HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Peptoniphilus harei (GCA_030223985.1)

Select a Genome:
BAKTA Annotations for GCA_030223985.1
Genome Selected: Peptoniphilus harei
ContigsBases CDSrRNA tmRNAtRNA
18 1,967,478 1793 6 1 35
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3718 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3718 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 JASOTK010000001.1 GCA030223985_00544 gene open 585376-585719 ssrA
2 JASOTK010000001.1 GCA030223985_00544 tmRNA open 585376-585719 ssrA transfer-messenger RNA%2C SsrA
3 JASOTK010000001.1 rep_origin open 500139-500561
4 JASOTK010000001.1 GCA030223985_00094 gene open 90449-90580 SpR18_sRNA
5 JASOTK010000001.1 GCA030223985_00100 gene open 96346-96478 SpR18_sRNA
6 JASOTK010000001.1 GCA030223985_00162 gene open 162426-162590 sRNA_0030
7 JASOTK010000001.1 GCA030223985_00693 gene open 750304-750488 6S
8 JASOTK010000001.1 GCA030223985_00094 ncRNA open 90449-90580 Streptococcus sRNA SpR18
9 JASOTK010000001.1 GCA030223985_00100 ncRNA open 96346-96478 Streptococcus sRNA SpR18
10 JASOTK010000001.1 GCA030223985_00162 ncRNA open 162426-162590 Enterococcus sRNA 30
11 JASOTK010000001.1 GCA030223985_00693 ncRNA open 750304-750488 6S / SsrS RNA
12 JASOTK010000001.1 regulatory_region open 21074-21195 Ribosomal protein L10 leader
13 JASOTK010000001.1 regulatory_region open 56893-57005 FMN riboswitch aptamer (RFN element)
14 JASOTK010000001.1 regulatory_region open 71164-71365 T-box leader
15 JASOTK010000001.1 regulatory_region open 165252-165481 Cis-regulator of HTH transcription factor
16 JASOTK010000001.1 regulatory_region open 166709-166806 pemK RNA
17 JASOTK010000001.1 regulatory_region open 435133-435355 T-box leader
18 JASOTK010000001.1 regulatory_region open 513002-513231 T-box leader
19 JASOTK010000001.1 regulatory_region open 514629-514853 T-box leader
20 JASOTK010000001.1 regulatory_region open 643172-643258 SAM riboswitch aptamer (S box leader)
21 JASOTK010000001.1 regulatory_region open 650827-650996 Lysine riboswitch aptamer
22 JASOTK010000001.1 regulatory_region open 692555-692800 T-box leader
23 JASOTK010000001.1 repeat_region open 340302-341012 CRISPR array with 11 repeats of length 32%2C consensus sequence ATTTCAATCCACGCACTCACGAGGAGTGCGAC and spacer length 34
24 JASOTK010000001.1 repeat_region open 341037-341427 CRISPR array with 6 repeats of length 32%2C consensus sequence ATTTCAATCCACGCACCCGCGAAGGGTGCGAC and spacer length 37
25 JASOTK010000001.1 repeat_region open 341520-345639 CRISPR array with 62 repeats of length 32%2C consensus sequence ATTTCAATCCACGCACCCGCGAGGGGTGCGAC and spacer length 34
26 JASOTK010000001.1 GCA030223985_00011 CDS open 721-954 _na     77_aa hypothetical protein
27 JASOTK010000001.1 GCA030223985_00012 CDS open 1117-1587 _na     156_aa Phosphohydrolase
28 JASOTK010000001.1 GCA030223985_00013 CDS open 1584-2285 _na     233_aa ABC transporter permease
29 JASOTK010000001.1 GCA030223985_00014 CDS open 2516-4249 _na     577_aa pyk pyruvate kinase
30 JASOTK010000001.1 GCA030223985_00015 CDS open 4259-5212 _na     317_aa pfkA ATP-dependent 6-phosphofructokinase
31 JASOTK010000001.1 GCA030223985_00016 CDS open 5219-8644 _na     1141_aa dnaE DNA polymerase III subunit alpha
32 JASOTK010000001.1 GCA030223985_00017 CDS open 8905-9171 _na     88_aa ptsH Phosphocarrier protein HPr
33 JASOTK010000001.1 GCA030223985_00018 CDS open 9173-10108 _na     311_aa whiA DNA-binding protein WhiA
34 JASOTK010000001.1 GCA030223985_00019 CDS open 10295-11383 _na     362_aa surA peptidylprolyl isomerase
35 JASOTK010000001.1 GCA030223985_00020 CDS open 11436-14915 _na     1159_aa mfd transcription-repair coupling factor
36 JASOTK010000001.1 GCA030223985_00021 CDS open 14924-15493 _na     189_aa pth aminoacyl-tRNA hydrolase
37 JASOTK010000001.1 GCA030223985_00022 CDS open 15503-16453 _na     316_aa prsA Ribose-phosphate pyrophosphokinase
38 JASOTK010000001.1 GCA030223985_00023 CDS open 16467-17846 _na     459_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
39 JASOTK010000001.1 GCA030223985_00024 CDS open 18007-18144 _na     45_aa hypothetical protein
40 JASOTK010000001.1 GCA030223985_00025 CDS open 18495-19385 _na     296_aa cysK cysteine synthase A
41 JASOTK010000001.1 GCA030223985_00026 CDS open 19378-19929 _na     183_aa epsC serine O-acetyltransferase EpsC
42 JASOTK010000001.1 GCA030223985_00027 CDS open 20091-20477 _na     128_aa rplL 50S ribosomal protein L7/L12
43 JASOTK010000001.1 GCA030223985_00028 CDS open 20529-21119 _na     196_aa rplJ 50S ribosomal protein L10
44 JASOTK010000001.1 GCA030223985_00029 CDS open 21686-22327 _na     213_aa yitT YitT family protein
45 JASOTK010000001.1 GCA030223985_00030 CDS open 22797-23498 _na     233_aa rplA 50S ribosomal protein L1
46 JASOTK010000001.1 GCA030223985_00031 CDS open 23538-23963 _na     141_aa rplK 50S ribosomal protein L11
47 JASOTK010000001.1 GCA030223985_00032 CDS open 24011-24553 _na     180_aa nusG transcription termination/antitermination protein NusG
48 JASOTK010000001.1 GCA030223985_00033 CDS open 24568-24783 _na     71_aa secE preprotein translocase subunit SecE
49 JASOTK010000001.1 GCA030223985_00034 CDS open 24793-24942 _na     49_aa rpmG 50S ribosomal protein L33
50 JASOTK010000001.1 GCA030223985_00035 CDS open 25128-26015 _na     295_aa CAAX amino terminal protease family protein
51 JASOTK010000001.1 GCA030223985_00036 CDS open 26048-28348 _na     766_aa dinG DEAD2 domain protein
52 JASOTK010000001.1 GCA030223985_00037 CDS open 28378-28842 _na     154_aa trmL Putative tRNA (cytidine(34)-2'-O)-methyltransferase
53 JASOTK010000001.1 GCA030223985_00038 CDS open 28836-30392 _na     518_aa Pyridine nucleotide-disulfide oxidoreductase
54 JASOTK010000001.1 GCA030223985_00039 CDS open 30499-31653 _na     384_aa histidine kinase
55 JASOTK010000001.1 GCA030223985_00040 CDS open 31640-32314 _na     224_aa ompR Response regulator ArlR
56 JASOTK010000001.1 GCA030223985_00041 CDS open 32311-32787 _na     158_aa dihydrofolate reductase
57 JASOTK010000001.1 GCA030223985_00043 CDS open 33136-33591 _na     151_aa Glyoxalase family protein
58 JASOTK010000001.1 GCA030223985_00044 CDS open 33782-35047 _na     421_aa gdhA Glutamate dehydrogenase
59 JASOTK010000001.1 GCA030223985_00045 CDS open 35464-36348 _na     294_aa yitT Putative membrane protein
60 JASOTK010000001.1 GCA030223985_00046 CDS open 36565-37260 _na     231_aa CAAX amino terminal protease family protein
61 JASOTK010000001.1 GCA030223985_00047 CDS open 37253-37792 _na     179_aa 5-formyltetrahydrofolate cyclo-ligase
62 JASOTK010000001.1 GCA030223985_00048 CDS open 37785-40397 _na     870_aa PD-(D/E)XK endonuclease-like domain-containing protein
63 JASOTK010000001.1 GCA030223985_00049 CDS open 40378-41367 _na     329_aa Pseudouridine synthase
64 JASOTK010000001.1 GCA030223985_00050 CDS open 41441-42127 _na     228_aa YceG-like family protein
65 JASOTK010000001.1 GCA030223985_00051 CDS open 43050-44135 _na     361_aa pepP putative peptidase SA1530
66 JASOTK010000001.1 GCA030223985_00052 CDS open 45505-45723 _na     72_aa DUF2922 domain-containing protein
67 JASOTK010000001.1 GCA030223985_00053 CDS open 45810-46031 _na     73_aa DUF1659 domain-containing protein
