_00129 CDS open 135226-135705 _na     159_aa tadA tRNA(Arg) A34 adenosine deaminase TadA
201 JAKSED010000001.1 GCA022359935_00130 CDS open 135787-136062 _na     91_aa Secreted protein
202 JAKSED010000001.1 GCA022359935_00131 CDS open 136214-137494 _na     426_aa nlpD Murein DD-endopeptidase MepM/ murein hydrolase activator NlpD
203 JAKSED010000001.1 GCA022359935_00132 CDS open 137834-138316 _na     160_aa bcp thioredoxin-dependent thiol peroxidase
204 JAKSED010000001.1 GCA022359935_00133 CDS open 138582-141869 _na     1095_aa DUF3971 domain-containing protein
205 JAKSED010000001.1 GCA022359935_00134 CDS open 141926-142366 _na     146_aa Glyoxalase-related protein domain-containing protein
206 JAKSED010000001.1 GCA022359935_00135 CDS open 142617-143870 _na     417_aa tyrS tyrosine--tRNA ligase
207 JAKSED010000001.1 GCA022359935_00136 CDS open 143973-145100 _na     375_aa anhydro-N-acetylmuramic acid kinase
208 JAKSED010000001.1 GCA022359935_00137 CDS open 145092-145766 _na     224_aa Xaa-Pro dipeptidyl-peptidase-like domain-containing protein
209 JAKSED010000001.1 GCA022359935_00138 CDS open 145982-147169 _na     395_aa Cysteine desulfurase
210 JAKSED010000001.1 GCA022359935_00139 CDS open 147322-148836 _na     504_aa sufB Fe-S cluster assembly protein SufB
211 JAKSED010000001.1 GCA022359935_00140 CDS open 148864-149619 _na     251_aa sufC Fe-S cluster assembly ATPase SufC
212 JAKSED010000001.1 GCA022359935_00141 CDS open 149646-150914 _na     422_aa sufD Fe-S cluster assembly protein SufD
213 JAKSED010000001.1 GCA022359935_00142 CDS open 150982-152223 _na     413_aa cysteine desulfurase
214 JAKSED010000001.1 GCA022359935_00143 CDS open 152220-152627 _na     135_aa SUF system Fe-S cluster assembly protein
215 JAKSED010000001.1 GCA022359935_00144 CDS open 152713-153150 _na     145_aa sufA Fe-S cluster assembly scaffold SufA
216 JAKSED010000001.1 GCA022359935_00145 CDS open 153160-153498 _na     112_aa DNA transformation protein
217 JAKSED010000001.1 GCA022359935_00146 CDS open 153717-154793 _na     358_aa recA recombinase RecA
218 JAKSED010000001.1 GCA022359935_00147 CDS open 155052-157712 _na     886_aa alaS alanine--tRNA ligase
219 JAKSED010000001.1 GCA022359935_00148 CDS open 157922-158608 _na     228_aa aqpZ aquaporin Z
220 JAKSED010000001.1 GCA022359935_00149 CDS open 158950-160161 _na     403_aa NADP-dependent isocitrate dehydrogenase
221 JAKSED010000001.1 GCA022359935_00150 CDS open 160303-160842 _na     179_aa Gluconate kinase
222 JAKSED010000001.1 GCA022359935_00151 CDS open 160849-161850 _na     333_aa RNA methyltransferase
223 JAKSED010000001.1 GCA022359935_00152 CDS open 161843-162643 _na     266_aa murI glutamate racemase
224 JAKSED010000001.1 GCA022359935_00153 CDS open 162695-162883 _na     62_aa DUF3008 domain-containing protein
225 JAKSED010000001.1 GCA022359935_00154 CDS open 162911-163816 _na     301_aa NAD(P)H dehydrogenase (Quinone)
226 JAKSED010000001.1 GCA022359935_00155 CDS open 163950-164399 _na     149_aa hxlR DNA-binding HxlR family transcriptional regulator
227 JAKSED010000001.1 GCA022359935_00156 CDS open 164597-165214 _na     205_aa rpsD 30S ribosomal protein S4
228 JAKSED010000001.1 GCA022359935_00157 CDS open 165368-166240 _na     290_aa ttcA tRNA 2-thiocytidine(32) synthetase TtcA
229 JAKSED010000001.1 GCA022359935_00158 CDS open 166247-167488 _na     413_aa Bcr/CflA family efflux transporter
230 JAKSED010000001.1 GCA022359935_00159 CDS open 167643-167978 _na     111_aa grxD Grx4 family monothiol glutaredoxin
231 JAKSED010000001.1 GCA022359935_00160 CDS open 168118-168924 _na     268_aa DUF2233 domain-containing protein
232 JAKSED010000001.1 GCA022359935_00161 CDS open 168966-169199 _na     77_aa bolA Transcriptional regulator%2C BolA protein family
233 JAKSED010000001.1 GCA022359935_00162 CDS open 169213-171456 _na     747_aa purL phosphoribosylformylglycinamidine synthase subunit PurL
234 JAKSED010000001.1 GCA022359935_00163 CDS open 171518-172099 _na     193_aa DUF998 domain-containing protein
235 JAKSED010000001.1 GCA022359935_00164 CDS open 172161-172577 _na     138_aa Lipoprotein
236 JAKSED010000001.1 GCA022359935_00165 CDS open 172651-173319 _na     222_aa purQ phosphoribosylformylglycinamidine synthase subunit PurQ
237 JAKSED010000001.1 GCA022359935_00166 CDS open 173321-173563 _na     80_aa purS phosphoribosylformylglycinamidine synthase subunit PurS
