HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Levilactobacillus brevis (GCA_025447255.1)

Select a Genome:
BAKTA Annotations for GCA_025447255.1
Genome Selected: Levilactobacillus brevis
ContigsBases CDSrRNA tmRNAtRNA
5 2628394 2532 15 1 64
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5264 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 5264 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 JAOEJK010000001.1 GCA025447255_00776 gene open 819860-820228 ssrA
2 JAOEJK010000001.1 GCA025447255_00776 tmRNA open 819860-820228 ssrA transfer-messenger RNA%2C SsrA
3 JAOEJK010000001.1 rep_origin open 2504279-2504825
4 JAOEJK010000001.1 GCA025447255_00094 gene open 97888-99453 rrs
5 JAOEJK010000001.1 GCA025447255_00095 gene open 99670-102588 rrl
6 JAOEJK010000001.1 GCA025447255_00096 gene open 102658-102774 rrf
7 JAOEJK010000001.1 GCA025447255_00205 gene open 224145-224268 Ref68
8 JAOEJK010000001.1 GCA025447255_00466 gene open 503169-504734 rrs
9 JAOEJK010000001.1 GCA025447255_00467 gene open 504951-507869 rrl
10 JAOEJK010000001.1 GCA025447255_00468 gene open 507939-508055 rrf
11 JAOEJK010000001.1 GCA025447255_00577 gene open 626561-628126 rrs
12 JAOEJK010000001.1 GCA025447255_00580 gene open 628545-631463 rrl
13 JAOEJK010000001.1 GCA025447255_00581 gene open 631533-631649 rrf
14 JAOEJK010000001.1 GCA025447255_00650 gene open 694849-694935 Bacteria_small_SRP
15 JAOEJK010000001.1 GCA025447255_00938 gene open 976827-978392 rrs
16 JAOEJK010000001.1 GCA025447255_00939 gene open 978609-981527 rrl
17 JAOEJK010000001.1 GCA025447255_00940 gene open 981597-981713 rrf
18 JAOEJK010000001.1 GCA025447255_01190 gene open 1205427-1205806 RNaseP_bact_b
19 JAOEJK010000001.1 GCA025447255_01634 gene open 1629125-1629241 rrf
20 JAOEJK010000001.1 GCA025447255_01635 gene open 1629311-1632229 rrl
21 JAOEJK010000001.1 GCA025447255_01638 gene open 1632648-1634213 rrs
22 JAOEJK010000001.1 GCA025447255_00205 ncRNA open 224145-224268 Enterococcus sRNA 68 (Lacto-3 RNA)
23 JAOEJK010000001.1 GCA025447255_00650 ncRNA open 694849-694935 Bacterial small signal recognition particle RNA
24 JAOEJK010000001.1 GCA025447255_01190 ncRNA open 1205427-1205806 Bacterial RNase P class B
25 JAOEJK010000001.1 regulatory_region open 25659-25873 T-box leader
26 JAOEJK010000001.1 regulatory_region open 71985-72235 T-box leader
27 JAOEJK010000001.1 regulatory_region open 104991-105157 M-box riboswitch aptamer (ykoK leader)
28 JAOEJK010000001.1 regulatory_region open 501092-501289 T-box leader
29 JAOEJK010000001.1 regulatory_region open 582480-582512 L31-Firmicutes ribosomal protein leader
30 JAOEJK010000001.1 regulatory_region open 683904-684032 Ribosomal protein L10 leader
31 JAOEJK010000001.1 regulatory_region open 893240-893453 T-box leader
32 JAOEJK010000001.1 regulatory_region open 902508-902735 T-box leader
33 JAOEJK010000001.1 regulatory_region open 1070140-1070217 Ribosomal protein L21 leader
34 JAOEJK010000001.1 regulatory_region open 1228259-1228356 THF (Tetrahydrofolate) riboswitch aptamer
35 JAOEJK010000001.1 regulatory_region open 1307338-1307455 FMN riboswitch aptamer (RFN element)
36 JAOEJK010000001.1 regulatory_region open 1551441-1551542 23S methyl RNA motif
37 JAOEJK010000001.1 regulatory_region open 1623378-1623496 SAM-III riboswitch aptamer (SMK box)
38 JAOEJK010000001.1 regulatory_region open 1757082-1757216 FMN riboswitch aptamer (RFN element)
39 JAOEJK010000001.1 regulatory_region open 1761400-1761458 Ribosomal protein L13 leader
40 JAOEJK010000001.1 regulatory_region open 1794003-1794059 Lacto-rpoB RNA
41 JAOEJK010000001.1 regulatory_region open 1803300-1803482 Lysine riboswitch aptamer
42 JAOEJK010000001.1 regulatory_region open 1939988-1940079 TPP riboswitch aptamer (THI element)
43 JAOEJK010000001.1 regulatory_region open 1948088-1948186 Purine riboswitch aptamer
44 JAOEJK010000001.1 regulatory_region open 2044460-2044856 cspA thermoregulator
45 JAOEJK010000001.1 regulatory_region open 2209916-2210021 TPP riboswitch aptamer (THI element)
46 JAOEJK010000001.1 regulatory_region open 2281455-2281618 M-box riboswitch aptamer (ykoK leader)
47 JAOEJK010000001.1 regulatory_region open 2289516-2289609 Guanidine-I riboswitch aptamer
48 JAOEJK010000001.1 regulatory_region open 2368866-2368964 azaaromatic riboswitch aptamer (yjdF RNA)
49 JAOEJK010000001.1 GCA025447255_00094 rRNA open 97888-99453 rrs 16S ribosomal RNA
50 JAOEJK010000001.1 GCA025447255_00095 rRNA open 99670-102588 rrl 23S ribosomal RNA
51 JAOEJK010000001.1 GCA025447255_00096 rRNA open 102658-102774 rrf 5S ribosomal RNA
52 JAOEJK010000001.1 GCA025447255_00466 rRNA open 503169-504734 rrs 16S ribosomal RNA
53 JAOEJK010000001.1 GCA025447255_00467 rRNA open 504951-507869 rrl 23S ribosomal RNA
54 JAOEJK010000001.1 GCA025447255_00468 rRNA open 507939-508055 rrf 5S ribosomal RNA
55 JAOEJK010000001.1 GCA025447255_00577 rRNA open 626561-628126 rrs 16S ribosomal RNA
56 JAOEJK010000001.1 GCA025447255_00580 rRNA open 628545-631463 rrl 23S ribosomal RNA
57 JAOEJK010000001.1 GCA025447255_00581 rRNA open 631533-631649 rrf 5S ribosomal RNA
58 JAOEJK010000001.1 GCA025447255_00938 rRNA open 976827-978392 rrs 16S ribosomal RNA
59 JAOEJK010000001.1 GCA025447255_00939 rRNA open 978609-981527 rrl 23S ribosomal RNA
60 JAOEJK010000001.1 GCA025447255_00940 rRNA open 981597-981713 rrf 5S ribosomal RNA
61 JAOEJK010000001.1 GCA025447255_01634 rRNA open 1629125-1629241 rrf 5S ribosomal RNA
62 JAOEJK010000001.1 GCA025447255_01635 rRNA open 1629311-1632229 rrl 23S ribosomal RNA
63 JAOEJK010000001.1 GCA025447255_01638 rRNA open 1632648-1634213 rrs 16S ribosomal RNA
64 JAOEJK010000001.1 repeat_region open 1140822-1141101 CRISPR array with 5 repeats of length 28%2C consensus sequence GTATTCCCCACGGGTGTGGGGGTGATCC and spacer length 33
65 JAOEJK010000001.1 repeat_region open 2297949-2298917 CRISPR array with 15 repeats of length 36%2C consensus sequence GTTCTTAACCCTATTGATTTACCAAGATTCTAAAGC and spacer length 30
66 JAOEJK010000001.1 GCA025447255_00001 CDS open 3-395 _na     130_aa DNA polymerase III beta subunit
67 JAOEJK010000001.1 GCA025447255_00002 CDS open 815-1042 _na     75_aa ybcJ S4 domain-containing protein YaaA
68 JAOEJK010000001.1 GCA025447255_00003 CDS open 1042-2196 _na     384_aa recF DNA replication/repair protein RecF
69 JAOEJK010000001.1 GCA025447255_00004 CDS open 2200-4143 _na     647_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
70 JAOEJK010000001.1 GCA025447255_00005 CDS open 4165-6699 _na     844_aa gyrA DNA gyrase subunit A
71 JAOEJK010000001.1 GCA025447255_00006 CDS open 7359-7655 _na     98_aa rpsF 30S ribosomal protein S6
72 JAOEJK010000001.1 GCA025447255_00007 CDS open 7689-8255 _na     188_aa ssb Single-stranded DNA-binding protein
73 JAOEJK010000001.1 GCA025447255_00008 CDS open 8284-8520 _na     78_aa rpsR 30S ribosomal protein S18
74 JAOEJK010000001.1 GCA025447255_00009 CDS open 8665-9852 _na     395_aa hutI Amidohydrolase-related domain-containing protein
75 JAOEJK010000001.1 GCA025447255_00010 CDS open 9883-11490 _na     535_aa oppA ABC-type oligopeptide transport system%2C periplasmic component