68 JASOTK010000001.1 GCA030223985_00054 CDS open 46115-46591 _na     158_aa N-acetylmuramoyl-L-alanine amidase
69 JASOTK010000001.1 GCA030223985_00055 CDS open 46604-47344 _na     246_aa Sigma-70%2C region 4
70 JASOTK010000001.1 GCA030223985_00056 CDS open 48744-49433 _na     229_aa SMODS and SLOG-associating 2TM effector domain-containing protein
71 JASOTK010000001.1 GCA030223985_00057 CDS open 49516-52245 _na     909_aa SLH domain-containing protein
72 JASOTK010000001.1 GCA030223985_00058 CDS open 53018-53341 _na     107_aa Addiction module toxin%2C RelE/StbE family
73 JASOTK010000001.1 GCA030223985_00059 CDS open 53338-53658 _na     106_aa Antitoxin
74 JASOTK010000001.1 GCA030223985_00060 CDS open 54977-56101 _na     374_aa pucG Purine catabolism protein PucG
75 JASOTK010000001.1 GCA030223985_00061 CDS open 56235-56840 _na     201_aa fmnP Riboflavin transporter
76 JASOTK010000001.1 GCA030223985_00062 CDS open 57111-58550 _na     479_aa L%2CD-TPase catalytic domain-containing protein
77 JASOTK010000001.1 GCA030223985_00063 CDS open 58691-59260 _na     189_aa fic protein adenylyltransferase Fic
78 JASOTK010000001.1 GCA030223985_00065 CDS open 59756-60685 _na     309_aa mdh L-lactate dehydrogenase
79 JASOTK010000001.1 GCA030223985_00066 CDS open 60714-61115 _na     133_aa Zn-finger containing protein
80 JASOTK010000001.1 GCA030223985_00067 CDS open 61181-62344 _na     387_aa abgB Peptidase M20 domain-containing protein 2
81 JASOTK010000001.1 GCA030223985_00068 CDS open 62364-63752 _na     462_aa C4-dicarboxylate anaerobic carrier
82 JASOTK010000001.1 GCA030223985_00069 CDS open 63927-64214 _na     95_aa lysR LysR family transcriptional regulator
83 JASOTK010000001.1 GCA030223985_00070 CDS open 64220-64813 _na     197_aa lysR LysR substrate binding domain protein
84 JASOTK010000001.1 GCA030223985_00071 CDS open 64946-65839 _na     297_aa Copper amine oxidase-like N-terminal domain-containing protein
85 JASOTK010000001.1 GCA030223985_00072 CDS open 65954-67072 _na     372_aa Copper amine oxidase N-terminal domain protein
86 JASOTK010000001.1 GCA030223985_00073 CDS open 67142-68440 _na     432_aa folC tetrahydrofolate synthase
87 JASOTK010000001.1 GCA030223985_00074 CDS open 68437-71088 _na     883_aa valS valine--tRNA ligase
88 JASOTK010000001.1 GCA030223985_00075 CDS open 71353-72144 _na     263_aa hypothetical protein
89 JASOTK010000001.1 GCA030223985_00076 CDS open 72208-73200 _na     330_aa trpS tryptophan--tRNA ligase
90 JASOTK010000001.1 GCA030223985_00077 CDS open 73190-74113 _na     307_aa CAAX amino terminal protease family protein
91 JASOTK010000001.1 GCA030223985_00078 CDS open 74055-75338 _na     427_aa ssnA 5-methylthioadenosine/S-adenosylhomocysteine deaminase
92 JASOTK010000001.1 GCA030223985_00079 CDS open 75442-76089 _na     215_aa yadS Glycine transporter domain-containing protein
93 JASOTK010000001.1 GCA030223985_00080 CDS open 76100-76411 _na     103_aa Thiamine-binding protein domain-containing protein
94 JASOTK010000001.1 GCA030223985_00081 CDS open 76594-77556 _na     320_aa Peptidase family T4
95 JASOTK010000001.1 GCA030223985_00082 CDS open 77606-78355 _na     249_aa ECF transporter S component
96 JASOTK010000001.1 GCA030223985_00083 CDS open 78357-79139 _na     260_aa coaX Type III pantothenate kinase
97 JASOTK010000001.1 GCA030223985_00084 CDS open 79158-79988 _na     276_aa murI glutamate racemase
98 JASOTK010000001.1 GCA030223985_00086 CDS open 80323-80991 _na     222_aa gntR Transcriptional regulator%2C GntR family
99 JASOTK010000001.1 GCA030223985_00087 CDS open 81186-81809 _na     207_aa PepSY domain-containing protein
100 JASOTK010000001.1 GCA030223985_00088 CDS open 82029-82331 _na     100_aa DUF3870 domain-containing protein
101 JASOTK010000001.1 GCA030223985_00089 CDS open 82333-83121 _na     262_aa Beta-lactamase class A catalytic domain-containing protein
102 JASOTK010000001.1 GCA030223985_00090 CDS open 83147-84328 _na     393_aa DUF819 domain-containing protein
103 JASOTK010000001.1 GCA030223985_00091 CDS open 84381-85475 _na     364_aa Dipeptide epimerase
104 JASOTK010000001.1 GCA030223985_00092 CDS open 85948-88686 _na     912_aa secA preprotein translocase subunit SecA
105 JASOTK010000001.1 GCA030223985_00093 CDS open 88903-90423 _na     506_aa guaA glutamine-hydrolyzing GMP synthase
106 JASOTK010000001.1 GCA030223985_00095 CDS open 91399-91527 _na     42_aa hypothetical protein
107 JASOTK010000001.1 GCA030223985_00096 CDS open 91656-91925 _na     89_aa transposase
108 JASOTK010000001.1 GCA030223985_00097 CDS open 92258-92707 _na     149_aa CopY/TcrY family copper transport repressor
109 JASOTK010000001.1 GCA030223985_00098 CDS open 92727-94829 _na     700_aa zntA P-type Cu(+) transporter
110 JASOTK010000001.1 GCA030223985_00099 CDS open 95029-95421 _na     130_aa Endonuclease GajA/Old nuclease/RecF-like AAA domain-containing protein
111 JASOTK010000001.1 GCA030223985_00101 CDS open 97112-97537 _na     141_aa HTH marR-type domain-containing protein
112 JASOTK010000001.1 GCA030223985_00102 CDS open 97539-97901 _na     120_aa Lipoprotein
113 JASOTK010000001.1 GCA030223985_00103 CDS open 98306-100837 _na     843_aa mgtA magnesium-translocating P-type ATPase
114 JASOTK010000001.1 GCA030223985_00104 CDS open 101189-102499 _na     436_aa metL1 aspartate kinase
115 JASOTK010000001.1 GCA030223985_00105 CDS open 102502-103479 _na     325_aa asd aspartate-semialdehyde dehydrogenase
116 JASOTK010000001.1 GCA030223985_00106 CDS open 103481-104662 _na     393_aa thrA Homoserine dehydrogenase
117 JASOTK010000001.1 GCA030223985_00107 CDS open 104659-106953 _na     764_aa thrB homoserine kinase
118 JASOTK010000001.1 GCA030223985_00108 CDS open 107049-108461 _na     470_aa Aldehyde dehydrogenase (NAD) family protein
119 JASOTK010000001.1 GCA030223985_00109 CDS open 108442-109278 _na     278_aa eutJ ethanolamine utilization protein EutJ
120 JASOTK010000001.1 GCA030223985_00110 CDS open 109283-109930 _na     215_aa Phosphate propanoyltransferase
121 JASOTK010000001.1 GCA030223985_00111 CDS open 109944-110807 _na     287_aa Permease
122 JASOTK010000001.1 GCA030223985_00112 CDS open 110815-111960 _na     381_aa metK methionine adenosyltransferase
123 JASOTK010000001.1 GCA030223985_00113 CDS open 111965-112966 _na     333_aa araC Transcriptional regulator%2C AraC family
124 JASOTK010000001.1 GCA030223985_00114 CDS open 112976-114262 _na     428_aa pocR PocR domain-containing protein
125 JASOTK010000001.1 GCA030223985_00115 CDS open 114307-115416 _na     369_aa Putative NADPH-dependent butanol dehydrogenase
126 JASOTK010000001.1 GCA030223985_00116 CDS open 115535-116740 _na     401_aa Aldehyde dehydrogenase (NAD) family protein
127 JASOTK010000001.1 GCA030223985_00117 CDS open 116749-117012 _na     87_aa ccmL Carbon dioxide concentrating mechanism protein CcmL
128 JASOTK010000001.1 GCA030223985_00118 CDS open 117020-117553 _na     177_aa BMC domain protein
129 JASOTK010000001.1 GCA030223985_00119 CDS open 117546-118070 _na     174_aa hypothetical protein
130 JASOTK010000001.1 GCA030223985_00120 CDS open 118156-118437 _na     93_aa pduA propanediol utilization microcompartment protein PduA