238 JAKSED010000001.1 GCA022359935_00167 CDS open 173589-174383 _na     264_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
239 JAKSED010000001.1 GCA022359935_00168 CDS open 174625-174984 _na     119_aa Aldolase
240 JAKSED010000001.1 GCA022359935_00169 CDS open 175129-175905 _na     258_aa 4-hydroxy-2-oxoheptanedioate aldolase
241 JAKSED010000001.1 GCA022359935_00170 CDS open 175912-176580 _na     222_aa Alpha/beta hydrolase
242 JAKSED010000001.1 GCA022359935_00171 CDS open 176534-177007 _na     157_aa GNAT superfamily N-acetyltransferase
243 JAKSED010000001.1 GCA022359935_00172 CDS open 177309-178124 _na     271_aa Catechol 2%2C3-dioxygenase
244 JAKSED010000001.1 GCA022359935_00173 CDS open 178176-178808 _na     210_aa Threonine/homoserine/homoserine lactone efflux protein
245 JAKSED010000001.1 GCA022359935_00174 CDS open 178988-179278 _na     96_aa ygiN Quinol monooxygenase YgiN
246 JAKSED010000001.1 GCA022359935_00175 CDS open 179333-180640 _na     435_aa purB adenylosuccinate lyase
247 JAKSED010000001.1 GCA022359935_00176 CDS open 180781-181506 _na     241_aa Putative secreted protein
248 JAKSED010000001.1 GCA022359935_00177 CDS open 181615-181803 _na     62_aa hypothetical protein
249 JAKSED010000001.1 GCA022359935_00178 CDS open 181881-182882 _na     333_aa L-aminopeptidase/D-esterase-like protein
250 JAKSED010000001.1 GCA022359935_00179 CDS open 182882-183940 _na     352_aa Branched-chain amino acid transport system substrate-binding protein
251 JAKSED010000001.1 GCA022359935_00180 CDS open 184122-184619 _na     165_aa Cob(II)yrinic acid a%2Cc-diamide reductase
252 JAKSED010000001.1 GCA022359935_00181 CDS open 184677-185723 _na     348_aa Xanthine dehydrogenase accessory factor
253 JAKSED010000001.1 GCA022359935_00182 CDS open 185720-186601 _na     293_aa Dienelactone hydrolase
254 JAKSED010000001.1 GCA022359935_00183 CDS open 186611-187669 _na     352_aa DUF1176 domain-containing protein
255 JAKSED010000001.1 GCA022359935_00184 CDS open 187874-188038 _na     54_aa DUF1127 domain-containing protein
256 JAKSED010000001.1 GCA022359935_00185 CDS open 188241-188699 _na     152_aa J domain-containing protein
257 JAKSED010000001.1 GCA022359935_00186 CDS open 188791-189039 _na     82_aa ParB-like chromosome segregation protein Spo0J
258 JAKSED010000001.1 GCA022359935_00187 CDS open 189177-189371 _na     64_aa ANTAR domain-containing protein
259 JAKSED010000001.1 GCA022359935_00188 CDS open 189577-190611 _na     344_aa Lysozyme
260 JAKSED010000001.1 GCA022359935_00189 CDS open 190635-190997 _na     120_aa Putative DNA-binding ribbon-helix-helix protein
261 JAKSED010000001.1 GCA022359935_00190 CDS open 191042-191599 _na     185_aa yajL Protease I
262 JAKSED010000001.1 GCA022359935_00191 CDS open 191817-195581 _na     1254_aa vitamin B12-dependent ribonucleotide reductase
263 JAKSED010000001.1 GCA022359935_00192 CDS open 196458-197303 _na     281_aa cysE serine O-acetyltransferase
264 JAKSED010000001.1 GCA022359935_00193 CDS open 197412-197615 _na     67_aa DUF3126 domain-containing protein
265 JAKSED010000001.1 GCA022359935_00194 CDS open 197646-198383 _na     245_aa Transmembrane anchored protein
266 JAKSED010000001.1 GCA022359935_00195 CDS open 198512-199045 _na     177_aa Carbonic anhydrase/acetyltransferase-like protein (Isoleucine patch superfamily)
267 JAKSED010000001.1 GCA022359935_00196 CDS open 199186-199791 _na     201_aa Putative transglutaminase-like cysteine proteinase
268 JAKSED010000001.1 GCA022359935_00197 CDS open 200149-200766 _na     205_aa pilZ PilZ domain-containing protein
269 JAKSED010000001.1 GCA022359935_00198 CDS open 200870-201508 _na     212_aa PAS domain-containing protein
270 JAKSED010000001.1 GCA022359935_00199 CDS open 201919-202641 _na     240_aa Membrane associated rhomboid family serine protease
271 JAKSED010000001.1 GCA022359935_00200 CDS open 202750-203181 _na     143_aa CBS domain-containing protein
272 JAKSED010000001.1 GCA022359935_00201 CDS open 203351-204850 _na     499_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
273 JAKSED010000001.1 GCA022359935_00202 CDS open 204851-205519 _na     222_aa GNAT family N-acetyltransferase
274 JAKSED010000001.1 GCA022359935_00203 CDS open 205377-206231 _na     284_aa panC pantoate--beta-alanine ligase
