BAKTAGenome Explorer: Corynebacterium pseudodiphtheriticum (GCA_030176655.1)
Select a Genome:
|
BAKTA Annotations for GCA_030176655.1
|
Search & Sort all 4244 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | JASNUC010000001.1 | GCA030176655_00798 | gene | open | 69362-69456 | Bacteria_small_SRP | ||
| 2 | JASNUC010000001.1 | GCA030176655_00798 | ncRNA | open | 69362-69456 | Bacterial small signal recognition particle RNA | ||
| 3 | JASNUC010000001.1 | repeat_region | open | 172803-173808 | CRISPR array with 16 repeats of length 36%2C consensus sequence GCTGGGGTTCAGTTCTCATTACCCCTGATATACTTC and spacer length 28 | |||
| 4 | JASNUC010000001.1 | GCA030176655_00729 | CDS | open | 182-808 | _na 208_aa | HTH tetR-type domain-containing protein | |
| 5 | JASNUC010000001.1 | GCA030176655_00730 | CDS | open | 805-2067 | _na 420_aa | yidC | Membrane protein insertase YidC |
| 6 | JASNUC010000001.1 | GCA030176655_00731 | CDS | open | 2177-3499 | _na 440_aa | Histidine kinase domain-containing protein | |
| 7 | JASNUC010000001.1 | GCA030176655_00732 | CDS | open | 3553-4191 | _na 212_aa | Response regulatory domain-containing protein | |
| 8 | JASNUC010000001.1 | GCA030176655_00733 | CDS | open | 4201-4836 | _na 211_aa | DUF6474 domain-containing protein | |
| 9 | JASNUC010000001.1 | GCA030176655_00734 | CDS | open | 4923-6509 | _na 528_aa | yprB | YprB ribonuclease H-like domain-containing protein |
| 10 | JASNUC010000001.1 | GCA030176655_00735 | CDS | open | 6506-7714 | _na 402_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 11 | JASNUC010000001.1 | GCA030176655_00736 | CDS | open | 7933-8031 | _na 32_aa | hypothetical protein | |
| 12 | JASNUC010000001.1 | GCA030176655_00737 | CDS | open | 8074-8598 | _na 174_aa | IS3 family transposase | |
| 13 | JASNUC010000001.1 | GCA030176655_00738 | CDS | open | 8635-8823 | _na 62_aa | Tranposase | |
| 14 | JASNUC010000001.1 | GCA030176655_00739 | CDS | open | 9261-10214 | _na 317_aa | hypothetical protein | |
| 15 | JASNUC010000001.1 | GCA030176655_00740 | CDS | open | 10215-10442 | _na 75_aa | hypothetical protein | |
| 16 | JASNUC010000001.1 | GCA030176655_00741 | CDS | open | 10367-10576 | _na 69_aa | hypothetical protein | |
| 17 | JASNUC010000001.1 | GCA030176655_00742 | CDS | open | 10852-10989 | _na 45_aa | Transposase | |
| 18 | JASNUC010000001.1 | GCA030176655_00743 | CDS | open | 10989-11432 | _na 147_aa | Integrase catalytic domain-containing protein | |
| 19 | JASNUC010000001.1 | GCA030176655_00744 | CDS | open | 11481-11858 | _na 125_aa | hypothetical protein | |
| 20 | JASNUC010000001.1 | GCA030176655_00745 | CDS | open | 12129-12227 | _na 32_aa | hypothetical protein | |
| 21 | JASNUC010000001.1 | GCA030176655_00746 | CDS | open | 12227-12337 | _na 36_aa | hypothetical protein | |
| 22 | JASNUC010000001.1 | GCA030176655_00747 | CDS | open | 12783-13022 | _na 79_aa | hicA | Toxin HicA |
| 23 | JASNUC010000001.1 | GCA030176655_00748 | CDS | open | 13028-13354 | _na 108_aa | hicB | HicB family protein |
| 24 | JASNUC010000001.1 | GCA030176655_00749 | CDS | open | 13366-14112 | _na 248_aa | Resolvase/invertase-type recombinase catalytic domain-containing protein | |
| 25 | JASNUC010000001.1 | GCA030176655_00750 | CDS | open | 14234-14839 | _na 201_aa | DUF3800 domain-containing protein | |
| 26 | JASNUC010000001.1 | GCA030176655_00751 | CDS | open | 15104-15361 | _na 85_aa | Integrase core domain-containing protein | |
| 27 | JASNUC010000001.1 | GCA030176655_00752 | CDS | open | 15996-16403 | _na 135_aa | phospholipase A2 | |
| 28 | JASNUC010000001.1 | GCA030176655_00753 | CDS | open | 16418-16819 | _na 133_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 29 | JASNUC010000001.1 | GCA030176655_00754 | CDS | open | 16961-17563 | _na 200_aa | Superoxide dismutase | |
| 30 | JASNUC010000001.1 | GCA030176655_00755 | CDS | open | 17766-18428 | _na 220_aa | msrA | Peptide methionine sulfoxide reductase MsrA |
| 31 | JASNUC010000001.1 | GCA030176655_00756 | CDS | open | 18474-19202 | _na 242_aa | GP-PDE domain-containing protein | |
| 32 | JASNUC010000001.1 | GCA030176655_00757 | CDS | open | 19213-20133 | _na 306_aa | DUF5926 domain-containing protein | |
| 33 | JASNUC010000001.1 | GCA030176655_00758 | CDS | open | 20237-21340 | _na 367_aa | NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein | |
| 34 | JASNUC010000001.1 | GCA030176655_00759 | CDS | open | 21388-23247 | _na 619_aa | Cell envelope-related transcriptional attenuator domain-containing protein | |
| 35 | JASNUC010000001.1 | GCA030176655_00760 | CDS | open | 23308-24432 | _na 374_aa | amidase | |
| 36 | JASNUC010000001.1 | GCA030176655_00761 | CDS | open | 24457-25380 | _na 307_aa | pheA | prephenate dehydratase |
| 37 | JASNUC010000001.1 | GCA030176655_00762 | CDS | open | 25383-26036 | _na 217_aa | Phosphoglycerate mutase | |
| 38 | JASNUC010000001.1 | GCA030176655_00763 | CDS | open | 26083-26481 | _na 132_aa | Metallopeptidase family protein | |
| 39 | JASNUC010000001.1 | GCA030176655_00764 | CDS | open | 26490-27476 | _na 328_aa | Septum formation-related domain-containing protein | |
| 40 | JASNUC010000001.1 | GCA030176655_00765 | CDS | open | 27494-28807 | _na 437_aa | serS | serine--tRNA ligase |
| 41 | JASNUC010000001.1 | GCA030176655_00766 | CDS | open | 28804-29682 | _na 292_aa | Phospholipid/glycerol acyltransferase domain-containing protein | |
| 42 | JASNUC010000001.1 | GCA030176655_00767 | CDS | open | 29700-30533 | _na 277_aa | Cof-like hydrolase | |
| 43 | JASNUC010000001.1 | GCA030176655_00768 | CDS | open | 30541-32106 | _na 521_aa | glpK | glycerol kinase GlpK |
| 44 | JASNUC010000001.1 | GCA030176655_00769 | CDS | open | 32103-34253 | _na 716_aa | Peptidoglycan recognition protein family domain-containing protein | |
| 45 | JASNUC010000001.1 | GCA030176655_00770 | CDS | open | 34546-35736 | _na 396_aa | glf | UDP-galactopyranose mutase |
| 46 | JASNUC010000001.1 | GCA030176655_00771 | CDS | open | 35831-37765 | _na 644_aa | Glycosyltransferase | |
| 47 | JASNUC010000001.1 | GCA030176655_00772 | CDS | open | 37755-38285 | _na 176_aa | Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein | |
| 48 | JASNUC010000001.1 | GCA030176655_00773 | CDS | open | 38286-39269 | _na 327_aa | decaprenyl-phosphate phosphoribosyltransferase | |
| 49 | JASNUC010000001.1 | GCA030176655_00774 | CDS | open | 39476-40498 | _na 340_aa | Acyl-CoA:diacylglycerol acyltransferase | |
| 50 | JASNUC010000001.1 | GCA030176655_00775 | CDS | open | 40842-42839 | _na 665_aa | Trehalose O-mycolyltransferase | |
| 51 | JASNUC010000001.1 | GCA030176655_00776 | CDS | open | 42839-43465 | _na 208_aa | DUF732 domain-containing protein | |
| 52 | JASNUC010000001.1 | GCA030176655_00777 | CDS | open | 43530-44441 | _na 303_aa | Cutinase | |
| 53 | JASNUC010000001.1 | GCA030176655_00778 | CDS | open | 44714-46558 | _na 614_aa | FadD32-like long-chain-fatty-acid--AMP ligase | |