76 JAOEJK010000001.1 GCA025447255_00011 CDS open 12099-12875 _na     258_aa D-alanyl-D-alanine carboxypeptidase
77 JAOEJK010000001.1 GCA025447255_00012 CDS open 13008-14192 _na     394_aa hutI Pro-Hyp dipeptidase Metallo peptidase MEROPS family M38
78 JAOEJK010000001.1 GCA025447255_00013 CDS open 14214-15815 _na     533_aa oppA ABC-type oligopeptide transport system%2C periplasmic component
79 JAOEJK010000001.1 GCA025447255_00014 CDS open 16371-16937 _na     188_aa acrR Transcriptional regulator
80 JAOEJK010000001.1 GCA025447255_00015 CDS open 17057-17791 _na     244_aa tauE putative membrane transporter protein
81 JAOEJK010000001.1 GCA025447255_00016 CDS open 18059-20074 _na     671_aa gdpP Cyclic-di-AMP phosphodiesterase
82 JAOEJK010000001.1 GCA025447255_00017 CDS open 20143-20601 _na     152_aa rplI 50S ribosomal protein L9
83 JAOEJK010000001.1 GCA025447255_00018 CDS open 20777-20995 _na     72_aa Holin
84 JAOEJK010000001.1 GCA025447255_00019 CDS open 21058-21201 _na     47_aa hypothetical protein
85 JAOEJK010000001.1 GCA025447255_00020 CDS open 21521-22909 _na     462_aa dnaB replicative DNA helicase
86 JAOEJK010000001.1 GCA025447255_00021 CDS open 23298-23828 _na     176_aa wrbA Multimeric flavodoxin WrbA
87 JAOEJK010000001.1 GCA025447255_00022 CDS open 23969-25144 _na     391_aa Permease of the major facilitator superfamily
88 JAOEJK010000001.1 GCA025447255_00023 CDS open 25218-25487 _na     89_aa Extracellular protein
89 JAOEJK010000001.1 GCA025447255_00024 CDS open 25936-27546 _na     536_aa oppA ABC-type oligopeptide transport system%2C periplasmic component
90 JAOEJK010000001.1 GCA025447255_00025 CDS open 27746-27991 _na     81_aa hypothetical protein
91 JAOEJK010000001.1 GCA025447255_00026 CDS open 28038-29039 _na     333_aa Matrixin
92 JAOEJK010000001.1 GCA025447255_00028 CDS open 30051-30767 _na     238_aa yycF response regulator YycF
93 JAOEJK010000001.1 GCA025447255_00029 CDS open 30812-32668 _na     618_aa walK cell wall metabolism sensor histidine kinase WalK
94 JAOEJK010000001.1 GCA025447255_00030 CDS open 32655-33956 _na     433_aa yycH Regulatory protein YycH domain-containing protein
95 JAOEJK010000001.1 GCA025447255_00031 CDS open 33979-34833 _na     284_aa yycI Regulatory protein YycH-like domain-containing protein
96 JAOEJK010000001.1 GCA025447255_00032 CDS open 34979-35806 _na     275_aa phnP Metal-dependent hydrolase of the beta-lactamase superfamily I
97 JAOEJK010000001.1 GCA025447255_00033 CDS open 35956-37299 _na     447_aa degQ Trypsin-like serine protease with PDZ domain
98 JAOEJK010000001.1 GCA025447255_00034 CDS open 37836-38315 _na     159_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
99 JAOEJK010000001.1 GCA025447255_00035 CDS open 38406-39074 _na     222_aa DUF4062 domain-containing protein
100 JAOEJK010000001.1 GCA025447255_00036 CDS open 39018-39938 _na     306_aa tnp IS30 family ISLsa1 transposase
101 JAOEJK010000001.1 GCA025447255_00037 CDS open 40076-42079 _na     667_aa hypothetical protein
102 JAOEJK010000001.1 GCA025447255_00038 CDS open 42520-44364 _na     614_aa MucBP domain-containing protein
103 JAOEJK010000001.1 GCA025447255_00039 CDS open 44797-44928 _na     43_aa hypothetical protein
104 JAOEJK010000001.1 GCA025447255_00040 CDS open 44939-45454 _na     171_aa Surface layer protein A domain-containing protein
105 JAOEJK010000001.1 GCA025447255_00041 CDS open 45488-46057 _na     189_aa DUF4767 domain-containing protein
106 JAOEJK010000001.1 GCA025447255_00042 CDS open 46325-46777 _na     150_aa Surface layer protein A domain-containing protein
107 JAOEJK010000001.1 GCA025447255_00043 CDS open 46911-48794 _na     627_aa ushA 5'-nucleotidase protein
108 JAOEJK010000001.1 GCA025447255_00044 CDS open 48946-49434 _na     162_aa rimI Acetyltransferase
109 JAOEJK010000001.1 GCA025447255_00045 CDS open 49562-50689 _na     375_aa D-alanyl-D-alanine carboxypeptidase
110 JAOEJK010000001.1 GCA025447255_00046 CDS open 50985-51908 _na     307_aa surA Foldase protein PrsA
111 JAOEJK010000001.1 GCA025447255_00047 CDS open 51947-52114 _na     55_aa hypothetical protein
112 JAOEJK010000001.1 GCA025447255_00048 CDS open 52088-54160 _na     690_aa cscC Cell surface protein CscC family
113 JAOEJK010000001.1 GCA025447255_00049 CDS open 54641-54934 _na     97_aa Mor transcription activator domain-containing protein
114 JAOEJK010000001.1 GCA025447255_00050 CDS open 54959-55951 _na     330_aa nlpC NlpC/P60 domain-containing protein
115 JAOEJK010000001.1 GCA025447255_00051 CDS open 56264-57601 _na     445_aa araJ MFS transporter
116 JAOEJK010000001.1 GCA025447255_00052 CDS open 57681-58283 _na     200_aa ywnB NAD dependent epimerase/dehydratase family protein
117 JAOEJK010000001.1 GCA025447255_00053 CDS open 58434-59696 _na     420_aa ISL3 family transposase
118 JAOEJK010000001.1 GCA025447255_00054 CDS open 59815-61314 _na     499_aa abc-f ribosomal protection-like ABC-F family protein
119 JAOEJK010000001.1 GCA025447255_00055 CDS open 61569-62171 _na     200_aa acrR TetR family transcriptional regulator
120 JAOEJK010000001.1 GCA025447255_00056 CDS open 62288-63763 _na     491_aa araJ DHA2 family efflux MFS transporter permease subunit
121 JAOEJK010000001.1 GCA025447255_00057 CDS open 63897-64514 _na     205_aa argO Translocator protein%2C LysE family
122 JAOEJK010000001.1 GCA025447255_00058 CDS open 64708-65139 _na     143_aa marR MarR family transcriptional regulator
123 JAOEJK010000001.1 GCA025447255_00059 CDS open 65266-66219 _na     317_aa aes Esterase/lipase
124 JAOEJK010000001.1 GCA025447255_00060 CDS open 66346-67290 _na     314_aa draG ADP-ribosylglycohydrolase
125 JAOEJK010000001.1 GCA025447255_00061 CDS open 67290-67886 _na     198_aa wbbJ Acetyltransferase
126 JAOEJK010000001.1 GCA025447255_00062 CDS open 67995-68309 _na     104_aa hypothetical protein
127 JAOEJK010000001.1 GCA025447255_00063 CDS open 68349-68921 _na     190_aa cadD Cadmium resistance transporter family protein
128 JAOEJK010000001.1 GCA025447255_00064 CDS open 69010-69441 _na     143_aa Acetyltransferase%2C GNAT family
129 JAOEJK010000001.1 GCA025447255_00065 CDS open 69484-69996 _na     170_aa gtrA GtrA family protein
130 JAOEJK010000001.1 GCA025447255_00066 CDS open 70220-71860 _na     546_aa oppA ABC-type oligopeptide transport system%2C periplasmic component
131 JAOEJK010000001.1 GCA025447255_00067 CDS open 72557-73192 _na     211_aa acrR HTH tetR-type domain-containing protein
132 JAOEJK010000001.1 GCA025447255_00068 CDS open 73332-74606 _na     424_aa yhgE ABC-2 type transporter transmembrane domain-containing protein
133 JAOEJK010000001.1 GCA025447255_00069 CDS open 74670-75518 _na     282_aa hflC Membrane protease subunit%2C stomatin/prohibitin family
134 JAOEJK010000001.1 GCA025447255_00070 CDS open 75532-75861 _na     109_aa hicB Toxin-antitoxin system HicB family antitoxin
135 JAOEJK010000001.1 GCA025447255_00071 CDS open 75959-76696 _na     245_aa MucBP domain-containing protein
136 JAOEJK010000001.1 GCA025447255_00072 CDS open 77006-77572 _na     188_aa Nucleotidyltransferase family protein
137 JAOEJK010000001.1 GCA025447255_00073 CDS open 77689-78192 _na     167_aa DUF2798 domain-containing protein