275 JAKSED010000001.1 GCA022359935_00204 CDS open 206233-207066 _na     277_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
276 JAKSED010000001.1 GCA022359935_00205 CDS open 207246-207644 _na     132_aa NADH:ubiquinone oxidoreductase subunit NDUFA12
277 JAKSED010000001.1 GCA022359935_00206 CDS open 207759-208202 _na     147_aa Cellulase-like protein
278 JAKSED010000001.1 GCA022359935_00207 CDS open 208387-208812 _na     141_aa IS5 family transposase
279 JAKSED010000001.1 GCA022359935_00208 CDS open 208926-209144 _na     72_aa Transposase
280 JAKSED010000001.1 GCA022359935_00209 CDS open 209154-209909 _na     251_aa radC DNA repair protein RadC
281 JAKSED010000001.1 GCA022359935_00210 CDS open 209976-210803 _na     275_aa map type I methionyl aminopeptidase
282 JAKSED010000001.1 GCA022359935_00211 CDS open 211036-211332 _na     98_aa DUF982 domain-containing protein
283 JAKSED010000001.1 GCA022359935_00212 CDS open 211488-211805 _na     105_aa brnA BrnA antitoxin of type II toxin-antitoxin system
284 JAKSED010000001.1 GCA022359935_00213 CDS open 211848-212153 _na     101_aa DUF982 domain-containing protein
285 JAKSED010000001.1 GCA022359935_00214 CDS open 212330-212590 _na     86_aa hypothetical protein
286 JAKSED010000001.1 GCA022359935_00215 CDS open 212698-212907 _na     69_aa Transmembrane protein
287 JAKSED010000001.1 GCA022359935_00216 CDS open 212950-213171 _na     73_aa phnA Alkylphosphonate utilization operon protein PhnA
288 JAKSED010000001.1 GCA022359935_00217 CDS open 213245-213568 _na     107_aa Transcriptional regulator
289 JAKSED010000001.1 GCA022359935_00219 CDS open 214073-215293 _na     406_aa DUF882 domain-containing protein
290 JAKSED010000001.1 GCA022359935_00220 CDS open 215516-217357 _na     613_aa Polyhydroxyalkanoate synthase
291 JAKSED010000001.1 GCA022359935_00221 CDS open 217455-217871 _na     138_aa Lipoprotein
292 JAKSED010000001.1 GCA022359935_00222 CDS open 217920-219137 _na     405_aa aspB LL-diaminopimelate aminotransferase
293 JAKSED010000001.1 GCA022359935_00223 CDS open 219184-220497 _na     437_aa Homoserine dehydrogenase
294 JAKSED010000001.1 GCA022359935_00224 CDS open 220731-221714 _na     327_aa glpX class II fructose-bisphosphatase
295 JAKSED010000001.1 GCA022359935_00225 CDS open 221773-223554 _na     593_aa recJ single-stranded-DNA-specific exonuclease RecJ
296 JAKSED010000001.1 GCA022359935_00226 CDS open 223569-224528 _na     319_aa NTE family protein
297 JAKSED010000001.1 GCA022359935_00227 CDS open 224613-225071 _na     152_aa hisI phosphoribosyl-AMP cyclohydrolase
298 JAKSED010000001.1 GCA022359935_00228 CDS open 225121-225759 _na     212_aa folE GTP cyclohydrolase I FolE
299 JAKSED010000001.1 GCA022359935_00229 CDS open 225990-226436 _na     148_aa iron-sulfur cluster assembly scaffold protein
300 JAKSED010000001.1 GCA022359935_00230 CDS open 226479-227528 _na     349_aa Luciferase
301 JAKSED010000001.1 GCA022359935_00231 CDS open 227718-228080 _na     120_aa yidD membrane protein insertion efficiency factor YidD
302 JAKSED010000001.1 GCA022359935_00232 CDS open 228244-229449 _na     401_aa D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine carboxypeptidase (Penicillin-binding protein 5/6)
303 JAKSED010000001.1 GCA022359935_00233 CDS open 229592-231580 _na     662_aa thrS threonine--tRNA ligase
304 JAKSED010000001.1 GCA022359935_00234 CDS open 231653-232132 _na     159_aa 6%2C7-dimethyl-8-ribityllumazine synthase
305 JAKSED010000001.1 GCA022359935_00235 CDS open 232430-233389 _na     319_aa Carboxypeptidase regulatory-like domain-containing protein
306 JAKSED010000001.1 GCA022359935_00236 CDS open 233539-234123 _na     194_aa Putative NAD(P)H nitroreductase
307 JAKSED010000001.1 GCA022359935_00237 CDS open 234178-235059 _na     293_aa Citrate lyase subunit beta/citryl-CoA lyase
308 JAKSED010000001.1 GCA022359935_00238 CDS open 235059-235511 _na     150_aa Dehydratase
309 JAKSED010000001.1 GCA022359935_00239 CDS open 235659-236783 _na     374_aa DUF2336 domain-containing protein
310 JAKSED010000001.1 GCA022359935_00240 CDS open 236786-238825 _na     679_aa yccC Putative membrane protein YccC
311 JAKSED010000001.1 GCA022359935_00241 CDS open 238832-240934 _na     700_aa parE DNA topoisomerase IV subunit B