| 54 | JASNUC010000001.1 | GCA030176655_00779 | CDS | open | 46559-51571 | _na 1670_aa | pks13 | polyketide synthase Pks13 |
| 55 | JASNUC010000001.1 | GCA030176655_00780 | CDS | open | 51572-53116 | _na 514_aa | Propionyl-CoA carboxylase beta chain 5 | |
| 56 | JASNUC010000001.1 | GCA030176655_00781 | CDS | open | 53109-53375 | _na 88_aa | hypothetical protein | |
| 57 | JASNUC010000001.1 | GCA030176655_00782 | CDS | open | 53903-54871 | _na 322_aa | rarD | EamA family transporter RarD |
| 58 | JASNUC010000001.1 | GCA030176655_00783 | CDS | open | 54785-55183 | _na 132_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 59 | JASNUC010000001.1 | GCA030176655_00784 | CDS | open | 55189-56226 | _na 345_aa | TIGR00374 family protein | |
| 60 | JASNUC010000001.1 | GCA030176655_00785 | CDS | open | 56239-58596 | _na 785_aa | Membrane transport protein MMPL domain-containing protein | |
| 61 | JASNUC010000001.1 | GCA030176655_00786 | CDS | open | 58605-59264 | _na 219_aa | NYN domain-containing protein | |
| 62 | JASNUC010000001.1 | GCA030176655_00787 | CDS | open | 59405-60202 | _na 265_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 63 | JASNUC010000001.1 | GCA030176655_00788 | CDS | open | 60468-62300 | _na 610_aa | phosphoenolpyruvate carboxykinase (GTP) | |
| 64 | JASNUC010000001.1 | GCA030176655_00789 | CDS | open | 62540-62887 | _na 115_aa | hypothetical protein | |
| 65 | JASNUC010000001.1 | GCA030176655_00790 | CDS | open | 63071-63529 | _na 152_aa | Phage holin family protein | |
| 66 | JASNUC010000001.1 | GCA030176655_00791 | CDS | open | 63535-64308 | _na 257_aa | Methyltransferase type 11 domain-containing protein | |
| 67 | JASNUC010000001.1 | GCA030176655_00792 | CDS | open | 64511-64873 | _na 120_aa | Ion transport domain-containing protein | |
| 68 | JASNUC010000001.1 | GCA030176655_00793 | CDS | open | 64987-65247 | _na 86_aa | hypothetical protein | |
| 69 | JASNUC010000001.1 | GCA030176655_00794 | CDS | open | 65315-66475 | _na 386_aa | Glycosyl transferase family 1 domain-containing protein | |
| 70 | JASNUC010000001.1 | GCA030176655_00795 | CDS | open | 66538-67485 | _na 315_aa | FAD-binding FR-type domain-containing protein | |
| 71 | JASNUC010000001.1 | GCA030176655_00796 | CDS | open | 67856-69229 | _na 457_aa | YibE/F family protein | |
| 72 | JASNUC010000001.1 | GCA030176655_00797 | CDS | open | 69296-69472 | _na 58_aa | hypothetical protein | |
| 73 | JASNUC010000001.1 | GCA030176655_00799 | CDS | open | 69566-70381 | _na 271_aa | hypothetical protein | |
| 74 | JASNUC010000001.1 | GCA030176655_00800 | CDS | open | 70488-70649 | _na 53_aa | hypothetical protein | |
| 75 | JASNUC010000001.1 | GCA030176655_00801 | CDS | open | 70630-71013 | _na 127_aa | Aminoacyl-tRNA synthetase class II (D/K/N) domain-containing protein | |
| 76 | JASNUC010000001.1 | GCA030176655_00802 | CDS | open | 71080-71370 | _na 96_aa | hypothetical protein | |
| 77 | JASNUC010000001.1 | GCA030176655_00803 | CDS | open | 71502-72710 | _na 402_aa | nitric oxide dioxygenase | |
| 78 | JASNUC010000001.1 | GCA030176655_00804 | CDS | open | 72730-73215 | _na 161_aa | Rrf2 family transcriptional regulator | |
| 79 | JASNUC010000001.1 | GCA030176655_00805 | CDS | open | 73455-73595 | _na 46_aa | hypothetical protein | |
| 80 | JASNUC010000001.1 | GCA030176655_00806 | CDS | open | 73719-74090 | _na 123_aa | Transposase IS110-like N-terminal domain-containing protein | |
| 81 | JASNUC010000001.1 | GCA030176655_00807 | CDS | open | 74107-74613 | _na 168_aa | Transposase IS116/IS110/IS902 C-terminal domain-containing protein | |
| 82 | JASNUC010000001.1 | GCA030176655_00808 | CDS | open | 74668-74922 | _na 84_aa | DUF6968 domain-containing protein | |
| 83 | JASNUC010000001.1 | GCA030176655_00809 | CDS | open | 75771-76961 | _na 396_aa | SsuA/THI5-like domain-containing protein | |
| 84 | JASNUC010000001.1 | GCA030176655_00810 | CDS | open | 76971-77900 | _na 309_aa | ABC transporter permease | |
| 85 | JASNUC010000001.1 | GCA030176655_00811 | CDS | open | 77893-78723 | _na 276_aa | ABC transporter domain-containing protein | |
| 86 | JASNUC010000001.1 | GCA030176655_00812 | CDS | open | 78875-80143 | _na 422_aa | Aminotransferase class I/classII domain-containing protein | |
| 87 | JASNUC010000001.1 | GCA030176655_00813 | CDS | open | 80124-80702 | _na 192_aa | Suppressor of fused-like domain-containing protein | |
| 88 | JASNUC010000001.1 | GCA030176655_00814 | CDS | open | 80781-83510 | _na 909_aa | DNA polymerase III subunit gamma and tau | |
| 89 | JASNUC010000001.1 | GCA030176655_00815 | CDS | open | 83637-83975 | _na 112_aa | YbaB/EbfC family nucleoid-associated protein | |
| 90 | JASNUC010000001.1 | GCA030176655_00816 | CDS | open | 83976-84635 | _na 219_aa | recR | recombination mediator RecR |
| 91 | JASNUC010000001.1 | GCA030176655_00817 | CDS | open | 84692-85609 | _na 305_aa | FAD-binding FR-type domain-containing protein | |
| 92 | JASNUC010000001.1 | GCA030176655_00818 | CDS | open | 85659-86495 | _na 278_aa | gatD | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD |
| 93 | JASNUC010000001.1 | GCA030176655_00819 | CDS | open | 86511-87947 | _na 478_aa | murT | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT |
| 94 | JASNUC010000001.1 | GCA030176655_00820 | CDS | open | 87978-89408 | _na 476_aa | DNA polymerase III subunit epsilon | |
| 95 | JASNUC010000001.1 | GCA030176655_00821 | CDS | open | 89525-91348 | _na 607_aa | leuA | 2-isopropylmalate synthase |
| 96 | JASNUC010000001.1 | GCA030176655_00822 | CDS | open | 91698-92963 | _na 421_aa | aspartate kinase | |
| 97 | JASNUC010000001.1 | GCA030176655_00823 | CDS | open | 93008-94045 | _na 345_aa | aspartate-semialdehyde dehydrogenase | |
| 98 | JASNUC010000001.1 | GCA030176655_00824 | CDS | open | 94155-95462 | _na 435_aa | ykvI | Membrane protein YkvI |
| 99 | JASNUC010000001.1 | GCA030176655_00825 | CDS | open | 95551-96099 | _na 182_aa | RNA polymerase sigma factor | |
| 100 | JASNUC010000001.1 | GCA030176655_00826 | CDS | open | 96251-97798 | _na 515_aa | Catalase core domain-containing protein | |
| 101 | JASNUC010000001.1 | GCA030176655_00827 | CDS | open | 98018-99550 | _na 510_aa | X-X-X-Leu-X-X-Gly heptad repeats protein | |
| 102 | JASNUC010000001.1 | GCA030176655_00828 | CDS | open | 99638-99928 | _na 96_aa | Peptidase M23 | |
| 103 | JASNUC010000001.1 | GCA030176655_00829 | CDS | open | 100153-101514 | _na 453_aa | Collagen-like protein | |
| 104 | JASNUC010000001.1 | GCA030176655_00831 | CDS | open | 102036-102938 | _na 300_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 105 | JASNUC010000001.1 | GCA030176655_00832 | CDS | open | 103063-103554 | _na 163_aa | GatB/YqeY domain-containing protein | |
| 106 | JASNUC010000001.1 | GCA030176655_00833 | CDS | open | 103551-105941 | _na 796_aa | peptidoglycan glycosyltransferase | |