138 JAOEJK010000001.1 GCA025447255_00074 CDS open 78279-78644 _na     121_aa paaI Thioesterase domain-containing protein
139 JAOEJK010000001.1 GCA025447255_00075 CDS open 78677-79498 _na     273_aa menB 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
140 JAOEJK010000001.1 GCA025447255_00076 CDS open 79514-80947 _na     477_aa menE o-succinylbenzoate--CoA ligase
141 JAOEJK010000001.1 GCA025447255_00077 CDS open 81012-81554 _na     180_aa DUF1097 domain-containing protein
142 JAOEJK010000001.1 GCA025447255_00078 CDS open 81757-82701 _na     314_aa hypothetical protein
143 JAOEJK010000001.1 GCA025447255_00079 CDS open 82761-84275 _na     504_aa murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
144 JAOEJK010000001.1 GCA025447255_00080 CDS open 84296-85804 _na     502_aa lysS lysine--tRNA ligase
145 JAOEJK010000001.1 GCA025447255_00081 CDS open 86065-86436 _na     123_aa tnp IS5 family transposase ORF A
146 JAOEJK010000001.1 GCA025447255_00082 CDS open 86409-86840 _na     143_aa tnp IS5 family ISLpl3 transposase
147 JAOEJK010000001.1 GCA025447255_00083 CDS open 86873-88054 _na     393_aa araJ Permease of the major facilitator superfamily
148 JAOEJK010000001.1 GCA025447255_00086 CDS open 88457-89209 _na     250_aa yqjQ Oxidoreductase%2C short chain dehydrogenase/reductase family protein
149 JAOEJK010000001.1 GCA025447255_00087 CDS open 89260-89817 _na     185_aa HTH tetR-type domain-containing protein
150 JAOEJK010000001.1 GCA025447255_00088 CDS open 89977-90612 _na     211_aa ywnB NAD(P)-binding domain-containing protein
151 JAOEJK010000001.1 GCA025447255_00089 CDS open 90886-91476 _na     196_aa acrR Transcriptional regulator
152 JAOEJK010000001.1 GCA025447255_00090 CDS open 91670-93175 _na     501_aa potE Glutamate/GABA antiporter
153 JAOEJK010000001.1 GCA025447255_00091 CDS open 93261-94670 _na     469_aa gadA glutamate decarboxylase
154 JAOEJK010000001.1 GCA025447255_00092 CDS open 94731-96242 _na     503_aa gltX glutamate--tRNA ligase
155 JAOEJK010000001.1 GCA025447255_00093 CDS open 96421-97335 _na     304_aa Regulatory protein YycH-like domain-containing protein
156 JAOEJK010000001.1 GCA025447255_00097 CDS open 102994-104280 _na     428_aa gltP Na+/H+-dicarboxylate symporter
157 JAOEJK010000001.1 GCA025447255_00098 CDS open 105372-105935 _na     187_aa ahpC Peroxiredoxin
158 JAOEJK010000001.1 GCA025447255_00099 CDS open 106042-106389 _na     115_aa hypothetical protein
159 JAOEJK010000001.1 GCA025447255_00100 CDS open 106553-107194 _na     213_aa wcaG putative nucleoside-diphosphate-sugar epimerase
160 JAOEJK010000001.1 GCA025447255_00101 CDS open 107286-107549 _na     87_aa hypothetical protein
161 JAOEJK010000001.1 GCA025447255_00102 CDS open 107714-108355 _na     213_aa hipB Transcriptional regulator%2C contains XRE-family HTH domain
162 JAOEJK010000001.1 GCA025447255_00103 CDS open 108505-108711 _na     68_aa hypothetical protein
163 JAOEJK010000001.1 GCA025447255_00104 CDS open 109174-109362 _na     62_aa hypothetical protein
164 JAOEJK010000001.1 GCA025447255_00105 CDS open 109529-110971 _na     480_aa gndA NADP-dependent phosphogluconate dehydrogenase
165 JAOEJK010000001.1 GCA025447255_00106 CDS open 111116-111544 _na     142_aa marR Transcriptional regulator
166 JAOEJK010000001.1 GCA025447255_00107 CDS open 111797-112066 _na     89_aa GNAT family N-acetyltransferase
167 JAOEJK010000001.1 GCA025447255_00108 CDS open 112354-113838 _na     494_aa DUF5776 domain-containing protein
168 JAOEJK010000001.1 GCA025447255_00109 CDS open 114016-115503 _na     495_aa zwf glucose-6-phosphate dehydrogenase
169 JAOEJK010000001.1 GCA025447255_00110 CDS open 115964-116785 _na     273_aa yokD Aminoglycoside N(3)-acetyltransferase
170 JAOEJK010000001.1 GCA025447255_00111 CDS open 117472-118047 _na     191_aa acrR Transcriptional regulator%2C TetR family
171 JAOEJK010000001.1 GCA025447255_00112 CDS open 118117-119544 _na     475_aa adhE Aldehyde dehydrogenase
172 JAOEJK010000001.1 GCA025447255_00113 CDS open 119646-120488 _na     280_aa pdxI Aryl-alcohol dehydrogenase related enzyme
173 JAOEJK010000001.1 GCA025447255_00114 CDS open 120728-121543 _na     271_aa Bacterial Ig domain-containing protein
174 JAOEJK010000001.1 GCA025447255_00115 CDS open 121794-122960 _na     388_aa araJ Permease of the major facilitator superfamily
175 JAOEJK010000001.1 GCA025447255_00116 CDS open 123118-124464 _na     448_aa uhpC Glycerol-3-phosphatase transporter
176 JAOEJK010000001.1 GCA025447255_00117 CDS open 124555-125169 _na     204_aa ywnB NAD(P)-binding domain-containing protein
177 JAOEJK010000001.1 GCA025447255_00118 CDS open 125273-126742 _na     489_aa araJ MFS-type drug efflux transporter P55
178 JAOEJK010000001.1 GCA025447255_00119 CDS open 126907-127566 _na     219_aa acrR Transcriptional regulator%2C TetR family
179 JAOEJK010000001.1 GCA025447255_00120 CDS open 127715-128461 _na     248_aa nfnB Nitroreductase
180 JAOEJK010000001.1 GCA025447255_00121 CDS open 128458-128931 _na     157_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
181 JAOEJK010000001.1 GCA025447255_00122 CDS open 129263-130783 _na     506_aa uup ATPase component of ABC transporter with duplicated ATPase domains
182 JAOEJK010000001.1 GCA025447255_00123 CDS open 130882-132315 _na     477_aa araJ Permease of the major facilitator superfamily
183 JAOEJK010000001.1 GCA025447255_00124 CDS open 132485-132664 _na     59_aa hypothetical protein
184 JAOEJK010000001.1 GCA025447255_00125 CDS open 132824-133597 _na     257_aa fabG 2-deoxy-D-gluconate 3-dehydrogenase
185 JAOEJK010000001.1 GCA025447255_00126 CDS open 133660-134628 _na     322_aa purR Transcriptional regulator%2C LacI family
186 JAOEJK010000001.1 GCA025447255_00127 CDS open 134631-135182 _na     183_aa acrR TetR/AcrR family transcriptional regulator
187 JAOEJK010000001.1 GCA025447255_00128 CDS open 135304-136095 _na     263_aa yqjQ Short-chain dehydrogenase-reductase SDR
188 JAOEJK010000001.1 GCA025447255_00129 CDS open 136158-137513 _na     451_aa mpfA CBS domain protein
189 JAOEJK010000001.1 GCA025447255_00130 CDS open 137721-138077 _na     118_aa Phage protein
190 JAOEJK010000001.1 GCA025447255_00131 CDS open 138357-138782 _na     141_aa ibpA Molecular chaperone (Small heat shock protein)
191 JAOEJK010000001.1 GCA025447255_00132 CDS open 138997-140475 _na     492_aa yjeM glutamate/gamma-aminobutyrate family transporter YjeM
192 JAOEJK010000001.1 GCA025447255_00133 CDS open 140663-141511 _na     282_aa aRA1 Aldo/keto reductase of diketogulonate reductase family
193 JAOEJK010000001.1 GCA025447255_00134 CDS open 141580-141738 _na     52_aa Lipoprotein
194 JAOEJK010000001.1 GCA025447255_00135 CDS open 141976-144312 _na     778_aa mgtA Cation transport ATPase
195 JAOEJK010000001.1 GCA025447255_00136 CDS open 144401-144925 _na     174_aa BS_ykrK family protein
196 JAOEJK010000001.1 GCA025447255_00137 CDS open 144980-146773 _na     597_aa ugpQ1 Membrane domain of membrane-anchored glycerophosphoryl diester phosphodiesterase
197 JAOEJK010000001.1 GCA025447255_00138 CDS open 147134-149752 _na     872_aa adhE bifunctional acetaldehyde-CoA/alcohol dehydrogenase