312 JAKSED010000001.1 GCA022359935_00242 CDS open 240961-241128 _na     55_aa hypothetical protein
313 JAKSED010000001.1 GCA022359935_00243 CDS open 241167-243974 _na     935_aa gcvP aminomethyl-transferring glycine dehydrogenase
314 JAKSED010000001.1 GCA022359935_00244 CDS open 243987-244355 _na     122_aa gcvH glycine cleavage system protein GcvH
315 JAKSED010000001.1 GCA022359935_00245 CDS open 244361-245461 _na     366_aa gcvT glycine cleavage system aminomethyltransferase GcvT
316 JAKSED010000001.1 GCA022359935_00247 CDS open 246314-246580 _na     88_aa Transmembrane protein
317 JAKSED010000001.1 GCA022359935_00248 CDS open 246601-247206 _na     201_aa yigZ Putative YigZ family protein
318 JAKSED010000001.1 GCA022359935_00249 CDS open 247294-247812 _na     172_aa Transcriptional regulator
319 JAKSED010000001.1 GCA022359935_00251 CDS open 248299-248967 _na     222_aa Protein-L-isoaspartate O-methyltransferase
320 JAKSED010000001.1 GCA022359935_00252 CDS open 249135-250517 _na     460_aa tolC TolC family outer membrane protein
321 JAKSED010000001.1 GCA022359935_00253 CDS open 250783-251619 _na     278_aa DUF2497 domain-containing protein
322 JAKSED010000001.1 GCA022359935_00254 CDS open 251750-252556 _na     268_aa yecE putative protein YecE (DUF72 family)
323 JAKSED010000001.1 GCA022359935_00255 CDS open 252770-253420 _na     216_aa diguanylate cyclase domain-containing protein
324 JAKSED010000001.1 GCA022359935_00256 CDS open 253450-256374 _na     974_aa uvrA excinuclease ABC subunit UvrA
325 JAKSED010000001.1 GCA022359935_00257 CDS open 257084-257374 _na     96_aa Porin
326 JAKSED010000001.1 GCA022359935_00258 CDS open 257604-258140 _na     178_aa Single-stranded DNA-binding protein
327 JAKSED010000001.1 GCA022359935_00259 CDS open 258600-258989 _na     129_aa ompR DNA-binding response OmpR family regulator
328 JAKSED010000001.1 GCA022359935_00260 CDS open 258937-259272 _na     111_aa DUF3311 domain-containing protein
329 JAKSED010000001.1 GCA022359935_00261 CDS open 259272-262013 _na     913_aa histidine kinase
330 JAKSED010000001.1 GCA022359935_00262 CDS open 262056-263591 _na     511_aa HTH cro/C1-type domain-containing protein
331 JAKSED010000001.1 GCA022359935_00263 CDS open 263736-265079 _na     447_aa Amino acid/amide ABC transporter substrate-binding protein (HAAT family)
332 JAKSED010000001.1 GCA022359935_00264 CDS open 265189-266217 _na     342_aa ABC transporter permease
333 JAKSED010000001.1 GCA022359935_00265 CDS open 266224-267366 _na     380_aa Amino acid/amide ABC transporter membrane protein 2 (HAAT family)
334 JAKSED010000001.1 GCA022359935_00266 CDS open 267377-268150 _na     257_aa Amino acid/amide ABC transporter ATP-binding protein 1 (HAAT family)
335 JAKSED010000001.1 GCA022359935_00267 CDS open 268147-268911 _na     254_aa ABC transporter
336 JAKSED010000001.1 GCA022359935_00268 CDS open 269349-271319 _na     656_aa oleate hydratase
337 JAKSED010000001.1 GCA022359935_00269 CDS open 271337-271975 _na     212_aa acrR AcrR family transcriptional regulator
338 JAKSED010000001.1 GCA022359935_00270 CDS open 272090-272389 _na     99_aa hypothetical protein
339 JAKSED010000001.1 GCA022359935_00271 CDS open 273095-275092 _na     665_aa zntA Cadmium-translocating P-type ATPase
340 JAKSED010000001.1 GCA022359935_00272 CDS open 275260-275658 _na     132_aa Mannose-6-phosphate isomerase-like protein (Cupin superfamily)
341 JAKSED010000001.1 GCA022359935_00273 CDS open 275874-276593 _na     239_aa DUF924 domain-containing protein
342 JAKSED010000001.1 GCA022359935_00274 CDS open 276407-276796 _na     129_aa XRE family transcriptional regulator
343 JAKSED010000001.1 GCA022359935_00275 CDS open 276891-278465 _na     524_aa recombinase family protein
344 JAKSED010000001.1 GCA022359935_00276 CDS open 278465-279373 _na     302_aa parB Plasmid stablization protein ParB
345 JAKSED010000001.1 GCA022359935_00277 CDS open 279370-280287 _na     305_aa repB plasmid partitioning protein RepB C-terminal domain-containing protein
346 JAKSED010000001.1 GCA022359935_00278 CDS open 280792-283572 _na     926_aa UvrD-helicase domain-containing protein
347 JAKSED010000001.1 GCA022359935_00279 CDS open 283629-284465 _na     278_aa Glycoside hydrolase family 104 protein
348 JAKSED010000001.1 GCA022359935_00280 CDS open 284579-284926 _na     115_aa phage head closure protein
