HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Paludibacteraceae [G1] bacterium HMT-274 (GCA_905372485.1)

Select a Genome:
BAKTA Annotations for GCA_905372485.1
Genome Selected: Paludibacteraceae [G1] bacterium HMT-274
ContigsBases CDSrRNA tmRNAtRNA
29 2138627 1941 2 1 38
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3985 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3985 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 CAJPPW010000001.1 GCA905372485_00221 gene open 237240-237595 RNaseP_bact_a
2 CAJPPW010000001.1 GCA905372485_00221 ncRNA open 237240-237595 Bacterial RNase P class A
3 CAJPPW010000001.1 regulatory_region open 118050-118286 Cobalamin riboswitch aptamer
4 CAJPPW010000001.1 regulatory_region open 227585-227792 Cobalamin riboswitch aptamer
5 CAJPPW010000001.1 repeat_region open 7203-8716 CRISPR array with 20 repeats of length 47%2C consensus sequence GTTGTGAATTGCTTTCAAAAGTTTGTATCTTTGTAGTCTGAAACAAC and spacer length 29
6 CAJPPW010000001.1 repeat_region open 18297-18683 CRISPR array with 6 repeats of length 36%2C consensus sequence GTCTATAAGACATTTATAATTTCTACTATTGTAGAT and spacer length 28
7 CAJPPW010000001.1 GCA905372485_00001 CDS open 502-1413 _na     303_aa hypothetical protein
8 CAJPPW010000001.1 GCA905372485_00002 CDS open 1975-2745 _na     256_aa ADP-ribosylglycohydrolase family protein
9 CAJPPW010000001.1 GCA905372485_00003 CDS open 3191-3436 _na     81_aa hypothetical protein
10 CAJPPW010000001.1 GCA905372485_00004 CDS open 3438-3641 _na     67_aa hypothetical protein
11 CAJPPW010000001.1 GCA905372485_00005 CDS open 3815-4639 _na     274_aa Endonuclease
12 CAJPPW010000001.1 GCA905372485_00006 CDS open 4642-5115 _na     157_aa Knr4/Smi1-like domain-containing protein
13 CAJPPW010000001.1 GCA905372485_00007 CDS open 5286-5717 _na     143_aa Lipoprotein
14 CAJPPW010000001.1 GCA905372485_00008 CDS open 5954-6166 _na     70_aa hypothetical protein
15 CAJPPW010000001.1 GCA905372485_00009 CDS open 6291-6677 _na     128_aa Lipoprotein
16 CAJPPW010000001.1 GCA905372485_00010 CDS open 6788-7042 _na     84_aa Transglycosylase associated protein
17 CAJPPW010000001.1 GCA905372485_00011 CDS open 8900-10102 _na     400_aa Serine aminopeptidase S33 domain-containing protein
18 CAJPPW010000001.1 GCA905372485_00012 CDS open 10165-10413 _na     82_aa DUF4342 domain-containing protein
19 CAJPPW010000001.1 GCA905372485_00013 CDS open 10423-11169 _na     248_aa hflC SPFH/Band 7/PHB domain protein
20 CAJPPW010000001.1 GCA905372485_00014 CDS open 11285-11485 _na     66_aa hypothetical protein
21 CAJPPW010000001.1 GCA905372485_00015 CDS open 11597-12037 _na     146_aa hypothetical protein
22 CAJPPW010000001.1 GCA905372485_00016 CDS open 12502-16290 _na     1262_aa cas12a type V CRISPR-associated protein Cas12a/Cpf1
23 CAJPPW010000001.1 GCA905372485_00017 CDS open 16259-16858 _na     199_aa cas4 type V CRISPR-associated protein Cas4
24 CAJPPW010000001.1 GCA905372485_00018 CDS open 16797-17819 _na     340_aa cas1 type V CRISPR-associated endonuclease Cas1
25 CAJPPW010000001.1 GCA905372485_00019 CDS open 17829-18101 _na     90_aa cas2 CRISPR-associated endonuclease Cas2
26 CAJPPW010000001.1 GCA905372485_00020 CDS open 18855-20771 _na     638_aa Penicillin-binding protein 2
27 CAJPPW010000001.1 GCA905372485_00021 CDS open 20761-21270 _na     169_aa mreD Rod shape-determining protein MreD
28 CAJPPW010000001.1 GCA905372485_00022 CDS open 21267-22088 _na     273_aa mreC Cell shape-determining protein MreC
29 CAJPPW010000001.1 GCA905372485_00023 CDS open 22187-22708 _na     173_aa MutT/NUDIX family protein
30 CAJPPW010000001.1 GCA905372485_00024 CDS open 22778-24520 _na     580_aa rho transcription termination factor Rho
31 CAJPPW010000001.1 GCA905372485_00025 CDS open 25093-27357 _na     754_aa Sodium/hydrogen exchanger family protein
32 CAJPPW010000001.1 GCA905372485_00026 CDS open 27445-27861 _na     138_aa ruvX Holliday junction resolvase RuvX
33 CAJPPW010000001.1 GCA905372485_00027 CDS open 28212-29411 _na     399_aa Na(+)/H(+) exchanger family protein
34 CAJPPW010000001.1 GCA905372485_00028 CDS open 29451-30755 _na     434_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
35 CAJPPW010000001.1 GCA905372485_00029 CDS open 30792-31538 _na     248_aa gpmA 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase
36 CAJPPW010000001.1 GCA905372485_00030 CDS open 31688-32365 _na     225_aa hypothetical protein
37 CAJPPW010000001.1 GCA905372485_00031 CDS open 32391-34199 _na     602_aa histidine kinase
38 CAJPPW010000001.1 GCA905372485_00032 CDS open 34947-37814 _na     955_aa Lipoprotein
39 CAJPPW010000001.1 GCA905372485_00033 CDS open 38002-39603 _na     533_aa Carboxyl-protease
40 CAJPPW010000001.1 GCA905372485_00034 CDS open 39648-40106 _na     152_aa Cytidine/deoxycytidylate deaminase family protein
41 CAJPPW010000001.1 GCA905372485_00035 CDS open 40103-40945 _na     280_aa nfo deoxyribonuclease IV
42 CAJPPW010000001.1 GCA905372485_00036 CDS open 40960-41796 _na     278_aa dapF diaminopimelate epimerase
43 CAJPPW010000001.1 GCA905372485_00037 CDS open 41864-42523 _na     219_aa putative transcriptional regulatory protein HMPREF0156_01451