198 JAOEJK010000001.1 GCA025447255_00139 CDS open 150233-150808 _na     191_aa lysM LysM domain protein
199 JAOEJK010000001.1 GCA025447255_00140 CDS open 151253-153850 _na     865_aa yopM MucBP domain-containing protein
200 JAOEJK010000001.1 GCA025447255_00141 CDS open 154262-154912 _na     216_aa lysM Aggregation promoting factrelated surface protein
201 JAOEJK010000001.1 GCA025447255_00142 CDS open 154958-155065 _na     35_aa hypothetical protein
202 JAOEJK010000001.1 GCA025447255_00143 CDS open 155135-155485 _na     116_aa Aggregation promoting factrelated surface protein
203 JAOEJK010000001.1 GCA025447255_00144 CDS open 155558-156679 _na     373_aa yesR Glycoside hydrolase family 88 protein
204 JAOEJK010000001.1 GCA025447255_00145 CDS open 156700-158238 _na     512_aa melB MFS transporter
205 JAOEJK010000001.1 GCA025447255_00146 CDS open 158283-159125 _na     280_aa ycjR Sugar phosphate isomerase/epimerase
206 JAOEJK010000001.1 GCA025447255_00147 CDS open 159414-160691 _na     425_aa pgu1 Glycoside hydrolase family 28 protein
207 JAOEJK010000001.1 GCA025447255_00148 CDS open 160748-160999 _na     83_aa hypothetical protein
208 JAOEJK010000001.1 GCA025447255_00149 CDS open 161251-161802 _na     183_aa acrR Transcriptional regulator%2C TetR family
209 JAOEJK010000001.1 GCA025447255_00150 CDS open 161935-162780 _na     281_aa kduI 5-dehydro-4-deoxy-D-glucuronate isomerase
210 JAOEJK010000001.1 GCA025447255_00151 CDS open 162798-163778 _na     326_aa rbsK 2-dehydro-3-deoxygluconokinase
211 JAOEJK010000001.1 GCA025447255_00152 CDS open 163903-165090 _na     395_aa ackA Acetate kinase
212 JAOEJK010000001.1 GCA025447255_00153 CDS open 165376-165873 _na     165_aa 3D domain protein
213 JAOEJK010000001.1 GCA025447255_00154 CDS open 165926-167548 _na     540_aa nodJ Exporter of polyketide antibiotics
214 JAOEJK010000001.1 GCA025447255_00155 CDS open 167554-168447 _na     297_aa rbbA ABC-type multidrug transport system%2C ATPase component
215 JAOEJK010000001.1 GCA025447255_00156 CDS open 168616-169272 _na     218_aa rnaY putative HD superfamily hydrolase
216 JAOEJK010000001.1 GCA025447255_00157 CDS open 169285-170622 _na     445_aa norM Na+-driven multidrug efflux pump
217 JAOEJK010000001.1 GCA025447255_00158 CDS open 170721-172148 _na     475_aa uxaC glucuronate isomerase
218 JAOEJK010000001.1 GCA025447255_00159 CDS open 172221-173639 _na     472_aa melB Na+/xyloside symporter related transporter
219 JAOEJK010000001.1 GCA025447255_00160 CDS open 173998-176493 _na     831_aa yicI Alpha-glucosidase%2C family 31 of glycosyl hydrolase
220 JAOEJK010000001.1 GCA025447255_00161 CDS open 176590-178401 _na     603_aa uidA beta-glucuronidase
221 JAOEJK010000001.1 GCA025447255_00162 CDS open 178830-180467 _na     545_aa mtlD Fructuronate reductase
222 JAOEJK010000001.1 GCA025447255_00163 CDS open 180485-181363 _na     292_aa galM Galactose mutarotase related enzyme
223 JAOEJK010000001.1 GCA025447255_00164 CDS open 181384-182046 _na     220_aa phoE Phosphoglycerate mutase family protein
224 JAOEJK010000001.1 GCA025447255_00165 CDS open 182081-183073 _na     330_aa serA 2-hydroxyacid dehydrogenase
225 JAOEJK010000001.1 GCA025447255_00166 CDS open 183169-184710 _na     513_aa gntK gluconokinase
226 JAOEJK010000001.1 GCA025447255_00167 CDS open 185176-186078 _na     300_aa gnd phosphogluconate dehydrogenase (NAD(+)-dependent%2C decarboxylating)
227 JAOEJK010000001.1 GCA025447255_00168 CDS open 186221-186916 _na     231_aa gntR Transcriptional regulator%2C GntR family
228 JAOEJK010000001.1 GCA025447255_00169 CDS open 186955-188025 _na     356_aa uxuA mannonate dehydratase
229 JAOEJK010000001.1 GCA025447255_00170 CDS open 188100-189107 _na     335_aa purR Transcriptional regulator
230 JAOEJK010000001.1 GCA025447255_00171 CDS open 189343-190821 _na     492_aa melB Na+/xyloside symporter related transporter
231 JAOEJK010000001.1 GCA025447255_00172 CDS open 190877-192457 _na     526_aa Tagaturonate/fructuronate epimerase
232 JAOEJK010000001.1 GCA025447255_00173 CDS open 192496-193956 _na     486_aa uxaC glucuronate isomerase
233 JAOEJK010000001.1 GCA025447255_00174 CDS open 194265-195506 _na     413_aa Siderophore/Surfactin synthetase related protein
234 JAOEJK010000001.1 GCA025447255_00175 CDS open 195577-195759 _na     60_aa hypothetical protein
235 JAOEJK010000001.1 GCA025447255_00176 CDS open 196002-197396 _na     464_aa araJ Lincomycin resistance protein lmrB
236 JAOEJK010000001.1 GCA025447255_00177 CDS open 197479-198006 _na     175_aa DUF805 domain-containing protein
237 JAOEJK010000001.1 GCA025447255_00178 CDS open 198009-198197 _na     62_aa xRE DNA-binding helix-turn-helix protein
238 JAOEJK010000001.1 GCA025447255_00179 CDS open 198707-200728 _na     673_aa DUF5776 domain-containing protein
239 JAOEJK010000001.1 GCA025447255_00180 CDS open 200784-201587 _na     267_aa Integral membrane protein
240 JAOEJK010000001.1 GCA025447255_00181 CDS open 201591-202094 _na     167_aa ybaK Cys-tRNA(Pro) deacylase
241 JAOEJK010000001.1 GCA025447255_00182 CDS open 202240-202965 _na     241_aa mngR Transcriptional regulator%2C GntR family
242 JAOEJK010000001.1 GCA025447255_00183 CDS open 203088-203759 _na     223_aa Matrixin
243 JAOEJK010000001.1 GCA025447255_00184 CDS open 203831-204313 _na     160_aa greA transcription elongation factor GreA
244 JAOEJK010000001.1 GCA025447255_00185 CDS open 204387-204809 _na     140_aa DUF3899 domain-containing protein
245 JAOEJK010000001.1 GCA025447255_00186 CDS open 205318-206073 _na     251_aa lytT Response regulator of the LytR/AlgR family
246 JAOEJK010000001.1 GCA025447255_00187 CDS open 206088-207413 _na     441_aa yesM ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein
247 JAOEJK010000001.1 GCA025447255_00188 CDS open 207410-208756 _na     448_aa Signal transduction protein
248 JAOEJK010000001.1 GCA025447255_00189 CDS open 209294-210034 _na     246_aa fabG Glucose 1-dehydrogenase
249 JAOEJK010000001.1 GCA025447255_00190 CDS open 210083-210172 _na     29_aa hypothetical protein
250 JAOEJK010000001.1 GCA025447255_00191 CDS open 210266-211153 _na     295_aa rluA Pseudouridylate synthase%2C 23S RNA-specific
251 JAOEJK010000001.1 GCA025447255_00192 CDS open 211245-211700 _na     151_aa uspA Universal stress protein
252 JAOEJK010000001.1 GCA025447255_00193 CDS open 211886-212536 _na     216_aa fieF Cation diffusion facilitator family transporter
253 JAOEJK010000001.1 GCA025447255_00194 CDS open 212543-214258 _na     571_aa araJ Major facilitator superfamily (MFS) profile domain-containing protein
254 JAOEJK010000001.1 GCA025447255_00195 CDS open 214350-214883 _na     177_aa HTH tetR-type domain-containing protein
255 JAOEJK010000001.1 GCA025447255_00196 CDS open 214949-216772 _na     607_aa ddpA ABC-type oligopeptide transport system%2C periplasmic component
256 JAOEJK010000001.1 GCA025447255_00197 CDS open 216893-217843 _na     316_aa dppC ABC-type dipeptide/oligopeptide/nickel transport system%2C permease component
257 JAOEJK010000001.1 GCA025447255_00198 CDS open 217859-218818 _na     319_aa dppB ABC-type dipeptide/oligopeptide/nickel transport system%2C permease component