131 JASOTK010000001.1 GCA030223985_00121 CDS open 118462-119247 _na     261_aa pduB propanediol utilization microcompartment protein PduB
132 JASOTK010000001.1 GCA030223985_00122 CDS open 119258-120175 _na     305_aa Putative pyruvate formate-lyase 1-activating enzyme
133 JASOTK010000001.1 GCA030223985_00123 CDS open 120189-122762 _na     857_aa Formate C-acetyltransferase
134 JASOTK010000001.1 GCA030223985_00124 CDS open 123051-123581 _na     176_aa BMC domain protein
135 JASOTK010000001.1 GCA030223985_00125 CDS open 123572-125290 _na     572_aa Tetratricopeptide repeat protein
136 JASOTK010000001.1 GCA030223985_00126 CDS open 125298-125888 _na     196_aa DUF4125 domain-containing protein
137 JASOTK010000001.1 GCA030223985_00127 CDS open 126148-126654 _na     168_aa eCF-S ECF transporter S component
138 JASOTK010000001.1 GCA030223985_00128 CDS open 126710-127435 _na     241_aa Fic family protein
139 JASOTK010000001.1 GCA030223985_00129 CDS open 127531-128451 _na     306_aa hslO Hsp33 family molecular chaperone HslO
140 JASOTK010000001.1 GCA030223985_00130 CDS open 128454-129179 _na     241_aa Methyltransferase
141 JASOTK010000001.1 GCA030223985_00131 CDS open 129176-129913 _na     245_aa sIR2 protein acetyllysine N-acetyltransferase
142 JASOTK010000001.1 GCA030223985_00132 CDS open 129925-130872 _na     315_aa ydiL CAAX amino terminal protease family protein
143 JASOTK010000001.1 GCA030223985_00133 CDS open 130826-131353 _na     175_aa hpt hypoxanthine phosphoribosyltransferase
144 JASOTK010000001.1 GCA030223985_00134 CDS open 131451-131975 _na     174_aa DUF4364 domain-containing protein
145 JASOTK010000001.1 GCA030223985_00135 CDS open 132043-134118 _na     691_aa zntA Cd(2+)-exporting ATPase
146 JASOTK010000001.1 GCA030223985_00136 CDS open 134120-134437 _na     105_aa DUF1490 domain-containing protein
147 JASOTK010000001.1 GCA030223985_00137 CDS open 134877-136547 _na     556_aa histidine kinase
148 JASOTK010000001.1 GCA030223985_00138 CDS open 136549-137229 _na     226_aa ompR Response regulator ArlR
149 JASOTK010000001.1 GCA030223985_00139 CDS open 137260-137898 _na     212_aa phoU phosphate signaling complex protein PhoU
150 JASOTK010000001.1 GCA030223985_00140 CDS open 137898-138653 _na     251_aa pstB phosphate ABC transporter ATP-binding protein PstB
151 JASOTK010000001.1 GCA030223985_00141 CDS open 138653-139534 _na     293_aa pstA phosphate ABC transporter permease PstA
152 JASOTK010000001.1 GCA030223985_00142 CDS open 139527-140435 _na     302_aa pstC phosphate ABC transporter permease subunit PstC
153 JASOTK010000001.1 GCA030223985_00143 CDS open 140453-141355 _na     300_aa Phosphate ABC transporter%2C phosphate-binding protein
154 JASOTK010000001.1 GCA030223985_00144 CDS open 141530-142039 _na     169_aa niaR putative transcription repressor NiaR
155 JASOTK010000001.1 GCA030223985_00145 CDS open 142047-142892 _na     281_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
156 JASOTK010000001.1 GCA030223985_00146 CDS open 142864-144126 _na     420_aa nadB L-aspartate oxidase
157 JASOTK010000001.1 GCA030223985_00147 CDS open 144128-145045 _na     305_aa nadA quinolinate synthase NadA
158 JASOTK010000001.1 GCA030223985_00148 CDS open 145339-146349 _na     336_aa gcvT Aminomethyltransferase
159 JASOTK010000001.1 GCA030223985_00149 CDS open 146516-148996 _na     826_aa Efflux ABC transporter%2C permease protein
160 JASOTK010000001.1 GCA030223985_00150 CDS open 148980-149657 _na     225_aa lolD ABC transporter domain-containing protein
161 JASOTK010000001.1 GCA030223985_00151 CDS open 149746-150543 _na     265_aa kdpD histidine kinase
162 JASOTK010000001.1 GCA030223985_00152 CDS open 150913-151227 _na     104_aa Conjugal transfer protein
163 JASOTK010000001.1 GCA030223985_00153 CDS open 151246-151629 _na     127_aa Conjugative transposon protein
164 JASOTK010000001.1 GCA030223985_00154 CDS open 151669-153063 _na     464_aa ftsK FtsK domain-containing protein
165 JASOTK010000001.1 GCA030223985_00155 CDS open 153296-154444 _na     382_aa mobT MobT family relaxase
166 JASOTK010000001.1 GCA030223985_00156 CDS open 154487-154708 _na     73_aa Conjugal transfer protein
167 JASOTK010000001.1 GCA030223985_00157 CDS open 154825-155322 _na     165_aa Conjugative transposon protein
168 JASOTK010000001.1 GCA030223985_00158 CDS open 155712-158159 _na     815_aa virB4 ATP/GTP-binding protein
169 JASOTK010000001.1 GCA030223985_00159 CDS open 158162-160339 _na     725_aa ytxH YtxH domain-containing protein
170 JASOTK010000001.1 GCA030223985_00160 CDS open 160336-161337 _na     333_aa nlpC NlpC/P60 domain-containing protein
171 JASOTK010000001.1 GCA030223985_00161 CDS open 161334-162269 _na     311_aa Conjugal transfer protein
172 JASOTK010000001.1 GCA030223985_00164 CDS open 162646-164565 _na     639_aa tet(M) tetracycline resistance ribosomal protection protein Tet(M)
173 JASOTK010000001.1 GCA030223985_00165 CDS open 164911-165264 _na     117_aa hipB HTH cro/C1-type domain-containing protein
174 JASOTK010000001.1 GCA030223985_00166 CDS open 165769-166194 _na     141_aa rpoE RNA polymerase sigma factor 70 region 4 type 2 domain-containing protein
175 JASOTK010000001.1 GCA030223985_00167 CDS open 166191-166421 _na     76_aa Helix-turn-helix conjugative transposon-like domain-containing protein
176 JASOTK010000001.1 GCA030223985_00168 CDS open 166883-167086 _na     67_aa DNA binding domain%2C excisionase family
177 JASOTK010000001.1 GCA030223985_00169 CDS open 167168-168385 _na     405_aa xerD Integrase
178 JASOTK010000001.1 GCA030223985_00170 CDS open 168598-169266 _na     222_aa ompR Response regulator receiver domain-containing protein
179 JASOTK010000001.1 GCA030223985_00171 CDS open 169628-173629 _na     1333_aa Efflux ABC transporter%2C permease protein
180 JASOTK010000001.1 GCA030223985_00172 CDS open 173637-174404 _na     255_aa lolD Lipoprotein-releasing system ATP-binding protein LolD
181 JASOTK010000001.1 GCA030223985_00173 CDS open 174503-174958 _na     151_aa smpB SsrA-binding protein SmpB
182 JASOTK010000001.1 GCA030223985_00174 CDS open 174951-177053 _na     700_aa rnr ribonuclease R
183 JASOTK010000001.1 GCA030223985_00175 CDS open 177053-178225 _na     390_aa ddlA D-alanine--D-alanine ligase
184 JASOTK010000001.1 GCA030223985_00176 CDS open 178230-179783 _na     517_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
185 JASOTK010000001.1 GCA030223985_00177 CDS open 179793-180563 _na     256_aa menH Dihydrolipoyllysine-residue acetyltransferase component of acetoin cleaving system
186 JASOTK010000001.1 GCA030223985_00178 CDS open 180550-180996 _na     148_aa hypothetical protein
187 JASOTK010000001.1 GCA030223985_00179 CDS open 181103-181342 _na     79_aa grxC Glutaredoxin
188 JASOTK010000001.1 GCA030223985_00180 CDS open 181381-182274 _na     297_aa DUF1700 domain-containing protein
189 JASOTK010000001.1 GCA030223985_00181 CDS open 182549-183535 _na     328_aa G5 domain-containing protein
190 JASOTK010000001.1 GCA030223985_00182 CDS open 183979-184608 _na     209_aa Hydrolase%2C NUDIX family
191 JASOTK010000001.1 GCA030223985_00183 CDS open 184598-185629 _na     343_aa Phospholipase%2C patatin family