349 JAKSED010000001.1 GCA022359935_00281 CDS open 284926-285495 _na     189_aa head-tail connector protein
350 JAKSED010000001.1 GCA022359935_00282 CDS open 285570-285956 _na     128_aa Bacteriophage lambda head decoration protein D
351 JAKSED010000001.1 GCA022359935_00283 CDS open 286051-287325 _na     424_aa phage major capsid protein
352 JAKSED010000001.1 GCA022359935_00284 CDS open 287336-288196 _na     286_aa ATP-dependent Clp protease proteolytic subunit
353 JAKSED010000001.1 GCA022359935_00285 CDS open 288193-288351 _na     52_aa hypothetical protein
354 JAKSED010000001.1 GCA022359935_00286 CDS open 288348-289661 _na     437_aa phage portal protein
355 JAKSED010000001.1 GCA022359935_00287 CDS open 289682-291475 _na     597_aa Terminase
356 JAKSED010000001.1 GCA022359935_00288 CDS open 291459-291929 _na     156_aa phage terminase small subunit P27 family
357 JAKSED010000001.1 GCA022359935_00289 CDS open 292059-292289 _na     76_aa dinB DinB family protein
358 JAKSED010000001.1 GCA022359935_00290 CDS open 292382-292900 _na     172_aa DUF3489 domain-containing protein
359 JAKSED010000001.1 GCA022359935_00291 CDS open 292920-293177 _na     85_aa GtrA-like protein domain-containing protein
360 JAKSED010000001.1 GCA022359935_00292 CDS open 293174-294565 _na     463_aa Methyltransferase
361 JAKSED010000001.1 GCA022359935_00293 CDS open 294706-295050 _na     114_aa yajD Putative HNH nuclease YajD
362 JAKSED010000001.1 GCA022359935_00294 CDS open 295208-295588 _na     126_aa DUF6362 domain-containing protein
363 JAKSED010000001.1 GCA022359935_00295 CDS open 295581-295781 _na     66_aa DUF559 domain-containing protein
364 JAKSED010000001.1 GCA022359935_00296 CDS open 295778-296317 _na     179_aa ruvC crossover junction endodeoxyribonuclease RuvC
365 JAKSED010000001.1 GCA022359935_00297 CDS open 296425-299352 _na     975_aa putative P-loop ATPase-like protein
366 JAKSED010000001.1 GCA022359935_00298 CDS open 299345-300625 _na     426_aa recD Exodeoxyribonuclease V
367 JAKSED010000001.1 GCA022359935_00299 CDS open 300622-301392 _na     256_aa PD-(D/E)XK endonuclease-like domain-containing protein
368 JAKSED010000001.1 GCA022359935_00300 CDS open 301401-301616 _na     71_aa DUF6511 domain-containing protein
369 JAKSED010000001.1 GCA022359935_00301 CDS open 301990-302724 _na     244_aa DUF669 domain-containing protein
370 JAKSED010000001.1 GCA022359935_00302 CDS open 302731-303564 _na     277_aa ATP-binding protein
371 JAKSED010000001.1 GCA022359935_00303 CDS open 303564-303863 _na     99_aa Integrase
372 JAKSED010000001.1 GCA022359935_00304 CDS open 303860-304354 _na     164_aa hypothetical protein
373 JAKSED010000001.1 GCA022359935_00305 CDS open 304354-304695 _na     113_aa hypothetical protein
374 JAKSED010000001.1 GCA022359935_00306 CDS open 304730-305305 _na     191_aa sigma factor
375 JAKSED010000001.1 GCA022359935_00307 CDS open 305435-306370 _na     311_aa OmpR/PhoB-type domain-containing protein
376 JAKSED010000001.1 GCA022359935_00308 CDS open 306330-307577 _na     415_aa DUF1704 domain-containing protein
377 JAKSED010000001.1 GCA022359935_00309 CDS open 307935-308381 _na     148_aa Bacteriophage-related protein
378 JAKSED010000001.1 GCA022359935_00310 CDS open 308378-309709 _na     443_aa Resolvase
379 JAKSED010000001.1 GCA022359935_00311 CDS open 309706-310113 _na     135_aa Bacteriophage-related protein
380 JAKSED010000001.1 GCA022359935_00312 CDS open 310196-310444 _na     82_aa mads1 methylation-associated defense system helix-turn-helix domain-containing protein MAD1
381 JAKSED010000001.1 GCA022359935_00313 CDS open 310434-313295 _na     953_aa SNF2-related protein
382 JAKSED010000001.1 GCA022359935_00314 CDS open 313312-315114 _na     600_aa AIPR family protein
383 JAKSED010000001.1 GCA022359935_00315 CDS open 315111-316802 _na     563_aa site-specific DNA-methyltransferase
384 JAKSED010000001.1 GCA022359935_00316 CDS open 316799-319489 _na     896_aa DEAD/DEAH box helicase
385 JAKSED010000001.1 GCA022359935_00317 CDS open 319486-320400 _na     304_aa Restriction endonuclease
386 JAKSED010000001.1 GCA022359935_00319 CDS open 321046-322455 _na     469_aa glnA type I glutamate--ammonia ligase
387 JAKSED010000001.1 GCA022359935_00320 CDS open 322501-322839 _na     112_aa glnB Nitrogen regulatory protein P-II