258 JAOEJK010000001.1 GCA025447255_00199 CDS open 218818-219792 _na     324_aa yejF ABC-type oligopeptide transport system%2C ATPase component
259 JAOEJK010000001.1 GCA025447255_00200 CDS open 219789-220802 _na     337_aa dppD ABC-type dipeptide/oligopeptide/nickel transport system%2C ATPase component
260 JAOEJK010000001.1 GCA025447255_00201 CDS open 221241-221705 _na     154_aa iscR Transcriptional regulator
261 JAOEJK010000001.1 GCA025447255_00202 CDS open 222029-223042 _na     337_aa lplA lipoate--protein ligase
262 JAOEJK010000001.1 GCA025447255_00203 CDS open 223174-223593 _na     139_aa Integral membrane protein
263 JAOEJK010000001.1 GCA025447255_00204 CDS open 223608-224087 _na     159_aa hypothetical protein
264 JAOEJK010000001.1 GCA025447255_00206 CDS open 224737-225546 _na     269_aa hypothetical protein
265 JAOEJK010000001.1 GCA025447255_00207 CDS open 225730-225825 _na     31_aa hypothetical protein
266 JAOEJK010000001.1 GCA025447255_00208 CDS open 226058-227407 _na     449_aa xylA xylose isomerase
267 JAOEJK010000001.1 GCA025447255_00209 CDS open 227511-229019 _na     502_aa xylB xylulokinase
268 JAOEJK010000001.1 GCA025447255_00210 CDS open 229230-230603 _na     457_aa xylT D-xylose transporter
269 JAOEJK010000001.1 GCA025447255_00211 CDS open 230771-231550 _na     259_aa fabG (S)-acetoin forming diacetyl reductase
270 JAOEJK010000001.1 GCA025447255_00212 CDS open 231888-232262 _na     124_aa fra YdhG-like domain-containing protein
271 JAOEJK010000001.1 GCA025447255_00213 CDS open 232287-234848 _na     853_aa yfhO Integral membrane protein
272 JAOEJK010000001.1 GCA025447255_00214 CDS open 234921-235442 _na     173_aa uspA Nucleotide-binding protein%2C UspA family
273 JAOEJK010000001.1 GCA025447255_00215 CDS open 235463-235972 _na     169_aa ybhB YbhB/YbcL family Raf kinase inhibitor-like protein
274 JAOEJK010000001.1 GCA025447255_00216 CDS open 236167-237339 _na     390_aa argE putative succinyl-diaminopimelate desuccinylase
275 JAOEJK010000001.1 GCA025447255_00217 CDS open 237430-238185 _na     251_aa Kef-type K+ transport system%2C putative NAD-binding component
276 JAOEJK010000001.1 GCA025447255_00218 CDS open 238239-238862 _na     207_aa Streptococcal hemagglutinin protein
277 JAOEJK010000001.1 GCA025447255_00219 CDS open 239067-239930 _na     287_aa aRA1 Aldo/keto reductase of diketogulonate reductase family
278 JAOEJK010000001.1 GCA025447255_00220 CDS open 239932-240321 _na     129_aa hypothetical protein
279 JAOEJK010000001.1 GCA025447255_00221 CDS open 240491-241024 _na     177_aa yhbS putative acetyltransferase
280 JAOEJK010000001.1 GCA025447255_00222 CDS open 241390-242832 _na     480_aa nhaC Na+/H+ antiporter NhaC
281 JAOEJK010000001.1 GCA025447255_00223 CDS open 243086-244159 _na     357_aa yfdV Auxin efflux carrier (AEC) family permease
282 JAOEJK010000001.1 GCA025447255_00224 CDS open 244179-245180 _na     333_aa ldhA Lactate dehydrogenase
283 JAOEJK010000001.1 GCA025447255_00225 CDS open 245300-246892 _na     530_aa citA Histidine kinase domain-containing protein
284 JAOEJK010000001.1 GCA025447255_00226 CDS open 246889-247605 _na     238_aa citB Transcriptional regulatory protein
285 JAOEJK010000001.1 GCA025447255_00227 CDS open 247668-249002 _na     444_aa yhgE ABC-2 type transporter transmembrane domain-containing protein
286 JAOEJK010000001.1 GCA025447255_00228 CDS open 249130-249747 _na     205_aa acrR Transcriptional regulator
287 JAOEJK010000001.1 GCA025447255_00229 CDS open 249811-250467 _na     218_aa eAL C-di-GMP-specific phosphodiesterase
288 JAOEJK010000001.1 GCA025447255_00230 CDS open 250854-251378 _na     174_aa Acetyltransferase%2C GNAT family
289 JAOEJK010000001.1 GCA025447255_00231 CDS open 251794-252258 _na     154_aa yjhB Hydrolase%2C NUDIX family
290 JAOEJK010000001.1 GCA025447255_00232 CDS open 252320-252514 _na     64_aa hypothetical protein
291 JAOEJK010000001.1 GCA025447255_00233 CDS open 252703-253239 _na     178_aa padC Phenolic acid decarboxylase
292 JAOEJK010000001.1 GCA025447255_00234 CDS open 253433-253933 _na     166_aa padR Transcriptional regulator%2C PadR family
293 JAOEJK010000001.1 GCA025447255_00235 CDS open 254040-254606 _na     188_aa Transcriptional regulator
294 JAOEJK010000001.1 GCA025447255_00236 CDS open 254721-255755 _na     344_aa wcaG NAD-dependent epimerase/dehydratase domain-containing protein
295 JAOEJK010000001.1 GCA025447255_00237 CDS open 255835-256278 _na     147_aa elaA Acetyltransferase%2C GNAT family
296 JAOEJK010000001.1 GCA025447255_00238 CDS open 256271-256723 _na     150_aa marR Transcriptional regulator%2C MarR family
297 JAOEJK010000001.1 GCA025447255_00239 CDS open 257695-258114 _na     139_aa Integral membrane protein
298 JAOEJK010000001.1 GCA025447255_00240 CDS open 258234-258785 _na     183_aa DUF3290 domain-containing protein
299 JAOEJK010000001.1 GCA025447255_00241 CDS open 259065-259631 _na     188_aa cadD Integral membrane protein
300 JAOEJK010000001.1 GCA025447255_00242 CDS open 259649-260299 _na     216_aa mntR Mn-dependent transcriptional regulator
301 JAOEJK010000001.1 GCA025447255_00243 CDS open 260386-260823 _na     145_aa uspA UspA domain-containing protein
302 JAOEJK010000001.1 GCA025447255_00244 CDS open 261236-262810 _na     524_aa mntH Nramp family divalent metal transporter
303 JAOEJK010000001.1 GCA025447255_00245 CDS open 263139-265274 _na     711_aa WxL domain-containing protein
304 JAOEJK010000001.1 GCA025447255_00246 CDS open 265336-266322 _na     328_aa guaC GMP reductase
305 JAOEJK010000001.1 GCA025447255_00247 CDS open 266347-267633 _na     428_aa purA adenylosuccinate synthase
306 JAOEJK010000001.1 GCA025447255_00248 CDS open 267907-269205 _na     432_aa purB adenylosuccinate lyase
307 JAOEJK010000001.1 GCA025447255_00249 CDS open 269609-270184 _na     191_aa wcaG NAD-dependent epimerase/dehydratase family protein
308 JAOEJK010000001.1 GCA025447255_00250 CDS open 270213-271625 _na     470_aa adhE Putative succinate-semialdehyde dehydrogenase
309 JAOEJK010000001.1 GCA025447255_00251 CDS open 271739-272653 _na     304_aa ybjT NmrA family protein
310 JAOEJK010000001.1 GCA025447255_00252 CDS open 272778-273356 _na     192_aa acrR Transcriptional regulator
311 JAOEJK010000001.1 GCA025447255_00253 CDS open 273718-274650 _na     310_aa frsA Hydrolase of the alpha/beta superfamily
312 JAOEJK010000001.1 GCA025447255_00254 CDS open 274729-275550 _na     273_aa oca4 Protein tyrosine phosphatase
313 JAOEJK010000001.1 GCA025447255_00255 CDS open 275699-276583 _na     294_aa aes Esterase/lipase
314 JAOEJK010000001.1 GCA025447255_00256 CDS open 276745-278586 _na     613_aa putative protease
315 JAOEJK010000001.1 GCA025447255_00257 CDS open 278636-279286 _na     216_aa yczE Sugar specific permease
316 JAOEJK010000001.1 GCA025447255_00258 CDS open 279377-280111 _na     244_aa puuD putative glutamine amidotransferase
317 JAOEJK010000001.1 GCA025447255_00259 CDS open 280273-280524 _na     83_aa hypothetical protein
318 JAOEJK010000001.1 GCA025447255_00260 CDS open 280636-281283 _na     215_aa hP0602 DNA-3-methyladenine glycosylase III