44 CAJPPW010000001.1 GCA905372485_00038 CDS open 42860-44254 _na     464_aa Lipoprotein
45 CAJPPW010000001.1 GCA905372485_00039 CDS open 44331-45137 _na     268_aa starch synthase
46 CAJPPW010000001.1 GCA905372485_00040 CDS open 45357-45953 _na     198_aa Outer membrane protein beta-barrel domain-containing protein
47 CAJPPW010000001.1 GCA905372485_00041 CDS open 45972-46385 _na     137_aa Polyketide cyclase
48 CAJPPW010000001.1 GCA905372485_00042 CDS open 46406-47638 _na     410_aa hutI imidazolonepropionase
49 CAJPPW010000001.1 GCA905372485_00043 CDS open 47738-48466 _na     242_aa Shikimate dehydrogenase
50 CAJPPW010000001.1 GCA905372485_00044 CDS open 48489-49232 _na     247_aa putative 3'-5' exonuclease PolB-like domain-containing protein
51 CAJPPW010000001.1 GCA905372485_00045 CDS open 49321-50928 _na     535_aa pckA phosphoenolpyruvate carboxykinase (ATP)
52 CAJPPW010000001.1 GCA905372485_00046 CDS open 50989-51951 _na     320_aa Glucokinase
53 CAJPPW010000001.1 GCA905372485_00047 CDS open 52188-52661 _na     157_aa trxA thioredoxin
54 CAJPPW010000001.1 GCA905372485_00048 CDS open 53633-54664 _na     343_aa asparaginase
55 CAJPPW010000001.1 GCA905372485_00049 CDS open 54674-55930 _na     418_aa Aspartokinase
56 CAJPPW010000001.1 GCA905372485_00050 CDS open 55958-56632 _na     224_aa TIGR02453 family protein
57 CAJPPW010000001.1 GCA905372485_00051 CDS open 56757-58388 _na     543_aa pruA L-glutamate gamma-semialdehyde dehydrogenase
58 CAJPPW010000001.1 GCA905372485_00052 CDS open 58477-58647 _na     56_aa hypothetical protein
59 CAJPPW010000001.1 GCA905372485_00053 CDS open 58714-59775 _na     353_aa buk butyrate kinase
60 CAJPPW010000001.1 GCA905372485_00054 CDS open 59897-61735 _na     612_aa DUF262 domain-containing protein
61 CAJPPW010000001.1 GCA905372485_00055 CDS open 61789-64161 _na     790_aa DUF262 domain-containing protein
62 CAJPPW010000001.1 GCA905372485_00056 CDS open 64303-64944 _na     213_aa Outer membrane protein beta-barrel domain-containing protein
63 CAJPPW010000001.1 GCA905372485_00057 CDS open 65030-66679 _na     549_aa Extracellular ribonuclease/nuclease fusion protein
64 CAJPPW010000001.1 GCA905372485_00058 CDS open 66850-69363 _na     837_aa yfhO YfhO family protein
65 CAJPPW010000001.1 GCA905372485_00059 CDS open 69360-69812 _na     150_aa rpiB ribose 5-phosphate isomerase B
66 CAJPPW010000001.1 GCA905372485_00060 CDS open 69836-71413 _na     525_aa site-specific DNA-methyltransferase (cytosine-N(4)-specific)
67 CAJPPW010000001.1 GCA905372485_00061 CDS open 71422-72702 _na     426_aa AIPR family protein
68 CAJPPW010000001.1 GCA905372485_00062 CDS open 72740-73138 _na     132_aa hypothetical protein
69 CAJPPW010000001.1 GCA905372485_00063 CDS open 73113-73898 _na     261_aa Type II restriction endonuclease TdeIII
70 CAJPPW010000001.1 GCA905372485_00064 CDS open 73934-75607 _na     557_aa Dipeptidase
71 CAJPPW010000001.1 GCA905372485_00065 CDS open 76087-76545 _na     152_aa yopX YopX protein domain-containing protein
72 CAJPPW010000001.1 GCA905372485_00066 CDS open 76721-76990 _na     89_aa Spore coat protein
73 CAJPPW010000001.1 GCA905372485_00067 CDS open 77948-79129 _na     393_aa Immunoreactive antigen PG99
74 CAJPPW010000001.1 GCA905372485_00068 CDS open 79763-80191 _na     142_aa hypothetical protein
75 CAJPPW010000001.1 GCA905372485_00069 CDS open 80455-80892 _na     145_aa Immunity protein 12 domain-containing protein
76 CAJPPW010000001.1 GCA905372485_00070 CDS open 81039-81479 _na     146_aa SMI1/KNR4 family protein
77 CAJPPW010000001.1 GCA905372485_00071 CDS open 81582-81674 _na     30_aa hypothetical protein
78 CAJPPW010000001.1 GCA905372485_00072 CDS open 81805-82236 _na     143_aa SMI1/KNR4 family protein
79 CAJPPW010000001.1 GCA905372485_00073 CDS open 82274-82471 _na     65_aa hypothetical protein
80 CAJPPW010000001.1 GCA905372485_00074 CDS open 82652-83251 _na     199_aa hypothetical protein
81 CAJPPW010000001.1 GCA905372485_00075 CDS open 83369-83641 _na     90_aa hypothetical protein
82 CAJPPW010000001.1 GCA905372485_00076 CDS open 83819-83995 _na     58_aa Transcriptional regulator
83 CAJPPW010000001.1 GCA905372485_00077 CDS open 84278-85147 _na     289_aa Leucine-rich repeat domain-containing protein
84 CAJPPW010000001.1 GCA905372485_00078 CDS open 85287-85772 _na     161_aa Expressed protein
85 CAJPPW010000001.1 GCA905372485_00079 CDS open 86091-88934 _na     947_aa gcvP aminomethyl-transferring glycine dehydrogenase
86 CAJPPW010000001.1 GCA905372485_00080 CDS open 89357-91111 _na     584_aa Glutamine amidotransferase%2C class II/dipeptidase
87 CAJPPW010000001.1 GCA905372485_00081 CDS open 91493-91705 _na     70_aa hypothetical protein
88 CAJPPW010000001.1 GCA905372485_00082 CDS open 91952-93229 _na     425_aa eno phosphopyruvate hydratase
89 CAJPPW010000001.1 GCA905372485_00083 CDS open 93330-94271 _na     313_aa ribose-phosphate diphosphokinase
90 CAJPPW010000001.1 GCA905372485_00084 CDS open 94356-95255 _na     299_aa 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