| 107 | JASNUC010000001.1 | GCA030176655_00834 | CDS | open | 106113-106466 | _na 117_aa | whiB | Transcriptional regulator WhiB |
| 108 | JASNUC010000001.1 | GCA030176655_00835 | CDS | open | 106542-106697 | _na 51_aa | DUF4177 domain-containing protein | |
| 109 | JASNUC010000001.1 | GCA030176655_00836 | CDS | open | 106699-107169 | _na 156_aa | Endoribonuclease L-PSP/chorismate mutase-like domain-containing protein | |
| 110 | JASNUC010000001.1 | GCA030176655_00837 | CDS | open | 107247-108074 | _na 275_aa | Metallo-beta-lactamase domain-containing protein | |
| 111 | JASNUC010000001.1 | GCA030176655_00838 | CDS | open | 108294-108977 | _na 227_aa | Transcriptional regulator%2C Crp family protein | |
| 112 | JASNUC010000001.1 | GCA030176655_00839 | CDS | open | 109336-110019 | _na 227_aa | Thioredoxin domain-containing protein | |
| 113 | JASNUC010000001.1 | GCA030176655_00840 | CDS | open | 110019-110768 | _na 249_aa | Nudix hydrolase domain-containing protein | |
| 114 | JASNUC010000001.1 | GCA030176655_00841 | CDS | open | 110804-112000 | _na 398_aa | marP | MarP family serine protease |
| 115 | JASNUC010000001.1 | GCA030176655_00842 | CDS | open | 112039-113004 | _na 321_aa | AB hydrolase-1 domain-containing protein | |
| 116 | JASNUC010000001.1 | GCA030176655_00843 | CDS | open | 113065-113568 | _na 167_aa | Phage holin family protein | |
| 117 | JASNUC010000001.1 | GCA030176655_00844 | CDS | open | 113565-114548 | _na 327_aa | HAD family hydrolase | |
| 118 | JASNUC010000001.1 | GCA030176655_00845 | CDS | open | 114819-116033 | _na 404_aa | ssd | septum site-determining protein Ssd |
| 119 | JASNUC010000001.1 | GCA030176655_00846 | CDS | open | 116131-117360 | _na 409_aa | Helicase/secretion neighborhood ATPase | |
| 120 | JASNUC010000001.1 | GCA030176655_00847 | CDS | open | 117357-118169 | _na 270_aa | gspF | Type II secretion system protein GspF domain-containing protein |
| 121 | JASNUC010000001.1 | GCA030176655_00848 | CDS | open | 118154-118738 | _na 194_aa | gspF | Type II secretion system protein GspF domain-containing protein |
| 122 | JASNUC010000001.1 | GCA030176655_00849 | CDS | open | 118789-119097 | _na 102_aa | DUF4244 domain-containing protein | |
| 123 | JASNUC010000001.1 | GCA030176655_00850 | CDS | open | 119048-119428 | _na 126_aa | tadE | TadE family protein |
| 124 | JASNUC010000001.1 | GCA030176655_00851 | CDS | open | 119425-119799 | _na 124_aa | Helicase/secretion neighborhood TadE-like protein | |
| 125 | JASNUC010000001.1 | GCA030176655_00852 | CDS | open | 119833-122217 | _na 794_aa | DEAD/DEAH box helicase | |
| 126 | JASNUC010000001.1 | GCA030176655_00853 | CDS | open | 122404-122607 | _na 67_aa | Cold-shock protein A | |
| 127 | JASNUC010000001.1 | GCA030176655_00854 | CDS | open | 122834-125833 | _na 999_aa | topA | type I DNA topoisomerase |
| 128 | JASNUC010000001.1 | GCA030176655_00855 | CDS | open | 125837-127186 | _na 449_aa | DUF418 domain-containing protein | |
| 129 | JASNUC010000001.1 | GCA030176655_00856 | CDS | open | 127287-128813 | _na 508_aa | Adenylate cyclase | |
| 130 | JASNUC010000001.1 | GCA030176655_00857 | CDS | open | 129004-130242 | _na 412_aa | DNA polymerase III subunit delta' | |
| 131 | JASNUC010000001.1 | GCA030176655_00859 | CDS | open | 130747-131028 | _na 93_aa | hypothetical protein | |
| 132 | JASNUC010000001.1 | GCA030176655_00860 | CDS | open | 131108-132406 | _na 432_aa | Fic family protein | |
| 133 | JASNUC010000001.1 | GCA030176655_00861 | CDS | open | 132841-134793 | _na 650_aa | Hypothetical DNA-binding protein | |
| 134 | JASNUC010000001.1 | GCA030176655_00862 | CDS | open | 134874-136481 | _na 535_aa | hsdM | site-specific DNA-methyltransferase (adenine-specific) |
| 135 | JASNUC010000001.1 | GCA030176655_00863 | CDS | open | 136478-137692 | _na 404_aa | Restriction endonuclease subunit S | |
| 136 | JASNUC010000001.1 | GCA030176655_00864 | CDS | open | 137709-140894 | _na 1061_aa | Type I restriction enzyme endonuclease subunit | |
| 137 | JASNUC010000001.1 | GCA030176655_00865 | CDS | open | 140897-142510 | _na 537_aa | TIGR04141 family sporadically distributed protein | |
| 138 | JASNUC010000001.1 | GCA030176655_00866 | CDS | open | 143371-143766 | _na 131_aa | hypothetical protein | |
| 139 | JASNUC010000001.1 | GCA030176655_00867 | CDS | open | 143863-145578 | _na 571_aa | ATP-binding protein | |
| 140 | JASNUC010000001.1 | GCA030176655_00868 | CDS | open | 145988-147631 | _na 547_aa | AMP-dependent synthetase/ligase domain-containing protein | |
| 141 | JASNUC010000001.1 | GCA030176655_00869 | CDS | open | 147896-149047 | _na 383_aa | S-(hydroxymethyl)mycothiol dehydrogenase | |
| 142 | JASNUC010000001.1 | GCA030176655_00870 | CDS | open | 149053-149670 | _na 205_aa | Metallo-beta-lactamase domain-containing protein | |
| 143 | JASNUC010000001.1 | GCA030176655_00871 | CDS | open | 149742-150602 | _na 286_aa | Cytochrome C biogenesis protein transmembrane domain-containing protein | |
| 144 | JASNUC010000001.1 | GCA030176655_00872 | CDS | open | 150620-151561 | _na 313_aa | Thioredoxin domain-containing protein | |
| 145 | JASNUC010000001.1 | GCA030176655_00873 | CDS | open | 151613-152479 | _na 288_aa | rfbA | glucose-1-phosphate thymidylyltransferase RfbA |
| 146 | JASNUC010000001.1 | GCA030176655_00874 | CDS | open | 152486-153850 | _na 454_aa | rfbD | dTDP-4-dehydrorhamnose reductase |
| 147 | JASNUC010000001.1 | GCA030176655_00875 | CDS | open | 153866-154852 | _na 328_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 148 | JASNUC010000001.1 | GCA030176655_00876 | CDS | open | 155086-156210 | _na 374_aa | Esterase | |
| 149 | JASNUC010000001.1 | GCA030176655_00877 | CDS | open | 156718-156825 | _na 35_aa | hypothetical protein | |
| 150 | JASNUC010000001.1 | GCA030176655_00878 | CDS | open | 157019-158446 | _na 475_aa | lpdA | dihydrolipoyl dehydrogenase |
| 151 | JASNUC010000001.1 | GCA030176655_00879 | CDS | open | 158800-159555 | _na 251_aa | B558 family succinate dehydrogenase (Or fumarate reductase) cytochrome B subunit | |
| 152 | JASNUC010000001.1 | GCA030176655_00880 | CDS | open | 159622-161631 | _na 669_aa | Succinate dehydrogenase or fumarate reductase%2C flavoprotein subunit | |
| 153 | JASNUC010000001.1 | GCA030176655_00881 | CDS | open | 161631-162380 | _na 249_aa | succinate dehydrogenase | |
| 154 | JASNUC010000001.1 | GCA030176655_00882 | CDS | open | 162519-162887 | _na 122_aa | DUF2628 domain-containing protein | |
| 155 | JASNUC010000001.1 | GCA030176655_00883 | CDS | open | 163008-164396 | _na 462_aa | DUF445 domain-containing protein | |
| 156 | JASNUC010000001.1 | GCA030176655_00884 | CDS | open | 164477-164914 | _na 145_aa | Transposase | |
| 157 | JASNUC010000001.1 | GCA030176655_00885 | CDS | open | 165028-165417 | _na 129_aa | DUF2516 domain-containing protein | |
| 158 | JASNUC010000001.1 | GCA030176655_00886 | CDS | open | 165464-166351 | _na 295_aa | Deoxyribose-phosphate aldolase | |