192 JASOTK010000001.1 GCA030223985_00184 CDS open 185626-186045 _na     139_aa mscL large conductance mechanosensitive channel protein MscL
193 JASOTK010000001.1 GCA030223985_00185 CDS open 186239-187096 _na     285_aa Putative membrane protein
194 JASOTK010000001.1 GCA030223985_00186 CDS open 187376-188824 _na     482_aa Xaa-His dipeptidase
195 JASOTK010000001.1 GCA030223985_00187 CDS open 188834-190243 _na     469_aa p-aminobenzoyl-glutamate transporter
196 JASOTK010000001.1 GCA030223985_00188 CDS open 190650-191297 _na     215_aa tetR Transcriptional regulator%2C TetR family
197 JASOTK010000001.1 GCA030223985_00189 CDS open 191641-192060 _na     139_aa comEB Putative ComE operon protein 2
198 JASOTK010000001.1 GCA030223985_00190 CDS open 192057-192635 _na     192_aa rnh1 ribonuclease H
199 JASOTK010000001.1 GCA030223985_00191 CDS open 192724-193614 _na     296_aa fructose bisphosphate aldolase
200 JASOTK010000001.1 GCA030223985_00192 CDS open 193914-195557 _na     547_aa Tryptophan 2%2C3-dioxygenase
201 JASOTK010000001.1 GCA030223985_00193 CDS open 195643-196983 _na     446_aa Sodium:neurotransmitter symporter family protein
202 JASOTK010000001.1 GCA030223985_00194 CDS open 197052-197741 _na     229_aa gloB hydroxyacylglutathione hydrolase
203 JASOTK010000001.1 GCA030223985_00195 CDS open 198451-200073 _na     540_aa groL chaperonin GroEL
204 JASOTK010000001.1 GCA030223985_00196 CDS open 200103-200384 _na     93_aa groES Co-chaperonin GroES
205 JASOTK010000001.1 GCA030223985_00197 CDS open 201382-201918 _na     178_aa 6-O-methylguanine DNA methyltransferase%2C DNA binding domain protein
206 JASOTK010000001.1 GCA030223985_00198 CDS open 201966-202307 _na     113_aa rplQ 50S ribosomal protein L17
207 JASOTK010000001.1 GCA030223985_00199 CDS open 202318-203265 _na     315_aa rpoA DNA-directed RNA polymerase subunit alpha
208 JASOTK010000001.1 GCA030223985_00200 CDS open 203292-203687 _na     131_aa rpsK 30S ribosomal protein S11
209 JASOTK010000001.1 GCA030223985_00201 CDS open 203700-204062 _na     120_aa rpsM 30S ribosomal protein S13
210 JASOTK010000001.1 GCA030223985_00202 CDS open 204074-204187 _na     37_aa rpmJ 50S ribosomal protein L36
211 JASOTK010000001.1 GCA030223985_00203 CDS open 204210-204428 _na     72_aa infA translation initiation factor IF-1
212 JASOTK010000001.1 GCA030223985_00204 CDS open 204447-204668 _na     73_aa 50S ribosomal protein L14e
213 JASOTK010000001.1 GCA030223985_00205 CDS open 204705-205346 _na     213_aa adk adenylate kinase
214 JASOTK010000001.1 GCA030223985_00206 CDS open 205356-206636 _na     426_aa secY preprotein translocase subunit SecY
215 JASOTK010000001.1 GCA030223985_00207 CDS open 206636-207085 _na     149_aa rplO 50S ribosomal protein L15
216 JASOTK010000001.1 GCA030223985_00208 CDS open 207099-207275 _na     58_aa rpmD 50S ribosomal protein L30
217 JASOTK010000001.1 GCA030223985_00209 CDS open 207286-207792 _na     168_aa rpsE 30S ribosomal protein S5
218 JASOTK010000001.1 GCA030223985_00210 CDS open 207806-208168 _na     120_aa rplR 50S ribosomal protein L18
219 JASOTK010000001.1 GCA030223985_00211 CDS open 208184-208720 _na     178_aa rplF 50S ribosomal protein L6
220 JASOTK010000001.1 GCA030223985_00212 CDS open 208735-209130 _na     131_aa rpsH 30S ribosomal protein S8
221 JASOTK010000001.1 GCA030223985_00213 CDS open 209161-209346 _na     61_aa rpsN type Z 30S ribosomal protein S14
222 JASOTK010000001.1 GCA030223985_00214 CDS open 209358-209903 _na     181_aa rplE 50S ribosomal protein L5
223 JASOTK010000001.1 GCA030223985_00215 CDS open 209915-210223 _na     102_aa rplX 50S ribosomal protein L24
224 JASOTK010000001.1 GCA030223985_00216 CDS open 210238-210606 _na     122_aa rplN 50S ribosomal protein L14
225 JASOTK010000001.1 GCA030223985_00217 CDS open 210630-210884 _na     84_aa rpsQ 30S ribosomal protein S17
226 JASOTK010000001.1 GCA030223985_00218 CDS open 210889-211095 _na     68_aa rpmC 50S ribosomal protein L29
227 JASOTK010000001.1 GCA030223985_00219 CDS open 211085-211516 _na     143_aa rplP 50S ribosomal protein L16
228 JASOTK010000001.1 GCA030223985_00220 CDS open 211534-212289 _na     251_aa rpsC 30S ribosomal protein S3
229 JASOTK010000001.1 GCA030223985_00221 CDS open 212301-212636 _na     111_aa rplV 50S ribosomal protein L22
230 JASOTK010000001.1 GCA030223985_00222 CDS open 212648-212932 _na     94_aa rpsS 30S ribosomal protein S19
231 JASOTK010000001.1 GCA030223985_00223 CDS open 212946-213776 _na     276_aa rplB 50S ribosomal protein L2
232 JASOTK010000001.1 GCA030223985_00224 CDS open 213795-214082 _na     95_aa rplW 50S ribosomal protein L23
233 JASOTK010000001.1 GCA030223985_00225 CDS open 214082-214705 _na     207_aa rplD 50S ribosomal protein L4
234 JASOTK010000001.1 GCA030223985_00226 CDS open 214723-215355 _na     210_aa rplC 50S ribosomal protein L3
235 JASOTK010000001.1 GCA030223985_00227 CDS open 215414-215731 _na     105_aa rpsJ 30S ribosomal protein S10
236 JASOTK010000001.1 GCA030223985_00228 CDS open 216442-217965 _na     507_aa ahpF alkyl hydroperoxide reductase subunit F
237 JASOTK010000001.1 GCA030223985_00229 CDS open 217965-218534 _na     189_aa ahpC alkyl hydroperoxide reductase subunit C
238 JASOTK010000001.1 GCA030223985_00230 CDS open 219017-219814 _na     265_aa fixA Electron transfer flavoprotein small subunit
239 JASOTK010000001.1 GCA030223985_00231 CDS open 219823-220818 _na     331_aa fixB Electron transfer flavoprotein large subunit
240 JASOTK010000001.1 GCA030223985_00232 CDS open 221579-222271 _na     230_aa lrgB Murein hydrolase effector protein LrgB
241 JASOTK010000001.1 GCA030223985_00233 CDS open 222264-222614 _na     116_aa lrgA LrgA family protein
242 JASOTK010000001.1 GCA030223985_00234 CDS open 222628-223599 _na     323_aa fixB Electron transfer flavoprotein large subunit
243 JASOTK010000001.1 GCA030223985_00235 CDS open 223612-224382 _na     256_aa fixA Electron transfer flavoprotein small subunit
244 JASOTK010000001.1 GCA030223985_00236 CDS open 224393-225529 _na     378_aa caiA Acyl-CoA dehydrogenase
245 JASOTK010000001.1 GCA030223985_00237 CDS open 225549-226961 _na     470_aa glcD putative FAD-linked oxidoreductase Rv2280
246 JASOTK010000001.1 GCA030223985_00238 CDS open 227132-228568 _na     478_aa HTH cro/C1-type domain-containing protein
247 JASOTK010000001.1 GCA030223985_00239 CDS open 228908-235486 _na     2192_aa SLH domain-containing protein
248 JASOTK010000001.1 GCA030223985_00240 CDS open 236134-237846 _na     570_aa yfcC putative basic amino acid antiporter YfcC
249 JASOTK010000001.1 GCA030223985_00241 CDS open 237859-239043 _na     394_aa iadA beta-aspartyl-peptidase
250 JASOTK010000001.1 GCA030223985_00242 CDS open 239380-240210 _na     276_aa Sortase family protein
251 JASOTK010000001.1 GCA030223985_00243 CDS open 240200-241030 _na     276_aa srtA Sortase family protein
252 JASOTK010000001.1 GCA030223985_00244 CDS open 241014-242030 _na     338_aa Sortase family protein
253 JASOTK010000001.1 GCA030223985_00245 CDS open 242070-243287 _na     405_aa LPXTG-motif cell wall anchor domain protein
254 JASOTK010000001.1 GCA030223985_00246 CDS open 243394-245568 _na     724_aa isopeptide-forming domain-containing fimbrial protein