91 CAJPPW010000001.1 GCA905372485_00085 CDS open 95248-95820 _na     190_aa xrtF Exosortase family protein XrtF
92 CAJPPW010000001.1 GCA905372485_00086 CDS open 95851-96888 _na     345_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
93 CAJPPW010000001.1 GCA905372485_00087 CDS open 96902-97717 _na     271_aa murI glutamate racemase
94 CAJPPW010000001.1 GCA905372485_00088 CDS open 98220-99026 _na     268_aa atpG ATP synthase F1 subunit gamma
95 CAJPPW010000001.1 GCA905372485_00089 CDS open 99164-100744 _na     526_aa atpA F0F1 ATP synthase subunit alpha
96 CAJPPW010000001.1 GCA905372485_00090 CDS open 100861-101400 _na     179_aa F0F1 ATP synthase subunit delta
97 CAJPPW010000001.1 GCA905372485_00091 CDS open 101406-101903 _na     165_aa atpF F0F1 ATP synthase subunit B
98 CAJPPW010000001.1 GCA905372485_00092 CDS open 102033-102281 _na     82_aa atpE ATP synthase F0 subunit C
99 CAJPPW010000001.1 GCA905372485_00093 CDS open 102341-103432 _na     363_aa atpB F0F1 ATP synthase subunit A
100 CAJPPW010000001.1 GCA905372485_00094 CDS open 103435-103815 _na     126_aa ATP synthase protein I
101 CAJPPW010000001.1 GCA905372485_00095 CDS open 103873-104112 _na     79_aa ATP synthase%2C Delta/Epsilon chain%2C beta-sandwich domain protein
102 CAJPPW010000001.1 GCA905372485_00096 CDS open 104160-105752 _na     530_aa atpD F0F1 ATP synthase subunit beta
103 CAJPPW010000001.1 GCA905372485_00097 CDS open 105896-109225 _na     1109_aa mfd transcription-repair coupling factor
104 CAJPPW010000001.1 GCA905372485_00098 CDS open 109475-109810 _na     111_aa rbfA 30S ribosome-binding factor RbfA
105 CAJPPW010000001.1 GCA905372485_00099 CDS open 109845-111077 _na     410_aa Membrane protein
106 CAJPPW010000001.1 GCA905372485_00100 CDS open 111118-113481 _na     787_aa Outer membrane protein
107 CAJPPW010000001.1 GCA905372485_00101 CDS open 113658-114686 _na     342_aa branched-chain amino acid aminotransferase
108 CAJPPW010000001.1 GCA905372485_00102 CDS open 114834-116675 _na     613_aa Pyruvate synthase
109 CAJPPW010000001.1 GCA905372485_00103 CDS open 116693-117691 _na     332_aa Oxidoreductase
110 CAJPPW010000001.1 GCA905372485_00104 CDS open 118474-120567 _na     697_aa nrdD anaerobic ribonucleoside-triphosphate reductase
111 CAJPPW010000001.1 GCA905372485_00105 CDS open 120612-121079 _na     155_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
112 CAJPPW010000001.1 GCA905372485_00106 CDS open 121237-122322 _na     361_aa serC 3-phosphoserine/phosphohydroxythreonine transaminase
113 CAJPPW010000001.1 GCA905372485_00107 CDS open 122439-123134 _na     231_aa ABC transporter%2C ATP-binding protein
114 CAJPPW010000001.1 GCA905372485_00108 CDS open 123166-123915 _na     249_aa 5'-Nucleotidase C-terminal domain-containing protein
115 CAJPPW010000001.1 GCA905372485_00109 CDS open 124266-124502 _na     78_aa hypothetical protein
116 CAJPPW010000001.1 GCA905372485_00110 CDS open 124737-125261 _na     174_aa hypothetical protein
117 CAJPPW010000001.1 GCA905372485_00111 CDS open 125307-125828 _na     173_aa hypothetical protein
118 CAJPPW010000001.1 GCA905372485_00112 CDS open 126218-127009 _na     263_aa B12-binding domain-containing protein
119 CAJPPW010000001.1 GCA905372485_00113 CDS open 127024-127680 _na     218_aa Coenzyme A transferase%2C beta subunit
120 CAJPPW010000001.1 GCA905372485_00114 CDS open 127712-128113 _na     133_aa maoC MaoC domain protein
121 CAJPPW010000001.1 GCA905372485_00115 CDS open 128169-130211 _na     680_aa Helix-hairpin-helix domain-containing protein
122 CAJPPW010000001.1 GCA905372485_00116 CDS open 130410-132311 _na     633_aa yidC membrane protein insertase YidC
123 CAJPPW010000001.1 GCA905372485_00119 CDS open 132827-133147 _na     106_aa FeS assembly SUF system protein
124 CAJPPW010000001.1 GCA905372485_00120 CDS open 133166-133789 _na     207_aa lptC LPS export ABC transporter periplasmic protein LptC
125 CAJPPW010000001.1 GCA905372485_00121 CDS open 133859-135739 _na     626_aa ileS isoleucine--tRNA ligase
126 CAJPPW010000001.1 GCA905372485_00123 CDS open 135943-137946 _na     667_aa HDIG domain protein
127 CAJPPW010000001.1 GCA905372485_00124 CDS open 137979-139664 _na     561_aa gldG gliding motility-associated ABC transporter substrate-binding protein GldG
128 CAJPPW010000001.1 GCA905372485_00125 CDS open 139715-141826 _na     703_aa Dipeptidyl-peptidase
129 CAJPPW010000001.1 GCA905372485_00126 CDS open 141898-142626 _na     242_aa DUF4272 domain-containing protein
130 CAJPPW010000001.1 GCA905372485_00127 CDS open 142787-143821 _na     344_aa Lipoprotein
131 CAJPPW010000001.1 GCA905372485_00128 CDS open 144028-144423 _na     131_aa rpsH 30S ribosomal protein S8
132 CAJPPW010000001.1 GCA905372485_00129 CDS open 144444-144995 _na     183_aa rplF 50S ribosomal protein L6
133 CAJPPW010000001.1 GCA905372485_00130 CDS open 145018-145362 _na     114_aa rplR 50S ribosomal protein L18
134 CAJPPW010000001.1 GCA905372485_00131 CDS open 145369-145887 _na     172_aa rpsE 30S ribosomal protein S5
135 CAJPPW010000001.1 GCA905372485_00132 CDS open 145947-146102 _na     51_aa hypothetical protein