| 159 | JASNUC010000001.1 | GCA030176655_00887 | CDS | open | 166383-167273 | _na 296_aa | DUF2993 domain-containing protein | |
| 160 | JASNUC010000001.1 | GCA030176655_00888 | CDS | open | 167303-167794 | _na 163_aa | DUF2505 domain-containing protein | |
| 161 | JASNUC010000001.1 | GCA030176655_00889 | CDS | open | 167821-169083 | _na 420_aa | UDP-N-acetylmuramate dehydrogenase | |
| 162 | JASNUC010000001.1 | GCA030176655_00890 | CDS | open | 169117-169620 | _na 167_aa | Bacterial spore germination immunoglobulin-like domain-containing protein | |
| 163 | JASNUC010000001.1 | GCA030176655_00891 | CDS | open | 169718-170959 | _na 413_aa | Esterase | |
| 164 | JASNUC010000001.1 | GCA030176655_00892 | CDS | open | 171140-171583 | _na 147_aa | Bacterial Pleckstrin-like y domain-containing protein | |
| 165 | JASNUC010000001.1 | GCA030176655_00893 | CDS | open | 171598-172563 | _na 321_aa | Polysaccharide deacetylase family protein | |
| 166 | JASNUC010000001.1 | GCA030176655_00894 | CDS | open | 173849-174154 | _na 101_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 167 | JASNUC010000001.1 | GCA030176655_00895 | CDS | open | 174162-175076 | _na 304_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 168 | JASNUC010000001.1 | GCA030176655_00896 | CDS | open | 175079-178378 | _na 1099_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 169 | JASNUC010000001.1 | GCA030176655_00897 | CDS | open | 178548-187838 | _na 3096_aa | Ketosynthase family 3 (KS3) domain-containing protein | |
| 170 | JASNUC010000001.1 | GCA030176655_00898 | CDS | open | 188088-189872 | _na 594_aa | long-chain-fatty-acid--CoA ligase | |
| 171 | JASNUC010000001.1 | GCA030176655_00899 | CDS | open | 190129-191913 | _na 594_aa | long-chain-fatty-acid--CoA ligase | |
| 172 | JASNUC010000001.1 | GCA030176655_00900 | CDS | open | 192425-194143 | _na 572_aa | long-chain-fatty-acid--CoA ligase | |
| 173 | JASNUC010000001.1 | GCA030176655_00901 | CDS | open | 194401-195720 | _na 439_aa | mshA | D-inositol-3-phosphate glycosyltransferase |
| 174 | JASNUC010000001.1 | GCA030176655_00902 | CDS | open | 195802-196590 | _na 262_aa | phosphoglyceromutase | |
| 175 | JASNUC010000001.1 | GCA030176655_00903 | CDS | open | 196595-198028 | _na 477_aa | senX3 | Sensor-like histidine kinase SenX3 |
| 176 | JASNUC010000001.1 | GCA030176655_00904 | CDS | open | 198139-198837 | _na 232_aa | regX3 | Sensory transduction protein RegX3 |
| 177 | JASNUC010000001.1 | GCA030176655_00905 | CDS | open | 198850-199752 | _na 300_aa | DUF3109 domain-containing protein | |
| 178 | JASNUC010000001.1 | GCA030176655_00906 | CDS | open | 199786-200715 | _na 309_aa | Ppx/GppA phosphatase N-terminal domain-containing protein | |
| 179 | JASNUC010000001.1 | GCA030176655_00907 | CDS | open | 200727-202169 | _na 480_aa | hypothetical protein | |
| 180 | JASNUC010000001.1 | GCA030176655_00908 | CDS | open | 202293-203141 | _na 282_aa | proC | pyrroline-5-carboxylate reductase |
| 181 | JASNUC010000001.1 | GCA030176655_00909 | CDS | open | 203495-203686 | _na 63_aa | Helix-turn-helix domain-containing protein | |
| 182 | JASNUC010000001.1 | GCA030176655_00910 | CDS | open | 203938-204039 | _na 33_aa | 30S ribosomal protein bS22 | |
| 183 | JASNUC010000001.1 | GCA030176655_00911 | CDS | open | 204195-205826 | _na 543_aa | HNH nuclease domain-containing protein | |
| 184 | JASNUC010000001.1 | GCA030176655_00912 | CDS | open | 206045-207121 | _na 358_aa | HAD hydrolase%2C family IB | |
| 185 | JASNUC010000001.1 | GCA030176655_00913 | CDS | open | 207452-207835 | _na 127_aa | Glutaredoxin domain-containing protein | |
| 186 | JASNUC010000001.1 | GCA030176655_00914 | CDS | open | 208095-209561 | _na 488_aa | glutamyl-tRNA reductase | |
| 187 | JASNUC010000001.1 | GCA030176655_00915 | CDS | open | 209633-210526 | _na 297_aa | hemC | hydroxymethylbilane synthase |
| 188 | JASNUC010000001.1 | GCA030176655_00916 | CDS | open | 210808-212544 | _na 578_aa | Tetrapyrrole methylase domain-containing protein | |
| 189 | JASNUC010000001.1 | GCA030176655_00917 | CDS | open | 212719-213708 | _na 329_aa | hemB | porphobilinogen synthase |
| 190 | JASNUC010000001.1 | GCA030176655_00918 | CDS | open | 213713-214597 | _na 294_aa | hypothetical protein | |
| 191 | JASNUC010000001.1 | GCA030176655_00919 | CDS | open | 214831-215781 | _na 316_aa | hemE | uroporphyrinogen decarboxylase |
| 192 | JASNUC010000001.1 | GCA030176655_00920 | CDS | open | 215875-217422 | _na 515_aa | protoporphyrinogen oxidase | |
| 193 | JASNUC010000001.1 | GCA030176655_00921 | CDS | open | 217499-218917 | _na 472_aa | hemL | glutamate-1-semialdehyde 2%2C1-aminomutase |
| 194 | JASNUC010000001.1 | GCA030176655_00922 | CDS | open | 219142-219858 | _na 238_aa | Phosphoglycerate mutase | |
| 195 | JASNUC010000001.1 | GCA030176655_00923 | CDS | open | 219946-220572 | _na 208_aa | Thioredoxin domain-containing protein | |
| 196 | JASNUC010000001.1 | GCA030176655_00924 | CDS | open | 220615-221580 | _na 321_aa | Cytochrome C biogenesis protein transmembrane domain-containing protein | |
| 197 | JASNUC010000001.1 | GCA030176655_00925 | CDS | open | 221656-223320 | _na 554_aa | ResB-like domain-containing protein | |
| 198 | JASNUC010000001.1 | GCA030176655_00926 | CDS | open | 223576-224568 | _na 330_aa | ccsB | c-type cytochrome biogenesis protein CcsB |
| 199 | JASNUC010000001.1 | GCA030176655_00927 | CDS | open | 224777-225187 | _na 136_aa | Secreted protein | |
| 200 | JASNUC010000001.1 | GCA030176655_00928 | CDS | open | 225224-225694 | _na 156_aa | DUF4229 domain-containing protein | |
| 201 | JASNUC010000001.1 | GCA030176655_00929 | CDS | open | 225710-226639 | _na 309_aa | AEC family transporter | |
| 202 | JASNUC010000001.1 | GCA030176655_00930 | CDS | open | 226795-227685 | _na 296_aa | 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase | |
| 203 | JASNUC010000001.1 | GCA030176655_00931 | CDS | open | 227854-228936 | _na 360_aa | Aldo/keto reductase | |
| 204 | JASNUC010000001.1 | GCA030176655_00932 | CDS | open | 229032-230225 | _na 397_aa | menE | o-succinylbenzoate--CoA ligase |
| 205 | JASNUC010000001.1 | GCA030176655_00933 | CDS | open | 230332-231351 | _na 339_aa | 1%2C4-dihydroxy-2-naphthoyl-CoA synthase | |
| 206 | JASNUC010000001.1 | GCA030176655_00934 | CDS | open | 231379-232533 | _na 384_aa | o-succinylbenzoate synthase | |
| 207 | JASNUC010000001.1 | GCA030176655_00935 | CDS | open | 232475-235222 | _na 915_aa | UvrABC system protein A | |
| 208 | JASNUC010000001.1 | GCA030176655_00936 | CDS | open | 235259-236053 | _na 264_aa | hypothetical protein | |
| 209 | JASNUC010000001.1 | GCA030176655_00937 | CDS | open | 236191-237969 | _na 592_aa | menD | 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase |
| 210 | JASNUC010000001.1 | GCA030176655_00938 | CDS | open | 237982-238554 | _na 190_aa | DUF3592 domain-containing protein | |