255 JASOTK010000001.1 GCA030223985_00247 CDS open 246205-260373 _na     4722_aa spaA SpaA isopeptide-forming pilin-related protein
256 JASOTK010000001.1 GCA030223985_00248 CDS open 261508-262761 _na     417_aa macB Macrolide export ATP-binding/permease protein MacB
257 JASOTK010000001.1 GCA030223985_00249 CDS open 262761-263444 _na     227_aa macB Macrolide export ATP-binding/permease protein MacB
258 JASOTK010000001.1 GCA030223985_00250 CDS open 263441-265585 _na     714_aa efflux RND transporter periplasmic adaptor subunit
259 JASOTK010000001.1 GCA030223985_00251 CDS open 265758-267059 _na     433_aa Na+/H+ antiporter family protein
260 JASOTK010000001.1 GCA030223985_00252 CDS open 267315-267959 _na     214_aa opuBB ABC transporter permease
261 JASOTK010000001.1 GCA030223985_00253 CDS open 267952-268929 _na     325_aa osmF Glycine betaine/carnitine/choline-binding protein
262 JASOTK010000001.1 GCA030223985_00254 CDS open 268929-269564 _na     211_aa opuBB Choline transport system permease protein opuBB
263 JASOTK010000001.1 GCA030223985_00255 CDS open 269557-270777 _na     406_aa opuBA Quaternary amine transport ATP-binding protein
264 JASOTK010000001.1 GCA030223985_00256 CDS open 271139-272347 _na     402_aa ATP synthase F0%2C A subunit
265 JASOTK010000001.1 GCA030223985_00257 CDS open 272367-272810 _na     147_aa hypothetical protein
266 JASOTK010000001.1 GCA030223985_00258 CDS open 272813-273679 _na     288_aa Radical SAM domain protein
267 JASOTK010000001.1 GCA030223985_00259 CDS open 273712-275166 _na     484_aa pncB nicotinate phosphoribosyltransferase
268 JASOTK010000001.1 GCA030223985_00260 CDS open 275440-276258 _na     272_aa ttcA tRNA 2-thiocytidine biosynthesis protein TtcA
269 JASOTK010000001.1 GCA030223985_00261 CDS open 276380-277591 _na     403_aa norV Anaerobic nitric oxide reductase flavorubredoxin
270 JASOTK010000001.1 GCA030223985_00262 CDS open 278409-278759 _na     116_aa Transcriptional regulator%2C Spx/MgsR family
271 JASOTK010000001.1 GCA030223985_00263 CDS open 278850-280376 _na     508_aa trkA Putative ATP synthase F0%2C A subunit
272 JASOTK010000001.1 GCA030223985_00264 CDS open 280366-281562 _na     398_aa DUF4825 domain-containing protein
273 JASOTK010000001.1 GCA030223985_00265 CDS open 281674-283032 _na     452_aa norM MATE efflux family protein
274 JASOTK010000001.1 GCA030223985_00266 CDS open 283025-283651 _na     208_aa NAD(P)H-hydrate epimerase
275 JASOTK010000001.1 GCA030223985_00267 CDS open 283942-284577 _na     211_aa Melibiose operon regulatory protein
276 JASOTK010000001.1 GCA030223985_00268 CDS open 284633-286069 _na     478_aa algI Putative alginate O-acetyltransferase AlgI
277 JASOTK010000001.1 GCA030223985_00269 CDS open 286078-287106 _na     342_aa Putative lipoprotein
278 JASOTK010000001.1 GCA030223985_00270 CDS open 287280-288155 _na     291_aa lysR LysR substrate binding domain protein
279 JASOTK010000001.1 GCA030223985_00271 CDS open 288157-288678 _na     173_aa PAP2 family protein
280 JASOTK010000001.1 GCA030223985_00272 CDS open 288686-289375 _na     229_aa hypothetical protein
281 JASOTK010000001.1 GCA030223985_00273 CDS open 289404-290009 _na     201_aa Peptidase C39-like domain-containing protein
282 JASOTK010000001.1 GCA030223985_00274 CDS open 290049-290786 _na     245_aa Putative DNA metabolism protein
283 JASOTK010000001.1 GCA030223985_00275 CDS open 291131-292729 _na     532_aa nptA Na/Pi cotransporter family protein
284 JASOTK010000001.1 GCA030223985_00276 CDS open 292931-294151 _na     406_aa btlA Transporter%2C major facilitator family protein
285 JASOTK010000001.1 GCA030223985_00277 CDS open 294184-294456 _na     90_aa CrcB-like protein
286 JASOTK010000001.1 GCA030223985_00278 CDS open 294458-294997 _na     179_aa [ribosomal protein uS5]-alanine N-acetyltransferase
287 JASOTK010000001.1 GCA030223985_00279 CDS open 295002-295421 _na     139_aa Histidine kinase
288 JASOTK010000001.1 GCA030223985_00280 CDS open 295430-295642 _na     70_aa xRE DNA-binding helix-turn-helix protein
289 JASOTK010000001.1 GCA030223985_00281 CDS open 295836-296240 _na     134_aa Manganese transport regulator
290 JASOTK010000001.1 GCA030223985_00282 CDS open 296237-297349 _na     370_aa ABC 3 transport family protein
291 JASOTK010000001.1 GCA030223985_00283 CDS open 297346-298227 _na     293_aa ABC 3 transport family protein
292 JASOTK010000001.1 GCA030223985_00284 CDS open 298220-298945 _na     241_aa mntA Manganese transport system ATP-binding protein MntA
293 JASOTK010000001.1 GCA030223985_00285 CDS open 298955-299908 _na     317_aa Putative manganese ABC transporter substrate-binding lipoprotein
294 JASOTK010000001.1 GCA030223985_00286 CDS open 300288-301166 _na     292_aa Lipoprotein
295 JASOTK010000001.1 GCA030223985_00287 CDS open 301253-301735 _na     160_aa fadM Thioesterase domain-containing protein
296 JASOTK010000001.1 GCA030223985_00288 CDS open 301952-302077 _na     41_aa hypothetical protein
297 JASOTK010000001.1 GCA030223985_00289 CDS open 302137-302880 _na     247_aa AB hydrolase-1 domain-containing protein
298 JASOTK010000001.1 GCA030223985_00290 CDS open 303192-303950 _na     252_aa fabG Cyclopentanol dehydrogenase
299 JASOTK010000001.1 GCA030223985_00291 CDS open 304080-304391 _na     103_aa padR Transcriptional regulator%2C PadR family
300 JASOTK010000001.1 GCA030223985_00292 CDS open 304394-305635 _na     413_aa DUF2812 domain-containing protein
301 JASOTK010000001.1 GCA030223985_00293 CDS open 305931-306758 _na     275_aa Methyltransferase domain protein
302 JASOTK010000001.1 GCA030223985_00294 CDS open 306843-307481 _na     212_aa DUF6796 domain-containing protein
303 JASOTK010000001.1 GCA030223985_00295 CDS open 307803-308474 _na     223_aa Mg2+ transporter-C family protein
304 JASOTK010000001.1 GCA030223985_00296 CDS open 308716-308937 _na     73_aa DUF3784 domain-containing protein
305 JASOTK010000001.1 GCA030223985_00297 CDS open 309085-309342 _na     85_aa abrB Transcriptional regulator%2C AbrB family
306 JASOTK010000001.1 GCA030223985_00298 CDS open 309342-309608 _na     88_aa relE Addiction module toxin%2C RelE/StbE family
307 JASOTK010000001.1 GCA030223985_00299 CDS open 309783-310235 _na     150_aa tnpA IS200/IS605 family transposase
308 JASOTK010000001.1 GCA030223985_00300 CDS open 310799-311230 _na     143_aa helix-turn-helix domain-containing protein
309 JASOTK010000001.1 GCA030223985_00301 CDS open 311227-313140 _na     637_aa DNA methyltransferase
310 JASOTK010000001.1 GCA030223985_00302 CDS open 313145-313972 _na     275_aa DNA methyltransferase
311 JASOTK010000001.1 GCA030223985_00303 CDS open 313975-315465 _na     496_aa hypothetical protein
312 JASOTK010000001.1 GCA030223985_00304 CDS open 315802-315975 _na     57_aa Helix-turn-helix domain-containing protein
313 JASOTK010000001.1 GCA030223985_00305 CDS open 315972-316343 _na     123_aa tnpV TnpV protein
314 JASOTK010000001.1 GCA030223985_00306 CDS open 316422-318026 _na     534_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
315 JASOTK010000001.1 GCA030223985_00307 CDS open 318215-319252 _na     345_aa phnD Phosphate/phosphite/phosphonate ABC transporter%2C periplasmic binding protein