136 CAJPPW010000001.1 GCA905372485_00133 CDS open 146253-146432 _na     59_aa Nitrite reductase [NAD(P)H]%2C large subunit
137 CAJPPW010000001.1 GCA905372485_00134 CDS open 146697-147779 _na     360_aa BIG2 domain-containing protein
138 CAJPPW010000001.1 GCA905372485_00135 CDS open 147839-147937 _na     32_aa hypothetical protein
139 CAJPPW010000001.1 GCA905372485_00136 CDS open 148095-148406 _na     103_aa DUF35 domain-containing protein
140 CAJPPW010000001.1 GCA905372485_00137 CDS open 148440-149513 _na     357_aa SMP-30/Gluconolactonase/LRE-like region domain-containing protein
141 CAJPPW010000001.1 GCA905372485_00138 CDS open 149682-151196 _na     504_aa hypothetical protein
142 CAJPPW010000001.1 GCA905372485_00139 CDS open 151202-151948 _na     248_aa Polymer-forming cytoskeletal protein
143 CAJPPW010000001.1 GCA905372485_00140 CDS open 152249-153385 _na     378_aa Pseudouridine synthase
144 CAJPPW010000001.1 GCA905372485_00141 CDS open 153431-153742 _na     103_aa Putative septum formation initiator-related protein
145 CAJPPW010000001.1 GCA905372485_00142 CDS open 153843-154508 _na     221_aa hypothetical protein
146 CAJPPW010000001.1 GCA905372485_00143 CDS open 154617-155789 _na     390_aa dnaJ molecular chaperone DnaJ
147 CAJPPW010000001.1 GCA905372485_00144 CDS open 155802-156359 _na     185_aa grpE nucleotide exchange factor GrpE
148 CAJPPW010000001.1 GCA905372485_00145 CDS open 156656-157747 _na     363_aa gcvT glycine cleavage system aminomethyltransferase GcvT
149 CAJPPW010000001.1 GCA905372485_00146 CDS open 157776-158999 _na     407_aa pepT peptidase T
150 CAJPPW010000001.1 GCA905372485_00147 CDS open 159105-159518 _na     137_aa Lipoprotein
151 CAJPPW010000001.1 GCA905372485_00148 CDS open 159560-161935 _na     791_aa Bacillolysin (Neutral protease)
152 CAJPPW010000001.1 GCA905372485_00149 CDS open 161961-162959 _na     332_aa class II fructose-bisphosphate aldolase
153 CAJPPW010000001.1 GCA905372485_00150 CDS open 163007-163930 _na     307_aa nusB NusB family protein
154 CAJPPW010000001.1 GCA905372485_00151 CDS open 163952-164965 _na     337_aa Phospho-2-dehydro-3-deoxyheptonate aldolase/chorismate mutase
155 CAJPPW010000001.1 GCA905372485_00152 CDS open 164984-165403 _na     139_aa hypothetical protein
156 CAJPPW010000001.1 GCA905372485_00153 CDS open 165730-167166 _na     478_aa DUF5017 domain-containing protein
157 CAJPPW010000001.1 GCA905372485_00154 CDS open 167200-169932 _na     910_aa TonB-dependent outer membrane receptor protein
158 CAJPPW010000001.1 GCA905372485_00155 CDS open 170037-171293 _na     418_aa ampG AmpG protein
159 CAJPPW010000001.1 GCA905372485_00156 CDS open 171652-172650 _na     332_aa Lipoprotein
160 CAJPPW010000001.1 GCA905372485_00157 CDS open 173251-174000 _na     249_aa UDP-2%2C3-diacylglucosamine hydrolase
161 CAJPPW010000001.1 GCA905372485_00158 CDS open 173979-174647 _na     222_aa ung uracil-DNA glycosylase
162 CAJPPW010000001.1 GCA905372485_00159 CDS open 174656-175003 _na     115_aa ccmA Integral membrane protein CcmA involved in cell shape determination
163 CAJPPW010000001.1 GCA905372485_00160 CDS open 175083-175517 _na     144_aa Lipoprotein
164 CAJPPW010000001.1 GCA905372485_00161 CDS open 175755-176369 _na     204_aa hypothetical protein
165 CAJPPW010000001.1 GCA905372485_00162 CDS open 176406-176981 _na     191_aa Outer membrane protein beta-barrel domain-containing protein
166 CAJPPW010000001.1 GCA905372485_00163 CDS open 177222-179204 _na     660_aa Porin
167 CAJPPW010000001.1 GCA905372485_00164 CDS open 179355-180491 _na     378_aa PepSY domain-containing protein
168 CAJPPW010000001.1 GCA905372485_00165 CDS open 180731-181276 _na     181_aa 2-oxoglutarate oxidoreductase%2C gamma subunit
169 CAJPPW010000001.1 GCA905372485_00166 CDS open 181307-182068 _na     253_aa 2-oxoglutarate oxidoreductase%2C beta subunit
170 CAJPPW010000001.1 GCA905372485_00167 CDS open 182150-182242 _na     30_aa hypothetical protein
171 CAJPPW010000001.1 GCA905372485_00168 CDS open 182246-182659 _na     137_aa Lipoprotein
172 CAJPPW010000001.1 GCA905372485_00169 CDS open 182662-183075 _na     137_aa Lipoprotein
173 CAJPPW010000001.1 GCA905372485_00170 CDS open 183079-183492 _na     137_aa Lipoprotein
174 CAJPPW010000001.1 GCA905372485_00171 CDS open 183495-183911 _na     138_aa Lipoprotein
175 CAJPPW010000001.1 GCA905372485_00172 CDS open 184040-185122 _na     360_aa 2-ketoisovalerate ferredoxin oxidoreductase
176 CAJPPW010000001.1 GCA905372485_00173 CDS open 185143-185370 _na     75_aa 2-ketoglutarate ferredoxin oxidoreductase%2C subunit delta
177 CAJPPW010000001.1 GCA905372485_00174 CDS open 185552-188266 _na     904_aa DNA gyrase/topoisomerase IV subunit A
178 CAJPPW010000001.1 GCA905372485_00175 CDS open 188750-188932 _na     60_aa Pyrimidine dimer DNA glycosylase
179 CAJPPW010000001.1 GCA905372485_00176 CDS open 188945-189124 _na     59_aa hypothetical protein
180 CAJPPW010000001.1 GCA905372485_00177 CDS open 189215-190141 _na     308_aa Phosphate acetyltransferase
181 CAJPPW010000001.1 GCA905372485_00178 CDS open 190524-190856 _na     110_aa Import component protein