| 211 | JASNUC010000001.1 | GCA030176655_00939 | CDS | open | 238597-239823 | _na 408_aa | Glycosyltransferase family 1 protein | |
| 212 | JASNUC010000001.1 | GCA030176655_00940 | CDS | open | 239833-240633 | _na 266_aa | demethylmenaquinone methyltransferase | |
| 213 | JASNUC010000001.1 | GCA030176655_00941 | CDS | open | 240828-241139 | _na 103_aa | hypothetical protein | |
| 214 | JASNUC010000001.1 | GCA030176655_00942 | CDS | open | 241256-242689 | _na 477_aa | FAD-binding domain-containing protein | |
| 215 | JASNUC010000001.1 | GCA030176655_00943 | CDS | open | 242800-243816 | _na 338_aa | Geranylgeranyl pyrophosphate synthase | |
| 216 | JASNUC010000001.1 | GCA030176655_00729 | gene | open | 182-808 | |||
| 217 | JASNUC010000001.1 | GCA030176655_00730 | gene | open | 805-2067 | yidC | ||
| 218 | JASNUC010000001.1 | GCA030176655_00731 | gene | open | 2177-3499 | |||
| 219 | JASNUC010000001.1 | GCA030176655_00732 | gene | open | 3553-4191 | |||
| 220 | JASNUC010000001.1 | GCA030176655_00733 | gene | open | 4201-4836 | |||
| 221 | JASNUC010000001.1 | GCA030176655_00734 | gene | open | 4923-6509 | yprB | ||
| 222 | JASNUC010000001.1 | GCA030176655_00735 | gene | open | 6506-7714 | |||
| 223 | JASNUC010000001.1 | GCA030176655_00736 | gene | open | 7933-8031 | |||
| 224 | JASNUC010000001.1 | GCA030176655_00737 | gene | open | 8074-8598 | |||
| 225 | JASNUC010000001.1 | GCA030176655_00738 | gene | open | 8635-8823 | |||
| 226 | JASNUC010000001.1 | GCA030176655_00739 | gene | open | 9261-10214 | |||
| 227 | JASNUC010000001.1 | GCA030176655_00740 | gene | open | 10215-10442 | |||
| 228 | JASNUC010000001.1 | GCA030176655_00741 | gene | open | 10367-10576 | |||
| 229 | JASNUC010000001.1 | GCA030176655_00742 | gene | open | 10852-10989 | |||
| 230 | JASNUC010000001.1 | GCA030176655_00743 | gene | open | 10989-11432 | |||
| 231 | JASNUC010000001.1 | GCA030176655_00744 | gene | open | 11481-11858 | |||
| 232 | JASNUC010000001.1 | GCA030176655_00745 | gene | open | 12129-12227 | |||
| 233 | JASNUC010000001.1 | GCA030176655_00746 | gene | open | 12227-12337 | |||
| 234 | JASNUC010000001.1 | GCA030176655_00747 | gene | open | 12783-13022 | hicA | ||
| 235 | JASNUC010000001.1 | GCA030176655_00748 | gene | open | 13028-13354 | hicB | ||
| 236 | JASNUC010000001.1 | GCA030176655_00749 | gene | open | 13366-14112 | |||
| 237 | JASNUC010000001.1 | GCA030176655_00750 | gene | open | 14234-14839 | |||
| 238 | JASNUC010000001.1 | GCA030176655_00751 | gene | open | 15104-15361 | |||
| 239 | JASNUC010000001.1 | GCA030176655_00752 | gene | open | 15996-16403 | |||
| 240 | JASNUC010000001.1 | GCA030176655_00753 | gene | open | 16418-16819 | |||
| 241 | JASNUC010000001.1 | GCA030176655_00754 | gene | open | 16961-17563 | |||
| 242 | JASNUC010000001.1 | GCA030176655_00755 | gene | open | 17766-18428 | msrA | ||
| 243 | JASNUC010000001.1 | GCA030176655_00756 | gene | open | 18474-19202 | |||
| 244 | JASNUC010000001.1 | GCA030176655_00757 | gene | open | 19213-20133 | |||
| 245 | JASNUC010000001.1 | GCA030176655_00758 | gene | open | 20237-21340 | |||
| 246 | JASNUC010000001.1 | GCA030176655_00759 | gene | open | 21388-23247 | |||
| 247 | JASNUC010000001.1 | GCA030176655_00760 | gene | open | 23308-24432 | |||
| 248 | JASNUC010000001.1 | GCA030176655_00761 | gene | open | 24457-25380 | pheA | ||
| 249 | JASNUC010000001.1 | GCA030176655_00762 | gene | open | 25383-26036 | |||
| 250 | JASNUC010000001.1 | GCA030176655_00763 | gene | open | 26083-26481 | |||
| 251 | JASNUC010000001.1 | GCA030176655_00764 | gene | open | 26490-27476 | |||
| 252 | JASNUC010000001.1 | GCA030176655_00765 | gene | open | 27494-28807 | serS | ||
| 253 | JASNUC010000001.1 | GCA030176655_00766 | gene | open | 28804-29682 | |||
| 254 | JASNUC010000001.1 | GCA030176655_00767 | gene | open | 29700-30533 | |||
| 255 | JASNUC010000001.1 | GCA030176655_00768 | gene | open | 30541-32106 | glpK | ||
| 256 | JASNUC010000001.1 | GCA030176655_00769 | gene | open | 32103-34253 | |||
| 257 | JASNUC010000001.1 | GCA030176655_00770 | gene | open | 34546-35736 | glf | ||
| 258 | JASNUC010000001.1 | GCA030176655_00771 | gene | open | 35831-37765 | |||
| 259 | JASNUC010000001.1 | GCA030176655_00772 | gene | open | 37755-38285 | |||
| 260 | JASNUC010000001.1 | GCA030176655_00773 | gene | open | 38286-39269 | |||
| 261 | JASNUC010000001.1 | GCA030176655_00774 | gene | open | 39476-40498 | |||
| 262 | JASNUC010000001.1 | GCA030176655_00775 | gene | open | 40842-42839 | |||
| 263 | JASNUC010000001.1 | GCA030176655_00776 | gene | open | 42839-43465 | |||
| 264 | JASNUC010000001.1 | GCA030176655_00777 | gene | open | 43530-44441 | |||
| 265 | JASNUC010000001.1 | GCA030176655_00778 | gene | open | 44714-46558 | |||
| 266 | JASNUC010000001.1 | GCA030176655_00779 | gene | open | 46559-51571 | pks13 | ||
| 267 | JASNUC010000001.1 | GCA030176655_00780 | gene | open | 51572-53116 | |||
| 268 | JASNUC010000001.1 | GCA030176655_00781 | gene | open | 53109-53375 | |||
| 269 | JASNUC010000001.1 | GCA030176655_00782 | gene | open | 53903-54871 | rarD | ||
| 270 | JASNUC010000001.1 | GCA030176655_00783 | gene | open | 54785-55183 | |||
| 271 | JASNUC010000001.1 | GCA030176655_00784 | gene | open | 55189-56226 | |||
| 272 | JASNUC010000001.1 | GCA030176655_00785 | gene | open | 56239-58596 | |||
| 273 | JASNUC010000001.1 | GCA030176655_00786 | gene | open | 58605-59264 | |||
| 274 | JASNUC010000001.1 | GCA030176655_00787 | gene | open | 59405-60202 | trmB | ||
| 275 | JASNUC010000001.1 | GCA030176655_00788 | gene | open | 60468-62300 | |||
| 276 | JASNUC010000001.1 | GCA030176655_00789 | gene | open | 62540-62887 | |||
| 277 | JASNUC010000001.1 | GCA030176655_00790 | gene | open | 63071-63529 | |||
| 278 | JASNUC010000001.1 | GCA030176655_00791 | gene | open | 63535-64308 | |||
| 279 | JASNUC010000001.1 | GCA030176655_00792 | gene | open | 64511-64873 | |||
| 280 | JASNUC010000001.1 | GCA030176655_00793 | gene | open | 64987-65247 | |||
| 281 | JASNUC010000001.1 | GCA030176655_00794 | gene | open | 65315-66475 | |||
| 282 | JASNUC010000001.1 | GCA030176655_00795 | gene | open | 66538-67485 | |||
| 283 | JASNUC010000001.1 | GCA030176655_00796 | gene | open | 67856-69229 | |||
| 284 | JASNUC010000001.1 | GCA030176655_00797 | gene | open | 69296-69472 | |||
| 285 | JASNUC010000001.1 | GCA030176655_00799 | gene | open | 69566-70381 | |||
| 286 | JASNUC010000001.1 | GCA030176655_00800 | gene | open | 70488-70649 | |||
| 287 | JASNUC010000001.1 | GCA030176655_00801 | gene | open | 70630-71013 | |||
| 288 | JASNUC010000001.1 | GCA030176655_00802 | gene | open | 71080-71370 | |||
| 289 | JASNUC010000001.1 | GCA030176655_00803 | gene | open | 71502-72710 | |||
| 290 | JASNUC010000001.1 | GCA030176655_00804 | gene | open | 72730-73215 | |||
| 291 | JASNUC010000001.1 | GCA030176655_00805 | gene | open | 73455-73595 | |||
| 292 | JASNUC010000001.1 | GCA030176655_00806 | gene | open | 73719-74090 | |||