316 JASOTK010000001.1 GCA030223985_00308 CDS open 319293-320057 _na     254_aa phnC phosphonate ABC transporter ATP-binding protein
317 JASOTK010000001.1 GCA030223985_00309 CDS open 320054-320875 _na     273_aa phnE phosphonate ABC transporter%2C permease protein PhnE
318 JASOTK010000001.1 GCA030223985_00310 CDS open 320877-321689 _na     270_aa phnE phosphonate ABC transporter%2C permease protein PhnE
319 JASOTK010000001.1 GCA030223985_00311 CDS open 321686-323125 _na     479_aa 5'-nucleotidase protein
320 JASOTK010000001.1 GCA030223985_00312 CDS open 323287-323949 _na     220_aa Endo-1%2C4-beta-xylanase A
321 JASOTK010000001.1 GCA030223985_00313 CDS open 324709-325227 _na     172_aa nfnB NADH dehydrogenase
322 JASOTK010000001.1 GCA030223985_00314 CDS open 325335-326567 _na     410_aa Nramp family divalent metal transporter
323 JASOTK010000001.1 GCA030223985_00315 CDS open 326794-327549 _na     251_aa iclR IclR helix-turn-helix protein
324 JASOTK010000001.1 GCA030223985_00316 CDS open 327647-328621 _na     324_aa Agmatinase family protein
325 JASOTK010000001.1 GCA030223985_00317 CDS open 328715-329644 _na     309_aa glsA glutaminase A
326 JASOTK010000001.1 GCA030223985_00318 CDS open 329810-330673 _na     287_aa ypuA DUF1002 domain-containing protein
327 JASOTK010000001.1 GCA030223985_00319 CDS open 330859-331455 _na     198_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
328 JASOTK010000001.1 GCA030223985_00320 CDS open 331442-333775 _na     777_aa lon endopeptidase La
329 JASOTK010000001.1 GCA030223985_00321 CDS open 333822-335039 _na     405_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
330 JASOTK010000001.1 GCA030223985_00322 CDS open 335048-335632 _na     194_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
331 JASOTK010000001.1 GCA030223985_00323 CDS open 335649-336998 _na     449_aa tig trigger factor
332 JASOTK010000001.1 GCA030223985_00324 CDS open 337069-337290 _na     73_aa Transcriptional coactivator p15 (PC4) C-terminal domain-containing protein
333 JASOTK010000001.1 GCA030223985_00325 CDS open 337292-338995 _na     567_aa proS proline--tRNA ligase
334 JASOTK010000001.1 GCA030223985_00326 CDS open 339039-339365 _na     108_aa hypothetical protein
335 JASOTK010000001.1 GCA030223985_00327 CDS open 339550-339744 _na     64_aa hypothetical protein
336 JASOTK010000001.1 GCA030223985_00328 CDS open 339731-339913 _na     60_aa Phage protein
337 JASOTK010000001.1 GCA030223985_00329 CDS open 340025-340273 _na     82_aa hypothetical protein
338 JASOTK010000001.1 GCA030223985_00330 CDS open 345761-346054 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
339 JASOTK010000001.1 GCA030223985_00331 CDS open 346056-347087 _na     343_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
340 JASOTK010000001.1 GCA030223985_00332 CDS open 347084-347737 _na     217_aa cas4 CRISPR-associated protein Cas4
341 JASOTK010000001.1 GCA030223985_00333 CDS open 347739-348590 _na     283_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
342 JASOTK010000001.1 GCA030223985_00334 CDS open 348583-350547 _na     654_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
343 JASOTK010000001.1 GCA030223985_00335 CDS open 350561-351265 _na     234_aa cas5c type I-C CRISPR-associated protein Cas5c
344 JASOTK010000001.1 GCA030223985_00336 CDS open 351476-354055 _na     859_aa CRISPR-associated endonuclease Cas3-HD
345 JASOTK010000001.1 GCA030223985_00337 CDS open 354091-355029 _na     312_aa serA 4-phosphoerythronate dehydrogenase
346 JASOTK010000001.1 GCA030223985_00338 CDS open 355183-356739 _na     518_aa SH3 domain protein
347 JASOTK010000001.1 GCA030223985_00339 CDS open 356849-357415 _na     188_aa RNA polymerase sigma factor
348 JASOTK010000001.1 GCA030223985_00340 CDS open 357412-358173 _na     253_aa Signal peptide protein%2C YSIRK family
349 JASOTK010000001.1 GCA030223985_00341 CDS open 358280-359131 _na     283_aa dnaJ DnaJ domain protein
350 JASOTK010000001.1 GCA030223985_00342 CDS open 359124-359783 _na     219_aa Zinicin-like metallopeptidase
351 JASOTK010000001.1 GCA030223985_00343 CDS open 359876-360676 _na     266_aa dppD Glutathione import ATP-binding protein GsiA
352 JASOTK010000001.1 GCA030223985_00344 CDS open 360681-361637 _na     318_aa dppD ABC transporter ATP-binding protein
353 JASOTK010000001.1 GCA030223985_00345 CDS open 361639-362481 _na     280_aa dppC Glutathione transport system permease protein GsiD
354 JASOTK010000001.1 GCA030223985_00346 CDS open 362489-363418 _na     309_aa dppB Dipeptide ABC transporter%2C permease protein DppB
355 JASOTK010000001.1 GCA030223985_00347 CDS open 363486-365012 _na     508_aa ABC transporter%2C substrate-binding protein%2C family 5
356 JASOTK010000001.1 GCA030223985_00348 CDS open 365028-366275 _na     415_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
357 JASOTK010000001.1 GCA030223985_00349 CDS open 366418-367572 _na     384_aa aspB Aminotransferase
358 JASOTK010000001.1 GCA030223985_00350 CDS open 367661-368344 _na     227_aa DUF554 domain-containing protein
359 JASOTK010000001.1 GCA030223985_00351 CDS open 368351-369226 _na     291_aa alkA DNA-(apurinic or apyrimidinic site) lyase
360 JASOTK010000001.1 GCA030223985_00352 CDS open 369274-369903 _na     209_aa rex redox-sensing transcriptional repressor Rex
361 JASOTK010000001.1 GCA030223985_00353 CDS open 370183-370926 _na     247_aa srtB class B sortase
362 JASOTK010000001.1 GCA030223985_00354 CDS open 370952-371128 _na     58_aa hypothetical protein
363 JASOTK010000001.1 GCA030223985_00355 CDS open 371130-372032 _na     300_aa fN0238 Amidinotransferase
364 JASOTK010000001.1 GCA030223985_00356 CDS open 372130-372960 _na     276_aa folD Bifunctional protein FolD
365 JASOTK010000001.1 GCA030223985_00357 CDS open 373039-373773 _na     244_aa ymfI elongation factor P 5-aminopentanone reductase
366 JASOTK010000001.1 GCA030223985_00358 CDS open 373886-375121 _na     411_aa gltP Serine/threonine transporter family protein
367 JASOTK010000001.1 GCA030223985_00359 CDS open 375127-376008 _na     293_aa sdaAA L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha
368 JASOTK010000001.1 GCA030223985_00360 CDS open 376009-376677 _na     222_aa sdaAB L-serine ammonia-lyase%2C iron-sulfur-dependent subunit beta
369 JASOTK010000001.1 GCA030223985_00361 CDS open 376925-378502 _na     525_aa p-aminobenzoyl-glutamate transport protein
370 JASOTK010000001.1 GCA030223985_00362 CDS open 378627-379094 _na     155_aa radical SAM protein
371 JASOTK010000001.1 GCA030223985_00363 CDS open 379449-379892 _na     147_aa marR Transcriptional regulator%2C MarR family
372 JASOTK010000001.1 GCA030223985_00364 CDS open 379943-380785 _na     280_aa degV EDD domain protein%2C DegV family
373 JASOTK010000001.1 GCA030223985_00365 CDS open 380911-381828 _na     305_aa DUF2232 domain-containing protein
374 JASOTK010000001.1 GCA030223985_00366 CDS open 381840-383837 _na     665_aa gdpP Cyclic-di-AMP phosphodiesterase
375 JASOTK010000001.1 GCA030223985_00367 CDS open 383839-384288 _na     149_aa rplI 50S ribosomal protein L9
376 JASOTK010000001.1 GCA030223985_00368 CDS open 384294-385655 _na     453_aa dnaB replicative DNA helicase