182 CAJPPW010000001.1 GCA905372485_00179 CDS open 191013-193106 _na     697_aa recG ATP-dependent DNA helicase RecG
183 CAJPPW010000001.1 GCA905372485_00180 CDS open 193135-193815 _na     226_aa SH3b domain-containing protein
184 CAJPPW010000001.1 GCA905372485_00181 CDS open 193991-194344 _na     117_aa rplT 50S ribosomal protein L20
185 CAJPPW010000001.1 GCA905372485_00182 CDS open 194436-194633 _na     65_aa rpmI 50S ribosomal protein L35
186 CAJPPW010000001.1 GCA905372485_00183 CDS open 194682-195143 _na     153_aa infC translation initiation factor IF-3
187 CAJPPW010000001.1 GCA905372485_00184 CDS open 195372-197099 _na     575_aa DNA polymerase III subunit gamma/tau
188 CAJPPW010000001.1 GCA905372485_00185 CDS open 197128-198084 _na     318_aa SPOR domain-containing protein
189 CAJPPW010000001.1 GCA905372485_00186 CDS open 198110-198820 _na     236_aa deoD purine-nucleoside phosphorylase
190 CAJPPW010000001.1 GCA905372485_00187 CDS open 198917-200665 _na     582_aa TPR-repeat family protein
191 CAJPPW010000001.1 GCA905372485_00188 CDS open 200814-201308 _na     164_aa GtrA/DPMS transmembrane domain-containing protein
192 CAJPPW010000001.1 GCA905372485_00189 CDS open 201555-201869 _na     104_aa rplU 50S ribosomal protein L21
193 CAJPPW010000001.1 GCA905372485_00190 CDS open 201894-202157 _na     87_aa rpmA 50S ribosomal protein L27
194 CAJPPW010000001.1 GCA905372485_00191 CDS open 202319-202876 _na     185_aa Nicotinamide-nucleotide adenylyltransferase
195 CAJPPW010000001.1 GCA905372485_00192 CDS open 202988-203851 _na     287_aa Agmatinase 1
196 CAJPPW010000001.1 GCA905372485_00193 CDS open 203950-204219 _na     89_aa rpsO 30S ribosomal protein S15
197 CAJPPW010000001.1 GCA905372485_00194 CDS open 204316-205401 _na     361_aa carbamoyl phosphate synthase small subunit
198 CAJPPW010000001.1 GCA905372485_00195 CDS open 205661-206122 _na     153_aa Ribosomal RNA large subunit methyltransferase H
199 CAJPPW010000001.1 GCA905372485_00196 CDS open 206270-207325 _na     351_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
200 CAJPPW010000001.1 GCA905372485_00197 CDS open 207353-208714 _na     453_aa hisS histidine--tRNA ligase
201 CAJPPW010000001.1 GCA905372485_00198 CDS open 208714-209322 _na     202_aa Peptidoglycan N-acetylglucosamine deacetylase A
202 CAJPPW010000001.1 GCA905372485_00199 CDS open 209451-211574 _na     707_aa prolyl oligopeptidase
203 CAJPPW010000001.1 GCA905372485_00200 CDS open 211826-212818 _na     330_aa SMI1/KNR4 family protein
204 CAJPPW010000001.1 GCA905372485_00201 CDS open 212838-212987 _na     49_aa hypothetical protein
205 CAJPPW010000001.1 GCA905372485_00202 CDS open 213061-213603 _na     180_aa Hexapeptide transferase family protein
206 CAJPPW010000001.1 GCA905372485_00203 CDS open 213636-214583 _na     315_aa corA Magnesium transport protein CorA
207 CAJPPW010000001.1 GCA905372485_00204 CDS open 214645-215409 _na     254_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
208 CAJPPW010000001.1 GCA905372485_00205 CDS open 215581-216252 _na     223_aa Ribosomal large subunit pseudouridine synthase family protein
209 CAJPPW010000001.1 GCA905372485_00206 CDS open 216275-216955 _na     226_aa Universal stress protein
210 CAJPPW010000001.1 GCA905372485_00207 CDS open 216962-217672 _na     236_aa truB tRNA pseudouridine(55) synthase TruB
211 CAJPPW010000001.1 GCA905372485_00209 CDS open 218143-221202 _na     1019_aa DUF5074 domain-containing protein
212 CAJPPW010000001.1 GCA905372485_00210 CDS open 221290-223026 _na     578_aa Secretion system C-terminal sorting domain-containing protein
213 CAJPPW010000001.1 GCA905372485_00211 CDS open 223039-224247 _na     402_aa Cell surface protein
214 CAJPPW010000001.1 GCA905372485_00212 CDS open 224254-225435 _na     393_aa Lipoprotein
215 CAJPPW010000001.1 GCA905372485_00213 CDS open 225432-227426 _na     664_aa Ligand-gated channel protein
216 CAJPPW010000001.1 GCA905372485_00214 CDS open 227898-228851 _na     317_aa Endonuclease/exonuclease/phosphatase family protein
217 CAJPPW010000001.1 GCA905372485_00215 CDS open 228911-230386 _na     491_aa trkH Potassium uptake protein TrkH
218 CAJPPW010000001.1 GCA905372485_00216 CDS open 230410-231741 _na     443_aa trkA Trk system potassium transporter TrkA
219 CAJPPW010000001.1 GCA905372485_00217 CDS open 231815-233719 _na     634_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
220 CAJPPW010000001.1 GCA905372485_00218 CDS open 233835-234695 _na     286_aa panC pantoate--beta-alanine ligase
221 CAJPPW010000001.1 GCA905372485_00219 CDS open 234747-235835 _na     362_aa Membrane protein
222 CAJPPW010000001.1 GCA905372485_00220 CDS open 235863-237212 _na     449_aa Ribonuclease BN
223 CAJPPW010000001.1 GCA905372485_00222 CDS open 237741-238127 _na     128_aa rpsI 30S ribosomal protein S9
224 CAJPPW010000001.1 GCA905372485_00223 CDS open 238136-238591 _na     151_aa rplM 50S ribosomal protein L13
225 CAJPPW010000001.1 GCA905372485_00224 CDS open 238843-241407 _na     854_aa Maltodextrin phosphorylase
226 CAJPPW010000001.1 GCA905372485_00225 CDS open 241477-242295 _na     272_aa cmk (d)CMP kinase