| 293 | JASNUC010000001.1 | GCA030176655_00807 | gene | open | 74107-74613 | |||
| 294 | JASNUC010000001.1 | GCA030176655_00808 | gene | open | 74668-74922 | |||
| 295 | JASNUC010000001.1 | GCA030176655_00809 | gene | open | 75771-76961 | |||
| 296 | JASNUC010000001.1 | GCA030176655_00810 | gene | open | 76971-77900 | |||
| 297 | JASNUC010000001.1 | GCA030176655_00811 | gene | open | 77893-78723 | |||
| 298 | JASNUC010000001.1 | GCA030176655_00812 | gene | open | 78875-80143 | |||
| 299 | JASNUC010000001.1 | GCA030176655_00813 | gene | open | 80124-80702 | |||
| 300 | JASNUC010000001.1 | GCA030176655_00814 | gene | open | 80781-83510 | |||
| 301 | JASNUC010000001.1 | GCA030176655_00815 | gene | open | 83637-83975 | |||
| 302 | JASNUC010000001.1 | GCA030176655_00816 | gene | open | 83976-84635 | recR | ||
| 303 | JASNUC010000001.1 | GCA030176655_00817 | gene | open | 84692-85609 | |||
| 304 | JASNUC010000001.1 | GCA030176655_00818 | gene | open | 85659-86495 | gatD | ||
| 305 | JASNUC010000001.1 | GCA030176655_00819 | gene | open | 86511-87947 | murT | ||
| 306 | JASNUC010000001.1 | GCA030176655_00820 | gene | open | 87978-89408 | |||
| 307 | JASNUC010000001.1 | GCA030176655_00821 | gene | open | 89525-91348 | leuA | ||
| 308 | JASNUC010000001.1 | GCA030176655_00822 | gene | open | 91698-92963 | |||
| 309 | JASNUC010000001.1 | GCA030176655_00823 | gene | open | 93008-94045 | |||
| 310 | JASNUC010000001.1 | GCA030176655_00824 | gene | open | 94155-95462 | ykvI | ||
| 311 | JASNUC010000001.1 | GCA030176655_00825 | gene | open | 95551-96099 | |||
| 312 | JASNUC010000001.1 | GCA030176655_00826 | gene | open | 96251-97798 | |||
| 313 | JASNUC010000001.1 | GCA030176655_00827 | gene | open | 98018-99550 | |||
| 314 | JASNUC010000001.1 | GCA030176655_00828 | gene | open | 99638-99928 | |||
| 315 | JASNUC010000001.1 | GCA030176655_00829 | gene | open | 100153-101514 | |||
| 316 | JASNUC010000001.1 | GCA030176655_00831 | gene | open | 102036-102938 | |||
| 317 | JASNUC010000001.1 | GCA030176655_00832 | gene | open | 103063-103554 | |||
| 318 | JASNUC010000001.1 | GCA030176655_00833 | gene | open | 103551-105941 | |||
| 319 | JASNUC010000001.1 | GCA030176655_00834 | gene | open | 106113-106466 | whiB | ||
| 320 | JASNUC010000001.1 | GCA030176655_00835 | gene | open | 106542-106697 | |||
| 321 | JASNUC010000001.1 | GCA030176655_00836 | gene | open | 106699-107169 | |||
| 322 | JASNUC010000001.1 | GCA030176655_00837 | gene | open | 107247-108074 | |||
| 323 | JASNUC010000001.1 | GCA030176655_00838 | gene | open | 108294-108977 | |||
| 324 | JASNUC010000001.1 | GCA030176655_00839 | gene | open | 109336-110019 | |||
| 325 | JASNUC010000001.1 | GCA030176655_00840 | gene | open | 110019-110768 | |||
| 326 | JASNUC010000001.1 | GCA030176655_00841 | gene | open | 110804-112000 | marP | ||
| 327 | JASNUC010000001.1 | GCA030176655_00842 | gene | open | 112039-113004 | |||
| 328 | JASNUC010000001.1 | GCA030176655_00843 | gene | open | 113065-113568 | |||
| 329 | JASNUC010000001.1 | GCA030176655_00844 | gene | open | 113565-114548 | |||
| 330 | JASNUC010000001.1 | GCA030176655_00845 | gene | open | 114819-116033 | ssd | ||
| 331 | JASNUC010000001.1 | GCA030176655_00846 | gene | open | 116131-117360 | |||
| 332 | JASNUC010000001.1 | GCA030176655_00847 | gene | open | 117357-118169 | gspF | ||
| 333 | JASNUC010000001.1 | GCA030176655_00848 | gene | open | 118154-118738 | gspF | ||
| 334 | JASNUC010000001.1 | GCA030176655_00849 | gene | open | 118789-119097 | |||
| 335 | JASNUC010000001.1 | GCA030176655_00850 | gene | open | 119048-119428 | tadE | ||
| 336 | JASNUC010000001.1 | GCA030176655_00851 | gene | open | 119425-119799 | |||
| 337 | JASNUC010000001.1 | GCA030176655_00852 | gene | open | 119833-122217 | |||
| 338 | JASNUC010000001.1 | GCA030176655_00853 | gene | open | 122404-122607 | |||
| 339 | JASNUC010000001.1 | GCA030176655_00854 | gene | open | 122834-125833 | topA | ||
| 340 | JASNUC010000001.1 | GCA030176655_00855 | gene | open | 125837-127186 | |||
| 341 | JASNUC010000001.1 | GCA030176655_00856 | gene | open | 127287-128813 | |||
| 342 | JASNUC010000001.1 | GCA030176655_00857 | gene | open | 129004-130242 | |||
| 343 | JASNUC010000001.1 | GCA030176655_00859 | gene | open | 130747-131028 | |||
| 344 | JASNUC010000001.1 | GCA030176655_00860 | gene | open | 131108-132406 | |||
| 345 | JASNUC010000001.1 | GCA030176655_00861 | gene | open | 132841-134793 | |||
| 346 | JASNUC010000001.1 | GCA030176655_00862 | gene | open | 134874-136481 | hsdM | ||
| 347 | JASNUC010000001.1 | GCA030176655_00863 | gene | open | 136478-137692 | |||
| 348 | JASNUC010000001.1 | GCA030176655_00864 | gene | open | 137709-140894 | |||
| 349 | JASNUC010000001.1 | GCA030176655_00865 | gene | open | 140897-142510 | |||
| 350 | JASNUC010000001.1 | GCA030176655_00866 | gene | open | 143371-143766 | |||
| 351 | JASNUC010000001.1 | GCA030176655_00867 | gene | open | 143863-145578 | |||
| 352 | JASNUC010000001.1 | GCA030176655_00868 | gene | open | 145988-147631 | |||
| 353 | JASNUC010000001.1 | GCA030176655_00869 | gene | open | 147896-149047 | |||
| 354 | JASNUC010000001.1 | GCA030176655_00870 | gene | open | 149053-149670 | |||
| 355 | JASNUC010000001.1 | GCA030176655_00871 | gene | open | 149742-150602 | |||
| 356 | JASNUC010000001.1 | GCA030176655_00872 | gene | open | 150620-151561 | |||
| 357 | JASNUC010000001.1 | GCA030176655_00873 | gene | open | 151613-152479 | rfbA | ||
| 358 | JASNUC010000001.1 | GCA030176655_00874 | gene | open | 152486-153850 | rfbD | ||
| 359 | JASNUC010000001.1 | GCA030176655_00875 | gene | open | 153866-154852 | rfbB | ||
| 360 | JASNUC010000001.1 | GCA030176655_00876 | gene | open | 155086-156210 | |||
| 361 | JASNUC010000001.1 | GCA030176655_00877 | gene | open | 156718-156825 | |||
| 362 | JASNUC010000001.1 | GCA030176655_00878 | gene | open | 157019-158446 | lpdA | ||
| 363 | JASNUC010000001.1 | GCA030176655_00879 | gene | open | 158800-159555 | |||
| 364 | JASNUC010000001.1 | GCA030176655_00880 | gene | open | 159622-161631 | |||
| 365 | JASNUC010000001.1 | GCA030176655_00881 | gene | open | 161631-162380 | |||
| 366 | JASNUC010000001.1 | GCA030176655_00882 | gene | open | 162519-162887 | |||
| 367 | JASNUC010000001.1 | GCA030176655_00883 | gene | open | 163008-164396 | |||
| 368 | JASNUC010000001.1 | GCA030176655_00884 | gene | open | 164477-164914 | |||
| 369 | JASNUC010000001.1 | GCA030176655_00885 | gene | open | 165028-165417 | |||
| 370 | JASNUC010000001.1 | GCA030176655_00886 | gene | open | 165464-166351 | |||
| 371 | JASNUC010000001.1 | GCA030176655_00887 | gene | open | 166383-167273 | |||
| 372 | JASNUC010000001.1 | GCA030176655_00888 | gene | open | 167303-167794 | |||
| 373 | JASNUC010000001.1 | GCA030176655_00889 | gene | open | 167821-169083 | |||
| 374 | JASNUC010000001.1 | GCA030176655_00890 | gene | open | 169117-169620 | |||