319 JAOEJK010000001.1 GCA025447255_00261 CDS open 281416-282930 _na     504_aa glpK glycerol kinase GlpK
320 JAOEJK010000001.1 GCA025447255_00262 CDS open 283054-284088 _na     344_aa nlpC NlpC/P60 domain-containing protein
321 JAOEJK010000001.1 GCA025447255_00263 CDS open 284106-284978 _na     290_aa yvpB GW domain-containing protein
322 JAOEJK010000001.1 GCA025447255_00264 CDS open 285155-287377 _na     740_aa bglX Glycosyl hydrolase family 3 protein
323 JAOEJK010000001.1 GCA025447255_00265 CDS open 287551-288420 _na     289_aa araC HTH araC/xylS-type domain-containing protein
324 JAOEJK010000001.1 GCA025447255_00266 CDS open 288550-290541 _na     663_aa ganA Beta-galactosidase
325 JAOEJK010000001.1 GCA025447255_00267 CDS open 290556-291824 _na     422_aa uhpC Facilitator Transporter
326 JAOEJK010000001.1 GCA025447255_00268 CDS open 291870-293204 _na     444_aa xynC O-Glycosyl hydrolase family 30
327 JAOEJK010000001.1 GCA025447255_00269 CDS open 293252-293803 _na     183_aa pncA Amidase
328 JAOEJK010000001.1 GCA025447255_00270 CDS open 293974-294291 _na     105_aa padR Transcriptional regulator%2C PadR family
329 JAOEJK010000001.1 GCA025447255_00271 CDS open 294284-294922 _na     212_aa DUF1700 domain-containing protein
330 JAOEJK010000001.1 GCA025447255_00272 CDS open 294952-295893 _na     313_aa DUF4097 domain-containing protein
331 JAOEJK010000001.1 GCA025447255_00273 CDS open 296048-297043 _na     331_aa dusA tRNA-dihydrouridine synthase
332 JAOEJK010000001.1 GCA025447255_00274 CDS open 297190-298389 _na     399_aa trans-2-enoyl-CoA reductase (NAD(+))
333 JAOEJK010000001.1 GCA025447255_00275 CDS open 298613-299056 _na     147_aa fldA Flavodoxin
334 JAOEJK010000001.1 GCA025447255_00276 CDS open 299084-299608 _na     174_aa rimI Acetyltransferase%2C GNAT family
335 JAOEJK010000001.1 GCA025447255_00277 CDS open 300252-301592 _na     446_aa ansP Amino acid transporter
336 JAOEJK010000001.1 GCA025447255_00278 CDS open 301607-302269 _na     220_aa hypothetical protein
337 JAOEJK010000001.1 GCA025447255_00279 CDS open 302420-303028 _na     202_aa WxL domain-containing protein
338 JAOEJK010000001.1 GCA025447255_00280 CDS open 303025-305091 _na     688_aa WxL domain-containing protein
339 JAOEJK010000001.1 GCA025447255_00281 CDS open 305150-306385 _na     411_aa argE Acetylornithine deacetylase
340 JAOEJK010000001.1 GCA025447255_00282 CDS open 306755-307765 _na     336_aa adhP alcohol dehydrogenase AdhP
341 JAOEJK010000001.1 GCA025447255_00283 CDS open 307894-308310 _na     138_aa lrp Transcriptional regulator%2C AsnC family
342 JAOEJK010000001.1 GCA025447255_00284 CDS open 308517-309446 _na     309_aa opuBA ABC-type proline/glycine betaine transport system%2C ATPase component
343 JAOEJK010000001.1 GCA025447255_00285 CDS open 309448-310968 _na     506_aa osmF ABC-type proline/glycine betaine transport system%2C permease and substrate binding protein
344 JAOEJK010000001.1 GCA025447255_00286 CDS open 311345-312469 _na     374_aa metE vitamin B12 independent methionine synthase
345 JAOEJK010000001.1 GCA025447255_00287 CDS open 312531-313085 _na     184_aa ssuE putative flavoprotein
346 JAOEJK010000001.1 GCA025447255_00288 CDS open 313115-313609 _na     164_aa marR Transcriptional regulator
347 JAOEJK010000001.1 GCA025447255_00289 CDS open 314248-316995 _na     915_aa mgtA Cation transport ATPase
348 JAOEJK010000001.1 GCA025447255_00290 CDS open 317259-317486 _na     75_aa hypothetical protein
349 JAOEJK010000001.1 GCA025447255_00291 CDS open 317774-319195 _na     473_aa pepD C69 family dipeptidase
350 JAOEJK010000001.1 GCA025447255_00292 CDS open 319230-320225 _na     331_aa GW domain-containing protein
351 JAOEJK010000001.1 GCA025447255_00293 CDS open 320425-320997 _na     190_aa wbbJ Galactoside O-acetyltransferase
352 JAOEJK010000001.1 GCA025447255_00294 CDS open 321288-321935 _na     215_aa Elongation factor G-binding protein
353 JAOEJK010000001.1 GCA025447255_00295 CDS open 322203-323144 _na     313_aa rhaT Permease of the drug/metabolite transporter (DMT) superfamily
354 JAOEJK010000001.1 GCA025447255_00296 CDS open 323241-325313 _na     690_aa zntA P-type Cu(+) transporter
355 JAOEJK010000001.1 GCA025447255_00297 CDS open 325310-325756 _na     148_aa copY CopY/TcrY family copper transport repressor
356 JAOEJK010000001.1 GCA025447255_00298 CDS open 326000-327271 _na     423_aa dacC D-alanyl-D-alanine carboxypeptidase
357 JAOEJK010000001.1 GCA025447255_00299 CDS open 327395-328240 _na     281_aa aRA1 Aldo/keto reductase of diketogulonate reductase family
358 JAOEJK010000001.1 GCA025447255_00300 CDS open 328343-330268 _na     641_aa zntA P-type Cu(+) transporter
359 JAOEJK010000001.1 GCA025447255_00301 CDS open 330286-330657 _na     123_aa EfeO-type cupredoxin-like domain-containing protein
360 JAOEJK010000001.1 GCA025447255_00302 CDS open 330969-331061 _na     30_aa hypothetical protein
361 JAOEJK010000001.1 GCA025447255_00303 CDS open 331208-332056 _na     282_aa pgaB putative xylanase/chitin deacetylase
362 JAOEJK010000001.1 GCA025447255_00304 CDS open 332110-332934 _na     274_aa xerD Site-specific recombinase XerD
363 JAOEJK010000001.1 GCA025447255_00305 CDS open 333057-334100 _na     347_aa add adenosine deaminase
364 JAOEJK010000001.1 GCA025447255_00306 CDS open 334571-336511 _na     646_aa oafA putative acyltransferase
365 JAOEJK010000001.1 GCA025447255_00307 CDS open 336737-337489 _na     250_aa D-alanyl-D-alanine carboxypeptidase
366 JAOEJK010000001.1 GCA025447255_00308 CDS open 337717-339411 _na     564_aa oleate hydratase
367 JAOEJK010000001.1 GCA025447255_00309 CDS open 339501-340085 _na     194_aa lepB signal peptidase I
368 JAOEJK010000001.1 GCA025447255_00310 CDS open 340273-340665 _na     130_aa cdd cytidine deaminase
369 JAOEJK010000001.1 GCA025447255_00311 CDS open 341143-341382 _na     79_aa YolD-like protein
370 JAOEJK010000001.1 GCA025447255_00312 CDS open 341553-342176 _na     207_aa marR Transcriptional regulator%2C MarR family
371 JAOEJK010000001.1 GCA025447255_00313 CDS open 342342-343673 _na     443_aa melB Na+/xyloside symporter related transporter
372 JAOEJK010000001.1 GCA025447255_00314 CDS open 343692-344213 _na     173_aa yagU putative periplasmic/secreted protein
373 JAOEJK010000001.1 GCA025447255_00315 CDS open 344384-346660 _na     758_aa uvrA UvrABC system protein A
374 JAOEJK010000001.1 GCA025447255_00316 CDS open 346667-347056 _na     129_aa 4-oxalocrotonate tautomerase
375 JAOEJK010000001.1 GCA025447255_00317 CDS open 347176-348717 _na     513_aa hypothetical protein
376 JAOEJK010000001.1 GCA025447255_00318 CDS open 348786-350123 _na     445_aa Integral membrane protein
377 JAOEJK010000001.1 GCA025447255_00319 CDS open 350270-350932 _na     220_aa opuBB Glycine betaine/carnitine/choline ABC transporter%2C ATP-binding protein
378 JAOEJK010000001.1 GCA025447255_00320 CDS open 350934-351866 _na     310_aa osmF Periplasmic glycine betaine/choline-binding (Lipo)protein of an ABC-type transport system (Osmoprotectant binding protein)
379 JAOEJK010000001.1 GCA025447255_00321 CDS open 351877-352503 _na     208_aa opuBB Glycine betaine/carnitine/choline ABC transporter%2C permease protein