227 CAJPPW010000001.1 GCA905372485_00226 CDS open 242437-243660 _na     407_aa Transglutaminase-like domain-containing protein
228 CAJPPW010000001.1 GCA905372485_00227 CDS open 243698-244114 _na     138_aa mscL large-conductance mechanosensitive channel protein MscL
229 CAJPPW010000001.1 GCA905372485_00228 CDS open 244128-245084 _na     318_aa DUF3078 domain-containing protein
230 CAJPPW010000001.1 GCA905372485_00229 CDS open 245219-246427 _na     402_aa rocD ornithine--oxo-acid transaminase
231 CAJPPW010000001.1 GCA905372485_00230 CDS open 246538-248700 _na     720_aa tetQ Tetracycline resistance protein TetQ
232 CAJPPW010000001.1 GCA905372485_00231 CDS open 248948-249964 _na     338_aa Immunoreactive antigen PG97
233 CAJPPW010000001.1 GCA905372485_00232 CDS open 250086-250973 _na     295_aa bspA Surface antigen BspA
234 CAJPPW010000001.1 GCA905372485_00233 CDS open 251085-253064 _na     659_aa ftsH ATP-dependent zinc metalloprotease FtsH
235 CAJPPW010000001.1 GCA905372485_00234 CDS open 253314-254567 _na     417_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
236 CAJPPW010000001.1 GCA905372485_00235 CDS open 254640-256010 _na     456_aa ftsW putative peptidoglycan glycosyltransferase FtsW
237 CAJPPW010000001.1 GCA905372485_00236 CDS open 256206-257093 _na     295_aa queG tRNA epoxyqueuosine(34) reductase QueG
238 CAJPPW010000001.1 GCA905372485_00237 CDS open 257072-257296 _na     74_aa yidD membrane protein insertion efficiency factor YidD
239 CAJPPW010000001.1 GCA905372485_00238 CDS open 257280-257675 _na     131_aa rnpA ribonuclease P protein component
240 CAJPPW010000001.1 GCA905372485_00239 CDS open 257752-258639 _na     295_aa Fructokinase
241 CAJPPW010000001.1 GCA905372485_00240 CDS open 258878-259072 _na     64_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix fold protein
242 CAJPPW010000001.1 GCA905372485_00241 CDS open 259065-259286 _na     73_aa relE Toxin-antitoxin system%2C toxin component%2C RelE family
243 CAJPPW010000001.1 GCA905372485_00242 CDS open 259337-260608 _na     423_aa adenylosuccinate synthase
244 CAJPPW010000001.1 GCA905372485_00243 CDS open 260676-261419 _na     247_aa Periplasmic protein
245 CAJPPW010000001.1 GCA905372485_00244 CDS open 261594-262565 _na     323_aa manA mannose-6-phosphate isomerase%2C class I
246 CAJPPW010000001.1 GCA905372485_00245 CDS open 262627-262812 _na     61_aa rpmF 50S ribosomal protein L32
247 CAJPPW010000001.1 GCA905372485_00246 CDS open 262819-263349 _na     176_aa DUF177 domain-containing protein
248 CAJPPW010000001.1 GCA905372485_00247 CDS open 263540-264475 _na     311_aa bifunctional riboflavin kinase/FAD synthetase
249 CAJPPW010000001.1 GCA905372485_00248 CDS open 264507-265976 _na     489_aa lepB signal peptidase I
250 CAJPPW010000001.1 GCA905372485_00249 CDS open 266058-267848 _na     596_aa Long-chain-fatty-acid-CoA ligase
251 CAJPPW010000001.1 GCA905372485_00250 CDS open 267945-268274 _na     109_aa DNA-directed RNA polymerase subunit omega
252 CAJPPW010000001.1 GCA905372485_00251 CDS open 268363-269187 _na     274_aa bamD Outer membrane protein assembly factor BamD
253 CAJPPW010000001.1 GCA905372485_00252 CDS open 269191-271131 _na     646_aa thrS threonine--tRNA ligase
254 CAJPPW010000001.1 GCA905372485_00253 CDS open 271371-271907 _na     178_aa HDIG domain protein
255 CAJPPW010000001.1 GCA905372485_00254 CDS open 271932-272795 _na     287_aa NAD kinase
256 CAJPPW010000001.1 GCA905372485_00255 CDS open 272820-273632 _na     270_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
257 CAJPPW010000001.1 GCA905372485_00256 CDS open 273694-274815 _na     373_aa hemW radical SAM family heme chaperone HemW
258 CAJPPW010000001.1 GCA905372485_00257 CDS open 274928-275605 _na     225_aa TPR domain protein
259 CAJPPW010000001.1 GCA905372485_00258 CDS open 275677-276984 _na     435_aa UDP-glucose 6-dehydrogenase
260 CAJPPW010000001.1 GCA905372485_00259 CDS open 277023-278306 _na     427_aa UDP-glucose/GDP-mannose dehydrogenase family protein
261 CAJPPW010000001.1 GCA905372485_00260 CDS open 278331-279776 _na     481_aa Polysaccharide biosynthesis protein
262 CAJPPW010000001.1 GCA905372485_00261 CDS open 279863-280093 _na     76_aa Uroporphyrinogen decarboxylase
263 CAJPPW010000001.1 GCA905372485_00262 CDS open 280119-282374 _na     751_aa TonB-dependent receptor
264 CAJPPW010000001.1 GCA905372485_00263 CDS open 282390-282923 _na     177_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
265 CAJPPW010000001.1 GCA905372485_00264 CDS open 283194-283520 _na     108_aa padR Transcriptional regulator%2C PadR family
266 CAJPPW010000001.1 GCA905372485_00265 CDS open 283581-285380 _na     599_aa pspC PspC domain protein
267 CAJPPW010000001.1 GCA905372485_00266 CDS open 285423-285581 _na     52_aa hypothetical protein
268 CAJPPW010000001.1 GCA905372485_00267 CDS open 285620-288160 _na     846_aa TonB-dependent receptor
269 CAJPPW010000001.1 GCA905372485_00268 CDS open 288402-289580 _na     392_aa Vitellogenin II
270 CAJPPW010000001.1 GCA905372485_00269 CDS open 289619-291136 _na     505_aa Hemin receptor