| 375 | JASNUC010000001.1 | GCA030176655_00891 | gene | open | 169718-170959 | |||
| 376 | JASNUC010000001.1 | GCA030176655_00892 | gene | open | 171140-171583 | |||
| 377 | JASNUC010000001.1 | GCA030176655_00893 | gene | open | 171598-172563 | |||
| 378 | JASNUC010000001.1 | GCA030176655_00894 | gene | open | 173849-174154 | cas2 | ||
| 379 | JASNUC010000001.1 | GCA030176655_00895 | gene | open | 174162-175076 | cas1 | ||
| 380 | JASNUC010000001.1 | GCA030176655_00896 | gene | open | 175079-178378 | cas9 | ||
| 381 | JASNUC010000001.1 | GCA030176655_00897 | gene | open | 178548-187838 | |||
| 382 | JASNUC010000001.1 | GCA030176655_00898 | gene | open | 188088-189872 | |||
| 383 | JASNUC010000001.1 | GCA030176655_00899 | gene | open | 190129-191913 | |||
| 384 | JASNUC010000001.1 | GCA030176655_00900 | gene | open | 192425-194143 | |||
| 385 | JASNUC010000001.1 | GCA030176655_00901 | gene | open | 194401-195720 | mshA | ||
| 386 | JASNUC010000001.1 | GCA030176655_00902 | gene | open | 195802-196590 | |||
| 387 | JASNUC010000001.1 | GCA030176655_00903 | gene | open | 196595-198028 | senX3 | ||
| 388 | JASNUC010000001.1 | GCA030176655_00904 | gene | open | 198139-198837 | regX3 | ||
| 389 | JASNUC010000001.1 | GCA030176655_00905 | gene | open | 198850-199752 | |||
| 390 | JASNUC010000001.1 | GCA030176655_00906 | gene | open | 199786-200715 | |||
| 391 | JASNUC010000001.1 | GCA030176655_00907 | gene | open | 200727-202169 | |||
| 392 | JASNUC010000001.1 | GCA030176655_00908 | gene | open | 202293-203141 | proC | ||
| 393 | JASNUC010000001.1 | GCA030176655_00909 | gene | open | 203495-203686 | |||
| 394 | JASNUC010000001.1 | GCA030176655_00910 | gene | open | 203938-204039 | |||
| 395 | JASNUC010000001.1 | GCA030176655_00911 | gene | open | 204195-205826 | |||
| 396 | JASNUC010000001.1 | GCA030176655_00912 | gene | open | 206045-207121 | |||
| 397 | JASNUC010000001.1 | GCA030176655_00913 | gene | open | 207452-207835 | |||
| 398 | JASNUC010000001.1 | GCA030176655_00914 | gene | open | 208095-209561 | |||
| 399 | JASNUC010000001.1 | GCA030176655_00915 | gene | open | 209633-210526 | hemC | ||
| 400 | JASNUC010000001.1 | GCA030176655_00916 | gene | open | 210808-212544 | |||
| 401 | JASNUC010000001.1 | GCA030176655_00917 | gene | open | 212719-213708 | hemB | ||
| 402 | JASNUC010000001.1 | GCA030176655_00918 | gene | open | 213713-214597 | |||
| 403 | JASNUC010000001.1 | GCA030176655_00919 | gene | open | 214831-215781 | hemE | ||
| 404 | JASNUC010000001.1 | GCA030176655_00920 | gene | open | 215875-217422 | |||
| 405 | JASNUC010000001.1 | GCA030176655_00921 | gene | open | 217499-218917 | hemL | ||
| 406 | JASNUC010000001.1 | GCA030176655_00922 | gene | open | 219142-219858 | |||
| 407 | JASNUC010000001.1 | GCA030176655_00923 | gene | open | 219946-220572 | |||
| 408 | JASNUC010000001.1 | GCA030176655_00924 | gene | open | 220615-221580 | |||
| 409 | JASNUC010000001.1 | GCA030176655_00925 | gene | open | 221656-223320 | |||
| 410 | JASNUC010000001.1 | GCA030176655_00926 | gene | open | 223576-224568 | ccsB | ||
| 411 | JASNUC010000001.1 | GCA030176655_00927 | gene | open | 224777-225187 | |||
| 412 | JASNUC010000001.1 | GCA030176655_00928 | gene | open | 225224-225694 | |||
| 413 | JASNUC010000001.1 | GCA030176655_00929 | gene | open | 225710-226639 | |||
| 414 | JASNUC010000001.1 | GCA030176655_00930 | gene | open | 226795-227685 | |||
| 415 | JASNUC010000001.1 | GCA030176655_00931 | gene | open | 227854-228936 | |||
| 416 | JASNUC010000001.1 | GCA030176655_00932 | gene | open | 229032-230225 | menE | ||
| 417 | JASNUC010000001.1 | GCA030176655_00933 | gene | open | 230332-231351 | |||
| 418 | JASNUC010000001.1 | GCA030176655_00934 | gene | open | 231379-232533 | |||
| 419 | JASNUC010000001.1 | GCA030176655_00935 | gene | open | 232475-235222 | |||
| 420 | JASNUC010000001.1 | GCA030176655_00936 | gene | open | 235259-236053 | |||
| 421 | JASNUC010000001.1 | GCA030176655_00937 | gene | open | 236191-237969 | menD | ||
| 422 | JASNUC010000001.1 | GCA030176655_00938 | gene | open | 237982-238554 | |||
| 423 | JASNUC010000001.1 | GCA030176655_00939 | gene | open | 238597-239823 | |||
| 424 | JASNUC010000001.1 | GCA030176655_00940 | gene | open | 239833-240633 | |||
| 425 | JASNUC010000001.1 | GCA030176655_00941 | gene | open | 240828-241139 | |||
| 426 | JASNUC010000001.1 | GCA030176655_00942 | gene | open | 241256-242689 | |||
| 427 | JASNUC010000001.1 | GCA030176655_00943 | gene | open | 242800-243816 | |||
| 428 | JASNUC010000001.1 | GCA030176655_00830 | gene | open | 101840-101913 | trnP | ||
| 429 | JASNUC010000001.1 | GCA030176655_00858 | gene | open | 130384-130459 | trnT | ||
| 430 | JASNUC010000001.1 | GCA030176655_00944 | gene | open | 243954-244035 | trnY | ||
| 431 | JASNUC010000001.1 | GCA030176655_00830 | tRNA | open | 101840-101913 | trnP | tRNA-Pro(tgg) | |
| 432 | JASNUC010000001.1 | GCA030176655_00858 | tRNA | open | 130384-130459 | trnT | tRNA-Thr(cgt) | |
| 433 | JASNUC010000001.1 | GCA030176655_00944 | tRNA | open | 243954-244035 | trnY | tRNA-Tyr(gta) | |
| 434 | JASNUC010000002.1 | regulatory_region | open | 118278-118395 | L31-Corynebacteriaceae ribosomal protein leader | |||
| 435 | JASNUC010000002.1 | GCA030176655_01016 | CDS | open | 1583-3487 | _na 634_aa | typA | translational GTPase TypA |
| 436 | JASNUC010000002.1 | GCA030176655_01017 | CDS | open | 3935-4681 | _na 248_aa | Secreted protein | |
| 437 | JASNUC010000002.1 | GCA030176655_01018 | CDS | open | 4701-5327 | _na 208_aa | DUF402 domain-containing protein | |
| 438 | JASNUC010000002.1 | GCA030176655_01019 | CDS | open | 5368-6135 | _na 255_aa | zupT | zinc transporter ZupT |
| 439 | JASNUC010000002.1 | GCA030176655_01020 | CDS | open | 6313-7041 | _na 242_aa | FHA domain-containing protein | |
| 440 | JASNUC010000002.1 | GCA030176655_01021 | CDS | open | 7038-7790 | _na 250_aa | N-acetylglucosaminylphosphatidylinositol deacetylase | |
| 441 | JASNUC010000002.1 | GCA030176655_01022 | CDS | open | 7806-8510 | _na 234_aa | queuosine precursor transporter | |
| 442 | JASNUC010000002.1 | GCA030176655_01023 | CDS | open | 8546-9631 | _na 361_aa | ychF | redox-regulated ATPase YchF |
| 443 | JASNUC010000002.1 | GCA030176655_01024 | CDS | open | 9771-11279 | _na 502_aa | AI-2E family transporter | |
| 444 | JASNUC010000002.1 | GCA030176655_01025 | CDS | open | 11312-12505 | _na 397_aa | rmuC | DNA recombination protein RmuC |
| 445 | JASNUC010000002.1 | GCA030176655_01026 | CDS | open | 12517-13314 | _na 265_aa | DUF6542 domain-containing protein | |
| 446 | JASNUC010000002.1 | GCA030176655_01027 | CDS | open | 13331-14314 | _na 327_aa | 4-hydroxy-3-methylbut-2-enyl diphosphate reductase | |
| 447 | JASNUC010000002.1 | GCA030176655_01028 | CDS | open | 14407-15648 | _na 413_aa | xseA | exodeoxyribonuclease VII large subunit |
| 448 | JASNUC010000002.1 | GCA030176655_01029 | CDS | open | 15743-16036 | _na 97_aa | exodeoxyribonuclease VII small subunit | |