388 JAKSED010000001.1 GCA022359935_00321 CDS open 323148-324656 _na     502_aa Bifunctional NAD(P)H-hydrate repair enzyme
389 JAKSED010000001.1 GCA022359935_00322 CDS open 324729-327512 _na     927_aa valine--tRNA ligase
390 JAKSED010000001.1 GCA022359935_00323 CDS open 327937-329076 _na     379_aa aromatic hydrocarbon degradation protein
391 JAKSED010000001.1 GCA022359935_00324 CDS open 329414-330340 _na     308_aa Exopolysaccharide production negative regulator
392 JAKSED010000001.1 GCA022359935_00325 CDS open 330476-331270 _na     264_aa xth exodeoxyribonuclease III
393 JAKSED010000001.1 GCA022359935_00326 CDS open 331392-332879 _na     495_aa Permease
394 JAKSED010000001.1 GCA022359935_00327 CDS open 332947-333309 _na     120_aa erpA iron-sulfur cluster insertion protein ErpA
395 JAKSED010000001.1 GCA022359935_00328 CDS open 333400-334644 _na     414_aa deoxyguanosinetriphosphate triphosphohydrolase
396 JAKSED010000001.1 GCA022359935_00329 CDS open 334726-336483 _na     585_aa argS arginine--tRNA ligase
397 JAKSED010000001.1 GCA022359935_00330 CDS open 336585-339377 _na     930_aa SPOR domain-containing protein
398 JAKSED010000001.1 GCA022359935_00331 CDS open 339490-340509 _na     339_aa nagZ beta-N-acetylhexosaminidase
399 JAKSED010000001.1 GCA022359935_00332 CDS open 340611-341408 _na     265_aa Segregation and condensation protein A
400 JAKSED010000001.1 GCA022359935_00333 CDS open 341405-342130 _na     241_aa scpB SMC-Scp complex subunit ScpB
401 JAKSED010000001.1 GCA022359935_00334 CDS open 342289-342504 _na     71_aa tatA twin-arginine translocase TatA/TatE family subunit
402 JAKSED010000001.1 GCA022359935_00335 CDS open 342535-343290 _na     251_aa tatB Sec-independent protein translocase protein TatB
403 JAKSED010000001.1 GCA022359935_00336 CDS open 343287-344147 _na     286_aa tatC twin-arginine translocase subunit TatC
404 JAKSED010000001.1 GCA022359935_00337 CDS open 344333-344806 _na     157_aa yciE Ferritin-like metal-binding protein YciE
405 JAKSED010000001.1 GCA022359935_00338 CDS open 344875-345117 _na     80_aa Transmembrane protein
406 JAKSED010000001.1 GCA022359935_00339 CDS open 345242-346129 _na     295_aa yghX YghX family hydrolase
407 JAKSED010000001.1 GCA022359935_00340 CDS open 346265-346600 _na     111_aa Two pore domain potassium channel family protein
408 JAKSED010000001.1 GCA022359935_00341 CDS open 346681-347601 _na     306_aa diguanylate cyclase
409 JAKSED010000001.1 GCA022359935_00342 CDS open 347712-348044 _na     110_aa Lipoprotein
410 JAKSED010000001.1 GCA022359935_00344 CDS open 348452-349132 _na     226_aa Phosphoglycolate phosphatase
411 JAKSED010000001.1 GCA022359935_00345 CDS open 349306-349989 _na     227_aa rpiA ribose-5-phosphate isomerase RpiA
412 JAKSED010000001.1 GCA022359935_00346 CDS open 350012-350581 _na     189_aa DUF2059 domain-containing protein
413 JAKSED010000001.1 GCA022359935_00347 CDS open 350689-352080 _na     463_aa gor glutathione-disulfide reductase
414 JAKSED010000001.1 GCA022359935_00348 CDS open 352100-353464 _na     454_aa mgtE magnesium transporter
415 JAKSED010000001.1 GCA022359935_00349 CDS open 353668-355641 _na     657_aa ABC-type putative transport system fused permease/ATPase subunit
416 JAKSED010000001.1 GCA022359935_00350 CDS open 356149-357492 _na     447_aa class II 3-deoxy-7-phosphoheptulonate synthase
417 JAKSED010000001.1 GCA022359935_00351 CDS open 357577-358650 _na     357_aa diguanylate cyclase
418 JAKSED010000001.1 GCA022359935_00352 CDS open 359007-359366 _na     119_aa Diacylglycerol kinase
419 JAKSED010000001.1 GCA022359935_00353 CDS open 359408-361090 _na     560_aa NAD+ synthase
420 JAKSED010000001.1 GCA022359935_00354 CDS open 361083-361493 _na     136_aa yhbS Putative N-acetyltransferase YhbS
421 JAKSED010000001.1 GCA022359935_00355 CDS open 361577-362950 _na     457_aa gltX glutamate--tRNA ligase
422 JAKSED010000001.1 GCA022359935_00356 CDS open 362913-363956 _na     347_aa DUF2865 domain-containing protein
423 JAKSED010000001.1 GCA022359935_00357 CDS open 364017-366365 _na     782_aa Malate dehydrogenase (Oxaloacetate-decarboxylating)(NADP+)
424 JAKSED010000001.1 GCA022359935_00358 CDS open 366640-367461 _na     273_aa lpxH UDP-2%2C3-diacylglucosamine pyrophosphatase LpxH