271 CAJPPW010000001.1 GCA905372485_00270 CDS open 291373-292719 _na     448_aa tig trigger factor
272 CAJPPW010000001.1 GCA905372485_00271 CDS open 292924-294117 _na     397_aa CDP-glycerol glycerophosphotransferase family protein
273 CAJPPW010000001.1 GCA905372485_00272 CDS open 294176-295195 _na     339_aa Endonuclease/Exonuclease/phosphatase family protein
274 CAJPPW010000001.1 GCA905372485_00273 CDS open 295214-295519 _na     101_aa DUF721 domain-containing protein
275 CAJPPW010000001.1 GCA905372485_00274 CDS open 295559-296458 _na     299_aa Chromosome segregation protein SMC
276 CAJPPW010000001.1 GCA905372485_00275 CDS open 296509-298014 _na     501_aa Amine oxidase domain-containing protein
277 CAJPPW010000001.1 GCA905372485_00001 gene open 502-1413
278 CAJPPW010000001.1 GCA905372485_00002 gene open 1975-2745
279 CAJPPW010000001.1 GCA905372485_00003 gene open 3191-3436
280 CAJPPW010000001.1 GCA905372485_00004 gene open 3438-3641
281 CAJPPW010000001.1 GCA905372485_00005 gene open 3815-4639
282 CAJPPW010000001.1 GCA905372485_00006 gene open 4642-5115
283 CAJPPW010000001.1 GCA905372485_00007 gene open 5286-5717
284 CAJPPW010000001.1 GCA905372485_00008 gene open 5954-6166
285 CAJPPW010000001.1 GCA905372485_00009 gene open 6291-6677
286 CAJPPW010000001.1 GCA905372485_00010 gene open 6788-7042
287 CAJPPW010000001.1 GCA905372485_00011 gene open 8900-10102
288 CAJPPW010000001.1 GCA905372485_00012 gene open 10165-10413
289 CAJPPW010000001.1 GCA905372485_00013 gene open 10423-11169 hflC
290 CAJPPW010000001.1 GCA905372485_00014 gene open 11285-11485
291 CAJPPW010000001.1 GCA905372485_00015 gene open 11597-12037
292 CAJPPW010000001.1 GCA905372485_00016 gene open 12502-16290 cas12a
293 CAJPPW010000001.1 GCA905372485_00017 gene open 16259-16858 cas4
294 CAJPPW010000001.1 GCA905372485_00018 gene open 16797-17819 cas1
295 CAJPPW010000001.1 GCA905372485_00019 gene open 17829-18101 cas2
296 CAJPPW010000001.1 GCA905372485_00020 gene open 18855-20771
297 CAJPPW010000001.1 GCA905372485_00021 gene open 20761-21270 mreD
298 CAJPPW010000001.1 GCA905372485_00022 gene open 21267-22088 mreC
299 CAJPPW010000001.1 GCA905372485_00023 gene open 22187-22708
300 CAJPPW010000001.1 GCA905372485_00024 gene open 22778-24520 rho
301 CAJPPW010000001.1 GCA905372485_00025 gene open 25093-27357
302 CAJPPW010000001.1 GCA905372485_00026 gene open 27445-27861 ruvX
303 CAJPPW010000001.1 GCA905372485_00027 gene open 28212-29411
304 CAJPPW010000001.1 GCA905372485_00028 gene open 29451-30755
305 CAJPPW010000001.1 GCA905372485_00029 gene open 30792-31538 gpmA
306 CAJPPW010000001.1 GCA905372485_00030 gene open 31688-32365
307 CAJPPW010000001.1 GCA905372485_00031 gene open 32391-34199
308 CAJPPW010000001.1 GCA905372485_00032 gene open 34947-37814
309 CAJPPW010000001.1 GCA905372485_00033 gene open 38002-39603
310 CAJPPW010000001.1 GCA905372485_00034 gene open 39648-40106
311 CAJPPW010000001.1 GCA905372485_00035 gene open 40103-40945 nfo
312 CAJPPW010000001.1 GCA905372485_00036 gene open 40960-41796 dapF
313 CAJPPW010000001.1 GCA905372485_00037 gene open 41864-42523
314 CAJPPW010000001.1 GCA905372485_00038 gene open 42860-44254
315 CAJPPW010000001.1 GCA905372485_00039 gene open 44331-45137
316 CAJPPW010000001.1 GCA905372485_00040 gene open 45357-45953
317 CAJPPW010000001.1 GCA905372485_00041 gene open 45972-46385
318 CAJPPW010000001.1 GCA905372485_00042 gene open 46406-47638 hutI
319 CAJPPW010000001.1 GCA905372485_00043 gene open 47738-48466
320 CAJPPW010000001.1 GCA905372485_00044 gene open 48489-49232
321 CAJPPW010000001.1 GCA905372485_00045 gene open 49321-50928 pckA
322 CAJPPW010000001.1 GCA905372485_00046 gene open 50989-51951
323 CAJPPW010000001.1 GCA905372485_00047 gene open 52188-52661 trxA
324 CAJPPW010000001.1 GCA905372485_00048 gene open 53633-54664
325 CAJPPW010000001.1 GCA905372485_00049 gene open 54674-55930
326 CAJPPW010000001.1 GCA905372485_00050 gene open 55958-56632
327 CAJPPW010000001.1 GCA905372485_00051 gene open 56757-58388 pruA
328 CAJPPW010000001.1 GCA905372485_00052 gene open 58477-58647
329 CAJPPW010000001.1 GCA905372485_00053 gene open 58714-59775 buk
330 CAJPPW010000001.1 GCA905372485_00054 gene open 59897-61735
331 CAJPPW010000001.1 GCA905372485_00055 gene open 61789-64161
332 CAJPPW010000001.1 GCA905372485_00056 gene open 64303-64944
333 CAJPPW010000001.1 GCA905372485_00057 gene open 65030-66679
334 CAJPPW010000001.1 GCA905372485_00058 gene open 66850-69363 yfhO
335 CAJPPW010000001.1 GCA905372485_00059 gene open 69360-69812 rpiB
336 CAJPPW010000001.1 GCA905372485_00060 gene open 69836-71413
337 CAJPPW010000001.1 GCA905372485_00061 gene open 71422-72702
338 CAJPPW010000001.1 GCA905372485_00062 gene open 72740-73138
339 CAJPPW010000001.1 GCA905372485_00063 gene open 73113-73898
340 CAJPPW010000001.1 GCA905372485_00064 gene open 73934-75607
341 CAJPPW010000001.1 GCA905372485_00065 gene open 76087-76545 yopX
342 CAJPPW010000001.1 GCA905372485_00066 gene open 76721-76990
343 CAJPPW010000001.1 GCA905372485_00067 gene open 77948-79129
344 CAJPPW010000001.1 GCA905372485_00068 gene open 79763-80191
345 CAJPPW010000001.1 GCA905372485_00069 gene open 80455-80892