| 449 | JASNUC010000002.1 | GCA030176655_01030 | CDS | open | 16243-17061 | _na 272_aa | glutamine synthetase | |
| 450 | JASNUC010000002.1 | GCA030176655_01031 | CDS | open | 17154-17447 | _na 97_aa | glutamine synthetase | |
| 451 | JASNUC010000002.1 | GCA030176655_01032 | CDS | open | 17456-18154 | _na 232_aa | DUF4245 domain-containing protein | |
| 452 | JASNUC010000002.1 | GCA030176655_01033 | CDS | open | 18257-19267 | _na 336_aa | glpX | class II fructose-bisphosphatase |
| 453 | JASNUC010000002.1 | GCA030176655_01034 | CDS | open | 19400-20803 | _na 467_aa | Fumarate hydratase class II | |
| 454 | JASNUC010000002.1 | GCA030176655_01035 | CDS | open | 21086-21394 | _na 102_aa | yjdM | Protein YjdM C-terminal domain-containing protein |
| 455 | JASNUC010000002.1 | GCA030176655_01036 | CDS | open | 22662-23270 | _na 202_aa | DUF3558 domain-containing protein | |
| 456 | JASNUC010000002.1 | GCA030176655_01037 | CDS | open | 23289-25280 | _na 663_aa | PPE family domain-containing protein | |
| 457 | JASNUC010000002.1 | GCA030176655_01038 | CDS | open | 25285-26172 | _na 295_aa | hypothetical protein | |
| 458 | JASNUC010000002.1 | GCA030176655_01039 | CDS | open | 26248-27387 | _na 379_aa | DUF1444 domain-containing protein | |
| 459 | JASNUC010000002.1 | GCA030176655_01040 | CDS | open | 27407-28078 | _na 223_aa | HTH gntR-type domain-containing protein | |
| 460 | JASNUC010000002.1 | GCA030176655_01041 | CDS | open | 28272-29555 | _na 427_aa | Divalent metal cation transporter | |
| 461 | JASNUC010000002.1 | GCA030176655_01042 | CDS | open | 29636-30409 | _na 257_aa | 5-oxoprolinase subunit A | |
| 462 | JASNUC010000002.1 | GCA030176655_01043 | CDS | open | 30403-31029 | _na 208_aa | Carboxyltransferase domain-containing protein | |
| 463 | JASNUC010000002.1 | GCA030176655_01044 | CDS | open | 31023-31886 | _na 287_aa | Carboxyltransferase domain-containing protein | |
| 464 | JASNUC010000002.1 | GCA030176655_01045 | CDS | open | 31919-32446 | _na 175_aa | N-acetyltransferase domain-containing protein | |
| 465 | JASNUC010000002.1 | GCA030176655_01046 | CDS | open | 32588-33487 | _na 299_aa | lysR | LysR substrate-binding domain-containing protein |
| 466 | JASNUC010000002.1 | GCA030176655_01047 | CDS | open | 33545-33910 | _na 121_aa | Bacterial Pleckstrin-like y domain-containing protein | |
| 467 | JASNUC010000002.1 | GCA030176655_01048 | CDS | open | 34022-34504 | _na 160_aa | DUF5997 domain-containing protein | |
| 468 | JASNUC010000002.1 | GCA030176655_01049 | CDS | open | 34558-35337 | _na 259_aa | Aminotransferase class IV | |
| 469 | JASNUC010000002.1 | GCA030176655_01050 | CDS | open | 35442-36374 | _na 310_aa | Fe/B12 periplasmic-binding domain-containing protein | |
| 470 | JASNUC010000002.1 | GCA030176655_01051 | CDS | open | 36478-38670 | _na 730_aa | aminodeoxychorismate synthase | |
| 471 | JASNUC010000002.1 | GCA030176655_01052 | CDS | open | 38675-39943 | _na 422_aa | Serine hydroxymethyltransferase | |
| 472 | JASNUC010000002.1 | GCA030176655_01053 | CDS | open | 39977-40939 | _na 320_aa | coaA | type I pantothenate kinase |
| 473 | JASNUC010000002.1 | GCA030176655_01054 | CDS | open | 41006-41773 | _na 255_aa | isoprenyl transferase | |
| 474 | JASNUC010000002.1 | GCA030176655_01055 | CDS | open | 41776-42111 | _na 111_aa | hypothetical protein | |
| 475 | JASNUC010000002.1 | GCA030176655_01056 | CDS | open | 42111-42977 | _na 288_aa | mca | mycothiol conjugate amidase Mca |
| 476 | JASNUC010000002.1 | GCA030176655_01057 | CDS | open | 43125-43571 | _na 148_aa | DUF4307 domain-containing protein | |
| 477 | JASNUC010000002.1 | GCA030176655_01058 | CDS | open | 43716-44240 | _na 174_aa | greA | transcription elongation factor GreA |
| 478 | JASNUC010000002.1 | GCA030176655_01059 | CDS | open | 44254-44877 | _na 207_aa | Secreted protein | |
| 479 | JASNUC010000002.1 | GCA030176655_01060 | CDS | open | 45074-45916 | _na 280_aa | Bax inhibitor 1 like protein | |
| 480 | JASNUC010000002.1 | GCA030176655_01062 | CDS | open | 46221-47207 | _na 328_aa | Ppx/GppA phosphatase N-terminal domain-containing protein | |
| 481 | JASNUC010000002.1 | GCA030176655_01063 | CDS | open | 47245-47796 | _na 183_aa | Septum formation initiator family protein | |
| 482 | JASNUC010000002.1 | GCA030176655_01064 | CDS | open | 47850-48452 | _na 200_aa | ftsL | Cell division protein FtsL |
| 483 | JASNUC010000002.1 | GCA030176655_01065 | CDS | open | 48484-49761 | _na 425_aa | eno | phosphopyruvate hydratase |
| 484 | JASNUC010000002.1 | GCA030176655_01066 | CDS | open | 49869-50672 | _na 267_aa | Transglycosylase SLT domain-containing protein | |
| 485 | JASNUC010000002.1 | GCA030176655_01067 | CDS | open | 50685-51320 | _na 211_aa | NTP pyrophosphohydrolase MazG-like domain-containing protein | |
| 486 | JASNUC010000002.1 | GCA030176655_01068 | CDS | open | 51343-52965 | _na 540_aa | L-lysine transport protein | |
| 487 | JASNUC010000002.1 | GCA030176655_01069 | CDS | open | 53084-54151 | _na 355_aa | nadA | quinolinate synthase NadA |
| 488 | JASNUC010000002.1 | GCA030176655_01070 | CDS | open | 54152-55111 | _na 319_aa | nadC | carboxylating nicotinate-nucleotide diphosphorylase |
| 489 | JASNUC010000002.1 | GCA030176655_01071 | CDS | open | 55108-57114 | _na 668_aa | FAD-dependent urate hydroxylase HpyO/Asp monooxygenase CreE-like FAD/NAD(P)-binding domain-containing protein | |
| 490 | JASNUC010000002.1 | GCA030176655_01072 | CDS | open | 57077-57676 | _na 199_aa | HTH tetR-type domain-containing protein | |
| 491 | JASNUC010000002.1 | GCA030176655_01073 | CDS | open | 57765-58370 | _na 201_aa | DNA-3-methyladenine glycosylase | |
| 492 | JASNUC010000002.1 | GCA030176655_01074 | CDS | open | 58445-62173 | _na 1242_aa | mfd | transcription-repair coupling factor |
| 493 | JASNUC010000002.1 | GCA030176655_01076 | CDS | open | 62510-63778 | _na 422_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 494 | JASNUC010000002.1 | GCA030176655_01077 | CDS | open | 63868-65376 | _na 502_aa | glmU | bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU |
| 495 | JASNUC010000002.1 | GCA030176655_01078 | CDS | open | 65402-66391 | _na 329_aa | ribose-phosphate diphosphokinase | |
| 496 | JASNUC010000002.1 | GCA030176655_01079 | CDS | open | 66391-67161 | _na 256_aa | mabA | 3-oxoacyl-[acyl-carrier-protein] reductase MabA |
| 497 | JASNUC010000002.1 | GCA030176655_01080 | CDS | open | 67410-68096 | _na 228_aa | 50S ribosomal protein L25/general stress protein Ctc | |
| 498 | JASNUC010000002.1 | GCA030176655_01081 | CDS | open | 68156-68740 | _na 194_aa | pth | aminoacyl-tRNA hydrolase |
| 499 | JASNUC010000002.1 | GCA030176655_01082 | CDS | open | 68842-70278 | _na 478_aa | glnA | type I glutamate--ammonia ligase |
| 500 | JASNUC010000002.1 | GCA030176655_01083 | CDS | open | 70504-71325 | _na 273_aa | Class I SAM-dependent methyltransferase |