377 JASOTK010000001.1 GCA030223985_00369 CDS open 385756-386631 _na     291_aa uppP undecaprenyl-diphosphate phosphatase
378 JASOTK010000001.1 GCA030223985_00370 CDS open 386639-387433 _na     264_aa nit1 (R)-stereoselective amidase
379 JASOTK010000001.1 GCA030223985_00371 CDS open 387567-388040 _na     157_aa tnpA IS200/IS605 family transposase
380 JASOTK010000001.1 GCA030223985_00372 CDS open 388249-388890 _na     213_aa sdpI DUF1648 domain-containing protein
381 JASOTK010000001.1 GCA030223985_00373 CDS open 388880-389152 _na     90_aa arsR Toxin-antitoxin system%2C antitoxin component%2C ArsR domain protein
382 JASOTK010000001.1 GCA030223985_00374 CDS open 389592-390341 _na     249_aa iclR Transcriptional regulator kdgR
383 JASOTK010000001.1 GCA030223985_00375 CDS open 390533-391765 _na     410_aa Fic family protein
384 JASOTK010000001.1 GCA030223985_00376 CDS open 391859-393745 _na     628_aa abc-f ribosomal protection-like ABC-F family protein
385 JASOTK010000001.1 GCA030223985_00377 CDS open 394062-394700 _na     212_aa murI XkdX family protein
386 JASOTK010000001.1 GCA030223985_00378 CDS open 394705-395577 _na     290_aa Lipid kinase%2C YegS/Rv2252/BmrU family
387 JASOTK010000001.1 GCA030223985_00379 CDS open 395768-397597 _na     609_aa Arylsulfatase
388 JASOTK010000001.1 GCA030223985_00380 CDS open 397598-398491 _na     297_aa Putative membrane protein
389 JASOTK010000001.1 GCA030223985_00381 CDS open 398678-398833 _na     51_aa Lipoprotein
390 JASOTK010000001.1 GCA030223985_00382 CDS open 398992-400341 _na     449_aa Hemerythrin HHE cation binding domain protein
391 JASOTK010000001.1 GCA030223985_00383 CDS open 400371-401390 _na     339_aa mnmH tRNA 2-selenouridine(34) synthase MnmH
392 JASOTK010000001.1 GCA030223985_00384 CDS open 401454-402455 _na     333_aa selD selenide%2C water dikinase SelD
393 JASOTK010000001.1 GCA030223985_00385 CDS open 402459-403037 _na     192_aa yedF sulfurtransferase-like selenium metabolism protein YedF
394 JASOTK010000001.1 GCA030223985_00386 CDS open 403034-403240 _na     68_aa Putative Se/S carrier protein-like domain-containing protein
395 JASOTK010000001.1 GCA030223985_00387 CDS open 403237-404361 _na     374_aa putative cysteine desulfurase
396 JASOTK010000001.1 GCA030223985_00388 CDS open 404813-405535 _na     240_aa DUF624 domain-containing protein
397 JASOTK010000001.1 GCA030223985_00389 CDS open 405715-406644 _na     309_aa glsA glutaminase A
398 JASOTK010000001.1 GCA030223985_00390 CDS open 406654-408123 _na     489_aa alsT Amino acid carrier protein
399 JASOTK010000001.1 GCA030223985_00391 CDS open 408226-408576 _na     116_aa Phage holin family protein
400 JASOTK010000001.1 GCA030223985_00392 CDS open 408619-408924 _na     101_aa DUF4298 domain-containing protein
401 JASOTK010000001.1 GCA030223985_00393 CDS open 409110-409718 _na     202_aa ttdB L(+)-tartrate dehydratase subunit beta
402 JASOTK010000001.1 GCA030223985_00394 CDS open 409715-410611 _na     298_aa ttdA L(+)-tartrate dehydratase subunit alpha
403 JASOTK010000001.1 GCA030223985_00395 CDS open 410624-411898 _na     424_aa citT Transporter%2C DASS family
404 JASOTK010000001.1 GCA030223985_00396 CDS open 412206-413249 _na     347_aa araC Transcriptional regulator%2C AraC family
405 JASOTK010000001.1 GCA030223985_00397 CDS open 413349-414530 _na     393_aa abgB putative hydrolase YxeP
406 JASOTK010000001.1 GCA030223985_00398 CDS open 414637-418305 _na     1222_aa purL2 phosphoribosylformylglycinamidine synthase
407 JASOTK010000001.1 GCA030223985_00399 CDS open 418295-419656 _na     453_aa purF amidophosphoribosyltransferase
408 JASOTK010000001.1 GCA030223985_00400 CDS open 419722-419832 _na     36_aa hypothetical protein
409 JASOTK010000001.1 GCA030223985_00401 CDS open 419977-422496 _na     839_aa mprF bifunctional lysylphosphatidylglycerol flippase/synthetase MprF
410 JASOTK010000001.1 GCA030223985_00402 CDS open 422493-423209 _na     238_aa menH Hydrolase%2C alpha/beta domain protein
411 JASOTK010000001.1 GCA030223985_00403 CDS open 423417-429224 _na     1935_aa SLH domain-containing protein
412 JASOTK010000001.1 GCA030223985_00404 CDS open 429452-430771 _na     439_aa lAP4 M18 family aminopeptidase
413 JASOTK010000001.1 GCA030223985_00405 CDS open 430790-432226 _na     478_aa potE Inner membrane transporter ycaM
414 JASOTK010000001.1 GCA030223985_00406 CDS open 432818-433930 _na     370_aa Methionine synthase%2C vitamin-B12 independent
415 JASOTK010000001.1 GCA030223985_00407 CDS open 433952-435064 _na     370_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase
416 JASOTK010000001.1 GCA030223985_00408 CDS open 435403-435807 _na     134_aa DUF5082 domain-containing protein
417 JASOTK010000001.1 GCA030223985_00409 CDS open 435830-437434 _na     534_aa nhaP2 potassium/proton antiporter
418 JASOTK010000001.1 GCA030223985_00410 CDS open 437557-437850 _na     97_aa hypothetical protein
419 JASOTK010000001.1 GCA030223985_00411 CDS open 437831-439027 _na     398_aa aspB Aminotransferase
420 JASOTK010000001.1 GCA030223985_00412 CDS open 439053-440009 _na     318_aa dnaC ATP-binding protein
421 JASOTK010000001.1 GCA030223985_00413 CDS open 439984-440997 _na     337_aa dnaD DnaD domain protein
422 JASOTK010000001.1 GCA030223985_00414 CDS open 441001-441573 _na     190_aa Acetyltransferase%2C GNAT family
423 JASOTK010000001.1 GCA030223985_00415 CDS open 441788-442273 _na     161_aa lrp HTH-type transcriptional regulator lrpC
424 JASOTK010000001.1 GCA030223985_00416 CDS open 442292-442993 _na     233_aa ompR Response regulator transcription factor
425 JASOTK010000001.1 GCA030223985_00417 CDS open 442993-444801 _na     602_aa walK histidine kinase
426 JASOTK010000001.1 GCA030223985_00418 CDS open 444782-446122 _na     446_aa yycH YycH protein
427 JASOTK010000001.1 GCA030223985_00419 CDS open 446125-446973 _na     282_aa yycH YycH protein
428 JASOTK010000001.1 GCA030223985_00420 CDS open 447032-447817 _na     261_aa phnP Metallohydrolase
429 JASOTK010000001.1 GCA030223985_00421 CDS open 447837-448583 _na     248_aa surE 5'/3'-nucleotidase SurE
430 JASOTK010000001.1 GCA030223985_00422 CDS open 448741-449220 _na     159_aa DUF4825 domain-containing protein
431 JASOTK010000001.1 GCA030223985_00423 CDS open 449610-457055 _na     2481_aa SLH domain-containing protein
432 JASOTK010000001.1 GCA030223985_00424 CDS open 457278-458600 _na     440_aa mgtE magnesium transporter
433 JASOTK010000001.1 GCA030223985_00425 CDS open 458849-459397 _na     182_aa DNA-binding helix-turn-helix protein
434 JASOTK010000001.1 GCA030223985_00426 CDS open 459616-460512 _na     298_aa Alpha/beta hydrolase fold-3 domain-containing protein
435 JASOTK010000001.1 GCA030223985_00427 CDS open 460527-461750 _na     407_aa araC Transcriptional regulator%2C AraC family
436 JASOTK010000001.1 GCA030223985_00428 CDS open 461951-463282 _na     443_aa spoVV Transporter gate domain protein
437 JASOTK010000001.1 GCA030223985_00429 CDS open 463331-464002 _na     223_aa Flavin reductase like domain-containing protein
438 JASOTK010000001.1 GCA030223985_00430 CDS open 464596-465999 _na     467_aa Amino acid carrier protein
439 JASOTK010000001.1 GCA030223985_00431 CDS open 466011-466934 _na     307_aa glsA glutaminase A