380 JAOEJK010000001.1 GCA025447255_00322 CDS open 352500-353705 _na     401_aa opuBA Quaternary amine transport ATP-binding protein
381 JAOEJK010000001.1 GCA025447255_00323 CDS open 354101-354580 _na     159_aa Flavoprotein domain-containing protein
382 JAOEJK010000001.1 GCA025447255_00324 CDS open 354615-355844 _na     409_aa araJ Permease of the major facilitator superfamily
383 JAOEJK010000001.1 GCA025447255_00325 CDS open 356152-357105 _na     317_aa efeB putative iron-dependent peroxidase
384 JAOEJK010000001.1 GCA025447255_00326 CDS open 357246-358412 _na     388_aa malY cysteine-S-conjugate beta-lyase
385 JAOEJK010000001.1 GCA025447255_00327 CDS open 358412-359269 _na     285_aa Hydrogenase
386 JAOEJK010000001.1 GCA025447255_00328 CDS open 359389-361437 _na     682_aa Integral membrane protein
387 JAOEJK010000001.1 GCA025447255_00329 CDS open 361449-362468 _na     339_aa wcaA Glycosyltransferase related enzyme
388 JAOEJK010000001.1 GCA025447255_00330 CDS open 362954-364303 _na     449_aa acm Glycosyl hydrolase family 25
389 JAOEJK010000001.1 GCA025447255_00331 CDS open 364316-364957 _na     213_aa Lipoprotein
390 JAOEJK010000001.1 GCA025447255_00332 CDS open 365259-366431 _na     390_aa perM ATP synthase F0%2C A subunit
391 JAOEJK010000001.1 GCA025447255_00333 CDS open 366600-368075 _na     491_aa lolE ABC transporter permease
392 JAOEJK010000001.1 GCA025447255_00334 CDS open 368088-368747 _na     219_aa lolD ABC-type antimicrobial peptide transport system%2C ATPase component
393 JAOEJK010000001.1 GCA025447255_00335 CDS open 368997-370634 _na     545_aa amyA Trehalose-6-phosphate hydrolase
394 JAOEJK010000001.1 GCA025447255_00336 CDS open 370864-371325 _na     153_aa marR Transcriptional regulator
395 JAOEJK010000001.1 GCA025447255_00337 CDS open 371641-372393 _na     250_aa pnuC nicotinamide riboside transporter PnuC
396 JAOEJK010000001.1 GCA025447255_00338 CDS open 372478-373395 _na     305_aa corA Mg2+ and Co2+ transporter
397 JAOEJK010000001.1 GCA025447255_00339 CDS open 373604-375364 _na     586_aa spxB pyruvate oxidase
398 JAOEJK010000001.1 GCA025447255_00340 CDS open 375627-376046 _na     139_aa Holin
399 JAOEJK010000001.1 GCA025447255_00341 CDS open 376159-376407 _na     82_aa hypothetical protein
400 JAOEJK010000001.1 GCA025447255_00342 CDS open 376499-377863 _na     454_aa baeS histidine kinase
401 JAOEJK010000001.1 GCA025447255_00343 CDS open 377853-378554 _na     233_aa ompR DNA-binding response regulator%2C OmpR family (Rec-wHTH domains)
402 JAOEJK010000001.1 GCA025447255_00344 CDS open 378730-379026 _na     98_aa Extracellular protein
403 JAOEJK010000001.1 GCA025447255_00345 CDS open 379230-379871 _na     213_aa wcaG putative nucleoside-diphosphate-sugar epimerase
404 JAOEJK010000001.1 GCA025447255_00346 CDS open 380211-381422 _na     403_aa ndh NADH dehydrogenase%2C FAD-containing subunit
405 JAOEJK010000001.1 GCA025447255_00347 CDS open 381722-382240 _na     172_aa adaB Methylated-DNA--protein-cysteine methyltransferase
406 JAOEJK010000001.1 GCA025447255_00348 CDS open 382536-383102 _na     188_aa acrR Transcriptional regulator
407 JAOEJK010000001.1 GCA025447255_00349 CDS open 383318-384733 _na     471_aa adhE NAD-dependent aldehyde dehydrogenase
408 JAOEJK010000001.1 GCA025447255_00350 CDS open 384781-385539 _na     252_aa iclR IclR family transcriptional regulator
409 JAOEJK010000001.1 GCA025447255_00351 CDS open 385663-386409 _na     248_aa AP endonuclease%2C family 2
410 JAOEJK010000001.1 GCA025447255_00352 CDS open 386548-386823 _na     91_aa hypothetical protein
411 JAOEJK010000001.1 GCA025447255_00353 CDS open 387001-387093 _na     30_aa hypothetical protein
412 JAOEJK010000001.1 GCA025447255_00354 CDS open 387174-388019 _na     281_aa kduI 5-dehydro-4-deoxy-D-glucuronate isomerase
413 JAOEJK010000001.1 GCA025447255_00355 CDS open 388038-388853 _na     271_aa kduD 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD
414 JAOEJK010000001.1 GCA025447255_00356 CDS open 388945-389955 _na     336_aa 2-keto-3-deoxygluconate permease
415 JAOEJK010000001.1 GCA025447255_00357 CDS open 389985-390947 _na     320_aa rbsK 2-dehydro-3-deoxygluconokinase
416 JAOEJK010000001.1 GCA025447255_00358 CDS open 390965-391618 _na     217_aa eda Bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase
417 JAOEJK010000001.1 GCA025447255_00359 CDS open 391673-392188 _na     171_aa hypothetical protein
418 JAOEJK010000001.1 GCA025447255_00360 CDS open 392427-393176 _na     249_aa fabG Glucose 1-dehydrogenase
419 JAOEJK010000001.1 GCA025447255_00361 CDS open 393286-394665 _na     459_aa mntH Nramp family divalent metal transporter
420 JAOEJK010000001.1 GCA025447255_00362 CDS open 395250-396104 _na     284_aa degV DegV family protein
421 JAOEJK010000001.1 GCA025447255_00363 CDS open 397229-397600 _na     123_aa tnp IS5 family transposase ORF A
422 JAOEJK010000001.1 GCA025447255_00364 CDS open 397573-398004 _na     143_aa tnp IS5 family ISLpl3 transposase
423 JAOEJK010000001.1 GCA025447255_00365 CDS open 398056-399465 _na     469_aa fadH2 putative NAD(FAD)-dependent dehydrogenase
424 JAOEJK010000001.1 GCA025447255_00366 CDS open 399584-399910 _na     108_aa trxA thioredoxin
425 JAOEJK010000001.1 GCA025447255_00367 CDS open 399910-400173 _na     87_aa frmR Metal-sensitive transcriptional regulator
426 JAOEJK010000001.1 GCA025447255_00368 CDS open 400247-400639 _na     130_aa crcB Fluoride-specific ion channel FluC
427 JAOEJK010000001.1 GCA025447255_00369 CDS open 400639-400995 _na     118_aa crcB Fluoride-specific ion channel FluC
428 JAOEJK010000001.1 GCA025447255_00370 CDS open 401070-401918 _na     282_aa Integral membrane protein
429 JAOEJK010000001.1 GCA025447255_00371 CDS open 402048-402902 _na     284_aa aes BD-FAE-like domain-containing protein
430 JAOEJK010000001.1 GCA025447255_00372 CDS open 403003-403476 _na     157_aa luxS S-ribosylhomocysteine lyase
431 JAOEJK010000001.1 GCA025447255_00373 CDS open 403575-404660 _na     361_aa Extracellular protein
432 JAOEJK010000001.1 GCA025447255_00374 CDS open 404859-406172 _na     437_aa celB Permease IIC component
433 JAOEJK010000001.1 GCA025447255_00375 CDS open 406162-407055 _na     297_aa Acyltransferase
434 JAOEJK010000001.1 GCA025447255_00376 CDS open 407080-407937 _na     285_aa lysR Fhu operon transcription regulator
435 JAOEJK010000001.1 GCA025447255_00377 CDS open 408265-409110 _na     281_aa tauE putative membrane transporter protein
436 JAOEJK010000001.1 GCA025447255_00378 CDS open 409110-409487 _na     125_aa putative membrane protein
437 JAOEJK010000001.1 GCA025447255_00379 CDS open 409540-410298 _na     252_aa fabG R-specific alcohol dehydrogenase
438 JAOEJK010000001.1 GCA025447255_00380 CDS open 410474-411709 _na     411_aa araJ Permease of the major facilitator superfamily
439 JAOEJK010000001.1 GCA025447255_00381 CDS open 411706-412377 _na     223_aa yjbM GTP pyrophosphokinase
440 JAOEJK010000001.1 GCA025447255_00382 CDS open 412453-412653 _na     66_aa DUF2929 domain-containing protein
441 JAOEJK010000001.1 GCA025447255_00383 CDS open 412895-414061 _na     388_aa kefB Kef-type K+ transport system%2C membrane component