425 JAKSED010000001.1 GCA022359935_00359 CDS open 367466-368449 _na     327_aa dgcA N-acetyl-D-Glu racemase DgcA
426 JAKSED010000001.1 GCA022359935_00360 CDS open 368528-369715 _na     395_aa Phospholipid/cholesterol/gamma-HCH transport system permease protein
427 JAKSED010000001.1 GCA022359935_00361 CDS open 369726-370535 _na     269_aa Phospholipid/cholesterol/gamma-HCH transport system ATP-binding protein
428 JAKSED010000001.1 GCA022359935_00362 CDS open 370550-371923 _na     457_aa Organic solvent ABC transporter substrate-binding protein
429 JAKSED010000001.1 GCA022359935_00363 CDS open 372006-372605 _na     199_aa Cholesterol transport system auxiliary component
430 JAKSED010000001.1 GCA022359935_00364 CDS open 372681-374276 _na     531_aa Superfamily II DNA/RNA helicase
431 JAKSED010000001.1 GCA022359935_00365 CDS open 374381-375169 _na     262_aa NAD kinase
432 JAKSED010000001.1 GCA022359935_00366 CDS open 375656-376084 _na     142_aa N-acetyltransferase domain-containing protein
433 JAKSED010000001.1 GCA022359935_00367 CDS open 376081-377271 _na     396_aa diguanylate cyclase
434 JAKSED010000001.1 GCA022359935_00368 CDS open 377320-377577 _na     85_aa hypothetical protein
435 JAKSED010000001.1 GCA022359935_00369 CDS open 377574-378038 _na     154_aa DDE-type integrase/transposase/recombinase
436 JAKSED010000001.1 GCA022359935_00370 CDS open 377995-378789 _na     264_aa Putative spermidine/putrescine transport system permease protein
437 JAKSED010000001.1 GCA022359935_00371 CDS open 378789-378929 _na     46_aa hypothetical protein
438 JAKSED010000001.1 GCA022359935_00372 CDS open 378922-379257 _na     111_aa Tc1-like transposase DDE domain-containing protein
439 JAKSED010000001.1 GCA022359935_00373 CDS open 379208-379567 _na     119_aa Transposase
440 JAKSED010000001.1 GCA022359935_00375 CDS open 380470-380637 _na     55_aa Phosphatidate cytidylyltransferase
441 JAKSED010000001.1 GCA022359935_00376 CDS open 380650-381465 _na     271_aa bhcR HTH-type transcriptional regulator BhcR
442 JAKSED010000001.1 GCA022359935_00377 CDS open 381667-383448 _na     593_aa gcl glyoxylate carboligase
443 JAKSED010000001.1 GCA022359935_00378 CDS open 383473-384270 _na     265_aa hyi hydroxypyruvate isomerase
444 JAKSED010000001.1 GCA022359935_00379 CDS open 384291-385175 _na     294_aa 2-hydroxy-3-oxopropionate reductase
445 JAKSED010000001.1 GCA022359935_00380 CDS open 385378-386229 _na     283_aa 23S rRNA (Guanosine2251-2'-O)-methyltransferase
446 JAKSED010000001.1 GCA022359935_00383 CDS open 386815-387990 _na     391_aa tuf elongation factor Tu
447 JAKSED010000001.1 GCA022359935_00384 CDS open 388160-388546 _na     128_aa GFA family protein
448 JAKSED010000001.1 GCA022359935_00386 CDS open 389094-389297 _na     67_aa secE preprotein translocase subunit SecE
449 JAKSED010000001.1 GCA022359935_00387 CDS open 389325-389864 _na     179_aa nusG transcription termination/antitermination protein NusG
450 JAKSED010000001.1 GCA022359935_00388 CDS open 390033-390461 _na     142_aa rplK 50S ribosomal protein L11
451 JAKSED010000001.1 GCA022359935_00389 CDS open 390466-391164 _na     232_aa rplA 50S ribosomal protein L1
452 JAKSED010000001.1 GCA022359935_00390 CDS open 391533-392051 _na     172_aa rplJ 50S ribosomal protein L10
453 JAKSED010000001.1 GCA022359935_00391 CDS open 392109-392483 _na     124_aa rplL 50S ribosomal protein L7/L12
454 JAKSED010000001.1 GCA022359935_00392 CDS open 392700-396836 _na     1378_aa rpoB DNA-directed RNA polymerase subunit beta
455 JAKSED010000001.1 GCA022359935_00393 CDS open 396981-401177 _na     1398_aa rpoC DNA-directed RNA polymerase subunit beta'
456 JAKSED010000001.1 GCA022359935_00394 CDS open 401306-401599 _na     97_aa Transcriptional regulator
457 JAKSED010000001.1 GCA022359935_00395 CDS open 402063-402434 _na     123_aa rpsL 30S ribosomal protein S12
458 JAKSED010000001.1 GCA022359935_00396 CDS open 402494-402964 _na     156_aa rpsG 30S ribosomal protein S7
459 JAKSED010000001.1 GCA022359935_00397 CDS open 402995-405085 _na     696_aa fusA elongation factor G
460 JAKSED010000001.1 GCA022359935_00398 CDS open 405152-406327 _na     391_aa tuf elongation factor Tu
461 JAKSED010000001.1 GCA022359935_00399 CDS open 406394-406702 _na     102_aa rpsJ 30S ribosomal protein S10
462 JAKSED010000001.1 GCA022359935_00400 CDS open 406762-407487 _na     241_aa rplC 50S ribosomal protein L3