440 JASOTK010000001.1 GCA030223985_00432 CDS open 467193-468134 _na     313_aa msrA Peptide methionine sulfoxide reductase MsrA
441 JASOTK010000001.1 GCA030223985_00433 CDS open 468512-469147 _na     211_aa zinT ZinT domain-containing protein
442 JASOTK010000001.1 GCA030223985_00434 CDS open 469228-470523 _na     431_aa znuA putative zinc transport system zinc-binding lipoprotein AdcA
443 JASOTK010000001.1 GCA030223985_00435 CDS open 470527-471201 _na     224_aa znuC Zinc import ATP-binding protein ZnuC
444 JASOTK010000001.1 GCA030223985_00436 CDS open 471188-471985 _na     265_aa znuB High-affinity zinc uptake system membrane protein znuB
445 JASOTK010000001.1 GCA030223985_00437 CDS open 472174-474177 _na     667_aa pepD C69 family dipeptidase
446 JASOTK010000001.1 GCA030223985_00438 CDS open 474251-475207 _na     318_aa yqjG Glutathionyl-hydroquinone reductase YqjG
447 JASOTK010000001.1 GCA030223985_00439 CDS open 475314-477149 _na     611_aa ftsH ATP-dependent zinc metalloprotease FtsH
448 JASOTK010000001.1 GCA030223985_00440 CDS open 477226-478266 _na     346_aa nrdB ribonucleotide-diphosphate reductase subunit beta
449 JASOTK010000001.1 GCA030223985_00441 CDS open 478506-481034 _na     842_aa nrdD ribonucleoside-diphosphate reductase subunit alpha
450 JASOTK010000001.1 GCA030223985_00442 CDS open 481325-483085 _na     586_aa Copper amine oxidase N-terminal domain protein
451 JASOTK010000001.1 GCA030223985_00443 CDS open 484080-484799 _na     239_aa DUF5673 domain-containing protein
452 JASOTK010000001.1 GCA030223985_00444 CDS open 484796-485320 _na     174_aa hypothetical protein
453 JASOTK010000001.1 GCA030223985_00445 CDS open 485323-485895 _na     190_aa lytG Exo-glucosaminidase LytG family protein
454 JASOTK010000001.1 GCA030223985_00446 CDS open 485885-486703 _na     272_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
455 JASOTK010000001.1 GCA030223985_00447 CDS open 486714-487193 _na     159_aa rnaY HDIG domain protein
456 JASOTK010000001.1 GCA030223985_00448 CDS open 487193-487747 _na     184_aa folE GTP cyclohydrolase I FolE
457 JASOTK010000001.1 GCA030223985_00449 CDS open 487915-489285 _na     456_aa dacC serine-type D-Ala-D-Ala carboxypeptidase
458 JASOTK010000001.1 GCA030223985_00451 CDS open 489600-489920 _na     106_aa cutA1 Divalent cation tolerance protein%2C CutA1 family
459 JASOTK010000001.1 GCA030223985_00452 CDS open 490024-490356 _na     110_aa yvlD Phage holin family protein
460 JASOTK010000001.1 GCA030223985_00453 CDS open 490652-491068 _na     138_aa DUF4367 domain-containing protein
461 JASOTK010000001.1 GCA030223985_00454 CDS open 491068-491958 _na     296_aa phzF Phenazine biosynthesis protein%2C PhzF family
462 JASOTK010000001.1 GCA030223985_00455 CDS open 491961-492812 _na     283_aa Stage 0 sporulation protein J
463 JASOTK010000001.1 GCA030223985_00456 CDS open 492805-493560 _na     251_aa parA Sporulation initiation inhibitor protein soj
464 JASOTK010000001.1 GCA030223985_00457 CDS open 493834-494526 _na     230_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
465 JASOTK010000001.1 GCA030223985_00458 CDS open 494516-496420 _na     634_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
466 JASOTK010000001.1 GCA030223985_00459 CDS open 496427-497806 _na     459_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
467 JASOTK010000001.1 GCA030223985_00460 CDS open 497884-498687 _na     267_aa jag RNA-binding cell elongation regulator Jag/EloR
468 JASOTK010000001.1 GCA030223985_00461 CDS open 498687-499421 _na     244_aa yidC Membrane insertase YidC/Oxa/ALB C-terminal domain-containing protein
469 JASOTK010000001.1 GCA030223985_00462 CDS open 499439-499654 _na     71_aa yidD membrane protein insertion efficiency factor YidD
470 JASOTK010000001.1 GCA030223985_00463 CDS open 499651-499986 _na     111_aa rnpA ribonuclease P protein component
471 JASOTK010000001.1 GCA030223985_00464 CDS open 500562-501911 _na     449_aa dnaA chromosomal replication initiator protein DnaA
472 JASOTK010000001.1 GCA030223985_00465 CDS open 502060-503154 _na     364_aa dnaN DNA polymerase III subunit beta
473 JASOTK010000001.1 GCA030223985_00466 CDS open 503157-503369 _na     70_aa ybcJ Ribosome-associated protein
474 JASOTK010000001.1 GCA030223985_00467 CDS open 503366-504439 _na     357_aa recF DNA replication/repair protein RecF
475 JASOTK010000001.1 GCA030223985_00468 CDS open 504456-506369 _na     637_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
476 JASOTK010000001.1 GCA030223985_00469 CDS open 506379-508808 _na     809_aa gyrA DNA gyrase subunit A
477 JASOTK010000001.1 GCA030223985_00470 CDS open 508817-509128 _na     103_aa sTAS Anti-sigma factor antagonist
478 JASOTK010000001.1 GCA030223985_00471 CDS open 509130-509480 _na     116_aa Anti-sigma factor
479 JASOTK010000001.1 GCA030223985_00472 CDS open 509490-510275 _na     261_aa SigB/SigF/SigG family RNA polymerase sigma factor
480 JASOTK010000001.1 GCA030223985_00473 CDS open 510275-510946 _na     223_aa Transporter-associated domain-containing protein
481 JASOTK010000001.1 GCA030223985_00474 CDS open 511146-512633 _na     495_aa glpK glycerol kinase GlpK
482 JASOTK010000001.1 GCA030223985_00475 CDS open 513279-514442 _na     387_aa Putative membrane protein
483 JASOTK010000001.1 GCA030223985_00476 CDS open 514902-516053 _na     383_aa Putative membrane protein
484 JASOTK010000001.1 GCA030223985_00477 CDS open 516070-517161 _na     363_aa Glycerol dehydrogenase
485 JASOTK010000001.1 GCA030223985_00478 CDS open 517238-518239 _na     333_aa DUF4234 domain-containing protein
486 JASOTK010000001.1 GCA030223985_00479 CDS open 518236-518892 _na     218_aa Zinc-ribbon domain-containing protein
487 JASOTK010000001.1 GCA030223985_00480 CDS open 518896-519303 _na     135_aa DUF2752 domain-containing protein
488 JASOTK010000001.1 GCA030223985_00481 CDS open 519476-520720 _na     414_aa cdsB UPF0597 protein HMPREF9286_1685
489 JASOTK010000001.1 GCA030223985_00482 CDS open 520775-521053 _na     92_aa hypothetical protein
490 JASOTK010000001.1 GCA030223985_00483 CDS open 521126-522562 _na     478_aa gumN GumN protein
491 JASOTK010000001.1 GCA030223985_00484 CDS open 522563-523642 _na     359_aa Aminotransferase
492 JASOTK010000001.1 GCA030223985_00485 CDS open 523730-524728 _na     332_aa gLY1 Low specificity L-threonine aldolase
493 JASOTK010000001.1 GCA030223985_00486 CDS open 524737-525372 _na     211_aa rIC Hemerythrin HHE cation binding domain protein
494 JASOTK010000001.1 GCA030223985_00487 CDS open 525579-526622 _na     347_aa Fic family protein
495 JASOTK010000001.1 GCA030223985_00488 CDS open 526833-529586 _na     917_aa copZ copper chaperone CopZ
496 JASOTK010000001.1 GCA030223985_00489 CDS open 529583-529852 _na     89_aa frmR Copper-sensing transcriptional repressor CsoR
497 JASOTK010000001.1 GCA030223985_00490 CDS open 529859-530320 _na     153_aa Lipoprotein
498 JASOTK010000001.1 GCA030223985_00491 CDS open 530510-530836 _na     108_aa Lipoprotein
499 JASOTK010000001.1 GCA030223985_00492 CDS open 530844-531035 _na     63_aa DNA-binding helix-turn-helix protein
500 JASOTK010000001.1 GCA030223985_00493 CDS open 531124-532524 _na     466_aa cls phospholipase D