442 JAOEJK010000001.1 GCA025447255_00384 CDS open 414156-414338 _na     60_aa Integral membrane protein
443 JAOEJK010000001.1 GCA025447255_00385 CDS open 414384-417104 _na     906_aa yfhO Integral membrane protein
444 JAOEJK010000001.1 GCA025447255_00386 CDS open 417369-418061 _na     230_aa ompR DNA-binding response regulator%2C OmpR family (Rec-wHTH domains)
445 JAOEJK010000001.1 GCA025447255_00387 CDS open 418051-419391 _na     446_aa walK histidine kinase
446 JAOEJK010000001.1 GCA025447255_00388 CDS open 419542-420507 _na     321_aa purR Transcriptional regulator%2C LacI family
447 JAOEJK010000001.1 GCA025447255_00389 CDS open 420708-422081 _na     457_aa melB Permease of the major facilitator superfamily
448 JAOEJK010000001.1 GCA025447255_00390 CDS open 422134-424404 _na     756_aa aTH1 maltose phosphorylase
449 JAOEJK010000001.1 GCA025447255_00391 CDS open 424460-424897 _na     145_aa hypothetical protein
450 JAOEJK010000001.1 GCA025447255_00392 CDS open 425022-425291 _na     89_aa rpsN 30S ribosomal protein S14
451 JAOEJK010000001.1 GCA025447255_00393 CDS open 425467-426498 _na     343_aa galM Maltose epimerase
452 JAOEJK010000001.1 GCA025447255_00394 CDS open 426768-427592 _na     274_aa Alpha/beta hydrolase superfamily protein
453 JAOEJK010000001.1 GCA025447255_00395 CDS open 427595-428413 _na     272_aa cof putative hydrolase of the HAD superfamily
454 JAOEJK010000001.1 GCA025447255_00396 CDS open 428661-429044 _na     127_aa marR Transcriptional regulator
455 JAOEJK010000001.1 GCA025447255_00397 CDS open 429193-431007 _na     604_aa pgu1 N-acetylmuramoyl-L-alanine amidase
456 JAOEJK010000001.1 GCA025447255_00398 CDS open 431418-431846 _na     142_aa arsC Arsenate reductase related protein%2C glutaredoxin family
457 JAOEJK010000001.1 GCA025447255_00399 CDS open 431966-432742 _na     258_aa nlpC D-alanyl-D-alanine carboxypeptidase
458 JAOEJK010000001.1 GCA025447255_00400 CDS open 432938-433780 _na     280_aa DUF4253 domain-containing protein
459 JAOEJK010000001.1 GCA025447255_00401 CDS open 434004-436106 _na     700_aa Gram-positive cocci surface proteins LPxTG domain-containing protein
460 JAOEJK010000001.1 GCA025447255_00402 CDS open 436161-436901 _na     246_aa tauE putative membrane transporter protein
461 JAOEJK010000001.1 GCA025447255_00403 CDS open 437040-437756 _na     238_aa fabG Short-chain alcohol dehydrogenase
462 JAOEJK010000001.1 GCA025447255_00404 CDS open 437865-439103 _na     412_aa melB Glycoside-Pentoside-Hexuronide (GPH):Cation symporter family protein
463 JAOEJK010000001.1 GCA025447255_00405 CDS open 439096-440778 _na     560_aa xynB2 Beta-xylosidase
464 JAOEJK010000001.1 GCA025447255_00406 CDS open 440978-441793 _na     271_aa araC Transcriptional regulator%2C AraC family
465 JAOEJK010000001.1 GCA025447255_00407 CDS open 441829-442593 _na     254_aa fabG Glucose 1-dehydrogenase
466 JAOEJK010000001.1 GCA025447255_00408 CDS open 442751-443608 _na     285_aa ybjT putative nucleoside-diphosphate-sugar epimerase
467 JAOEJK010000001.1 GCA025447255_00409 CDS open 443655-444098 _na     147_aa iscR Transcriptional regulator%2C BadM/Rrf2 family
468 JAOEJK010000001.1 GCA025447255_00410 CDS open 444138-446444 _na     768_aa tagB CDP-glycerol:poly(Glycerophosphate) glycerophosphotransferase
469 JAOEJK010000001.1 GCA025447255_00411 CDS open 446454-447386 _na     310_aa hypothetical protein
470 JAOEJK010000001.1 GCA025447255_00412 CDS open 447639-448001 _na     120_aa hxlR Transcriptional regulator
471 JAOEJK010000001.1 GCA025447255_00413 CDS open 448132-449337 _na     401_aa araJ Arabinose efflux permease
472 JAOEJK010000001.1 GCA025447255_00414 CDS open 449402-450355 _na     317_aa ydhF putative oxidoreductase
473 JAOEJK010000001.1 GCA025447255_00415 CDS open 450526-451284 _na     252_aa lolD ABC-type antimicrobial peptide transport system%2C ATPase component
474 JAOEJK010000001.1 GCA025447255_00416 CDS open 451296-453107 _na     603_aa ybbP ABC-type antimicrobial peptide transport system%2C permease component
475 JAOEJK010000001.1 GCA025447255_00417 CDS open 453146-453517 _na     123_aa yhcF Transcriptional regulator%2C GntR family
476 JAOEJK010000001.1 GCA025447255_00418 CDS open 453655-454059 _na     134_aa FeS cluster biogenesis domain-containing protein
477 JAOEJK010000001.1 GCA025447255_00419 CDS open 454245-455576 _na     443_aa clfA Outer membrane protein
478 JAOEJK010000001.1 GCA025447255_00420 CDS open 455713-457521 _na     602_aa zntA Cd(2+)-exporting ATPase
479 JAOEJK010000001.1 GCA025447255_00421 CDS open 457586-458269 _na     227_aa tVP38 VTT domain-containing protein
480 JAOEJK010000001.1 GCA025447255_00422 CDS open 458409-459944 _na     511_aa sufI Putative multicopper oxidase
481 JAOEJK010000001.1 GCA025447255_00423 CDS open 459989-460327 _na     112_aa arsR Transcriptional regulator%2C ArsR family
482 JAOEJK010000001.1 GCA025447255_00424 CDS open 460399-461004 _na     201_aa cadD putative permease%2C cadmium resistance protein
483 JAOEJK010000001.1 GCA025447255_00425 CDS open 461068-462099 _na     343_aa yeiH PSE family sulfate exporter
484 JAOEJK010000001.1 GCA025447255_00426 CDS open 462209-463096 _na     295_aa lysR Transcriptional regulator
485 JAOEJK010000001.1 GCA025447255_00427 CDS open 463192-464382 _na     396_aa araJ Tetracycline resistance MFS efflux pump
486 JAOEJK010000001.1 GCA025447255_00428 CDS open 464835-465695 _na     286_aa araC Transcriptional regulator%2C AraC family
487 JAOEJK010000001.1 GCA025447255_00429 CDS open 465821-467452 _na     543_aa uup ATPase component of ABC transporter with duplicated ATPase domains
488 JAOEJK010000001.1 GCA025447255_00430 CDS open 467576-468358 _na     260_aa menH Halo peroxidase 3
489 JAOEJK010000001.1 GCA025447255_00431 CDS open 468360-469313 _na     317_aa deoR Citrate lyase
490 JAOEJK010000001.1 GCA025447255_00432 CDS open 469574-470716 _na     380_aa sfcA NAD-dependent malic enzyme
491 JAOEJK010000001.1 GCA025447255_00433 CDS open 470743-471723 _na     326_aa yfdV Transporter%2C auxin efflux carrier family protein
492 JAOEJK010000001.1 GCA025447255_00434 CDS open 471860-472813 _na     317_aa citC [citrate (pro-3S)-lyase] ligase
493 JAOEJK010000001.1 GCA025447255_00435 CDS open 472803-473096 _na     97_aa citD citrate lyase acyl carrier protein
494 JAOEJK010000001.1 GCA025447255_00436 CDS open 473096-474010 _na     304_aa citE citrate (pro-3S)-lyase subunit beta
495 JAOEJK010000001.1 GCA025447255_00437 CDS open 474000-475538 _na     512_aa citF citrate lyase subunit alpha
496 JAOEJK010000001.1 GCA025447255_00438 CDS open 475653-476195 _na     180_aa citX citrate lyase holo-[acyl-carrier protein] synthase
497 JAOEJK010000001.1 GCA025447255_00439 CDS open 476210-477070 _na     286_aa citG triphosphoribosyl-dephospho-CoA synthase
498 JAOEJK010000001.1 GCA025447255_00440 CDS open 477115-478044 _na     309_aa ydcZ DMT family transporter
499 JAOEJK010000001.1 GCA025447255_00441 CDS open 478114-479055 _na     313_aa uRH1 Inosine-uridine nucleoside N-ribohydrolase
500 JAOEJK010000001.1 GCA025447255_00442 CDS open 479239-479454 _na     71_aa hypothetical protein