463 JAKSED010000001.1 GCA022359935_00401 CDS open 407487-408107 _na     206_aa rplD 50S ribosomal protein L4
464 JAKSED010000001.1 GCA022359935_00402 CDS open 408104-408397 _na     97_aa 50S ribosomal protein L23
465 JAKSED010000001.1 GCA022359935_00403 CDS open 408420-409253 _na     277_aa rplB 50S ribosomal protein L2
466 JAKSED010000001.1 GCA022359935_00404 CDS open 409270-409548 _na     92_aa rpsS 30S ribosomal protein S19
467 JAKSED010000001.1 GCA022359935_00405 CDS open 409551-409940 _na     129_aa rplV 50S ribosomal protein L22
468 JAKSED010000001.1 GCA022359935_00406 CDS open 409940-410665 _na     241_aa rpsC 30S ribosomal protein S3
469 JAKSED010000001.1 GCA022359935_00407 CDS open 410691-411104 _na     137_aa rplP 50S ribosomal protein L16
470 JAKSED010000001.1 GCA022359935_00408 CDS open 411117-411317 _na     66_aa rpmC 50S ribosomal protein L29
471 JAKSED010000001.1 GCA022359935_00409 CDS open 411328-411567 _na     79_aa rpsQ 30S ribosomal protein S17
472 JAKSED010000001.1 GCA022359935_00410 CDS open 411644-412012 _na     122_aa rplN 50S ribosomal protein L14
473 JAKSED010000001.1 GCA022359935_00411 CDS open 412025-412339 _na     104_aa rplX 50S ribosomal protein L24
474 JAKSED010000001.1 GCA022359935_00412 CDS open 412332-412904 _na     190_aa rplE 50S ribosomal protein L5
475 JAKSED010000001.1 GCA022359935_00413 CDS open 412932-413237 _na     101_aa rpsN 30S ribosomal protein S14
476 JAKSED010000001.1 GCA022359935_00414 CDS open 413250-413648 _na     132_aa rpsH 30S ribosomal protein S8
477 JAKSED010000001.1 GCA022359935_00415 CDS open 413735-414268 _na     177_aa rplF 50S ribosomal protein L6
478 JAKSED010000001.1 GCA022359935_00416 CDS open 414373-414732 _na     119_aa rplR 50S ribosomal protein L18
479 JAKSED010000001.1 GCA022359935_00417 CDS open 414880-415449 _na     189_aa rpsE 30S ribosomal protein S5
480 JAKSED010000001.1 GCA022359935_00418 CDS open 415475-415672 _na     65_aa rpmD 50S ribosomal protein L30
481 JAKSED010000001.1 GCA022359935_00419 CDS open 415695-416168 _na     157_aa rplO 50S ribosomal protein L15
482 JAKSED010000001.1 GCA022359935_00420 CDS open 416297-417637 _na     446_aa secY preprotein translocase subunit SecY
483 JAKSED010000001.1 GCA022359935_00421 CDS open 417634-418224 _na     196_aa adenylate kinase
484 JAKSED010000001.1 GCA022359935_00422 CDS open 418369-418782 _na     137_aa rpsM 30S ribosomal protein S13
485 JAKSED010000001.1 GCA022359935_00423 CDS open 418903-419292 _na     129_aa rpsK 30S ribosomal protein S11
486 JAKSED010000001.1 GCA022359935_00424 CDS open 419391-420401 _na     336_aa rpoA DNA-directed RNA polymerase subunit alpha
487 JAKSED010000001.1 GCA022359935_00425 CDS open 420508-420936 _na     142_aa rplQ 50S ribosomal protein L17
488 JAKSED010000001.1 GCA022359935_00426 CDS open 421018-421659 _na     213_aa msrQ protein-methionine-sulfoxide reductase heme-binding subunit MsrQ
489 JAKSED010000001.1 GCA022359935_00427 CDS open 421659-422600 _na     313_aa msrP protein-methionine-sulfoxide reductase catalytic subunit MsrP
490 JAKSED010000001.1 GCA022359935_00428 CDS open 422892-424376 _na     494_aa putative periplasmic serine endoprotease DegP-like
491 JAKSED010000001.1 GCA022359935_00429 CDS open 424387-425694 _na     435_aa Replication-associated recombination protein A
492 JAKSED010000001.1 GCA022359935_00430 CDS open 425824-426762 _na     312_aa Pseudouridine synthase
493 JAKSED010000001.1 GCA022359935_00431 CDS open 426762-427583 _na     273_aa Chaperone required for assembly of F1-ATPase
494 JAKSED010000001.1 GCA022359935_00432 CDS open 427829-429718 _na     629_aa MFS transporter
495 JAKSED010000001.1 GCA022359935_00433 CDS open 429807-430184 _na     125_aa Membrane-bound inhibitor of C-type lysozyme
496 JAKSED010000001.1 GCA022359935_00434 CDS open 430300-430503 _na     67_aa Putative membrane protein
497 JAKSED010000001.1 GCA022359935_00435 CDS open 430574-431203 _na     209_aa UPF0056 membrane protein
498 JAKSED010000001.1 GCA022359935_00436 CDS open 431445-434291 _na     948_aa gyrA DNA gyrase subunit A
499 JAKSED010000001.1 GCA022359935_00437 CDS open 434338-434484 _na     48_aa hypothetical protein
500 JAKSED010000001.1 GCA022359935_00438 CDS open 434675-435175 _na     166_aa coaD pantetheine-phosphate adenylyltransferase