346 CAJPPW010000001.1 GCA905372485_00070 gene open 81039-81479
347 CAJPPW010000001.1 GCA905372485_00071 gene open 81582-81674
348 CAJPPW010000001.1 GCA905372485_00072 gene open 81805-82236
349 CAJPPW010000001.1 GCA905372485_00073 gene open 82274-82471
350 CAJPPW010000001.1 GCA905372485_00074 gene open 82652-83251
351 CAJPPW010000001.1 GCA905372485_00075 gene open 83369-83641
352 CAJPPW010000001.1 GCA905372485_00076 gene open 83819-83995
353 CAJPPW010000001.1 GCA905372485_00077 gene open 84278-85147
354 CAJPPW010000001.1 GCA905372485_00078 gene open 85287-85772
355 CAJPPW010000001.1 GCA905372485_00079 gene open 86091-88934 gcvP
356 CAJPPW010000001.1 GCA905372485_00080 gene open 89357-91111
357 CAJPPW010000001.1 GCA905372485_00081 gene open 91493-91705
358 CAJPPW010000001.1 GCA905372485_00082 gene open 91952-93229 eno
359 CAJPPW010000001.1 GCA905372485_00083 gene open 93330-94271
360 CAJPPW010000001.1 GCA905372485_00084 gene open 94356-95255
361 CAJPPW010000001.1 GCA905372485_00085 gene open 95248-95820 xrtF
362 CAJPPW010000001.1 GCA905372485_00086 gene open 95851-96888 tsaD
363 CAJPPW010000001.1 GCA905372485_00087 gene open 96902-97717 murI
364 CAJPPW010000001.1 GCA905372485_00088 gene open 98220-99026 atpG
365 CAJPPW010000001.1 GCA905372485_00089 gene open 99164-100744 atpA
366 CAJPPW010000001.1 GCA905372485_00090 gene open 100861-101400
367 CAJPPW010000001.1 GCA905372485_00091 gene open 101406-101903 atpF
368 CAJPPW010000001.1 GCA905372485_00092 gene open 102033-102281 atpE
369 CAJPPW010000001.1 GCA905372485_00093 gene open 102341-103432 atpB
370 CAJPPW010000001.1 GCA905372485_00094 gene open 103435-103815
371 CAJPPW010000001.1 GCA905372485_00095 gene open 103873-104112
372 CAJPPW010000001.1 GCA905372485_00096 gene open 104160-105752 atpD
373 CAJPPW010000001.1 GCA905372485_00097 gene open 105896-109225 mfd
374 CAJPPW010000001.1 GCA905372485_00098 gene open 109475-109810 rbfA
375 CAJPPW010000001.1 GCA905372485_00099 gene open 109845-111077
376 CAJPPW010000001.1 GCA905372485_00100 gene open 111118-113481
377 CAJPPW010000001.1 GCA905372485_00101 gene open 113658-114686
378 CAJPPW010000001.1 GCA905372485_00102 gene open 114834-116675
379 CAJPPW010000001.1 GCA905372485_00103 gene open 116693-117691
380 CAJPPW010000001.1 GCA905372485_00104 gene open 118474-120567 nrdD
381 CAJPPW010000001.1 GCA905372485_00105 gene open 120612-121079 nrdG
382 CAJPPW010000001.1 GCA905372485_00106 gene open 121237-122322 serC
383 CAJPPW010000001.1 GCA905372485_00107 gene open 122439-123134
384 CAJPPW010000001.1 GCA905372485_00108 gene open 123166-123915
385 CAJPPW010000001.1 GCA905372485_00109 gene open 124266-124502
386 CAJPPW010000001.1 GCA905372485_00110 gene open 124737-125261
387 CAJPPW010000001.1 GCA905372485_00111 gene open 125307-125828
388 CAJPPW010000001.1 GCA905372485_00112 gene open 126218-127009
389 CAJPPW010000001.1 GCA905372485_00113 gene open 127024-127680
390 CAJPPW010000001.1 GCA905372485_00114 gene open 127712-128113 maoC
391 CAJPPW010000001.1 GCA905372485_00115 gene open 128169-130211
392 CAJPPW010000001.1 GCA905372485_00116 gene open 130410-132311 yidC
393 CAJPPW010000001.1 GCA905372485_00119 gene open 132827-133147
394 CAJPPW010000001.1 GCA905372485_00120 gene open 133166-133789 lptC
395 CAJPPW010000001.1 GCA905372485_00121 gene open 133859-135739 ileS
396 CAJPPW010000001.1 GCA905372485_00123 gene open 135943-137946
397 CAJPPW010000001.1 GCA905372485_00124 gene open 137979-139664 gldG
398 CAJPPW010000001.1 GCA905372485_00125 gene open 139715-141826
399 CAJPPW010000001.1 GCA905372485_00126 gene open 141898-142626
400 CAJPPW010000001.1 GCA905372485_00127 gene open 142787-143821
401 CAJPPW010000001.1 GCA905372485_00128 gene open 144028-144423 rpsH
402 CAJPPW010000001.1 GCA905372485_00129 gene open 144444-144995 rplF
403 CAJPPW010000001.1 GCA905372485_00130 gene open 145018-145362 rplR
404 CAJPPW010000001.1 GCA905372485_00131 gene open 145369-145887 rpsE
405 CAJPPW010000001.1 GCA905372485_00132 gene open 145947-146102
406 CAJPPW010000001.1 GCA905372485_00133 gene open 146253-146432
407 CAJPPW010000001.1 GCA905372485_00134 gene open 146697-147779
408 CAJPPW010000001.1 GCA905372485_00135 gene open 147839-147937
409 CAJPPW010000001.1 GCA905372485_00136 gene open 148095-148406
410 CAJPPW010000001.1 GCA905372485_00137 gene open 148440-149513
411 CAJPPW010000001.1 GCA905372485_00138 gene open 149682-151196
412 CAJPPW010000001.1 GCA905372485_00139 gene open 151202-151948
413 CAJPPW010000001.1 GCA905372485_00140 gene open 152249-153385
414 CAJPPW010000001.1 GCA905372485_00141 gene open 153431-153742
415 CAJPPW010000001.1 GCA905372485_00142 gene open 153843-154508
416 CAJPPW010000001.1 GCA905372485_00143 gene open 154617-155789 dnaJ
417 CAJPPW010000001.1 GCA905372485_00144 gene open 155802-156359 grpE
418 CAJPPW010000001.1 GCA905372485_00145 gene open 156656-157747 gcvT
419 CAJPPW010000001.1 GCA905372485_00146 gene open 157776-158999 pepT
420 CAJPPW010000001.1 GCA905372485_00147 gene open 159105-159518
421 CAJPPW010000001.1 GCA905372485_00148 gene open 159560-161935
422 CAJPPW010000001.1 GCA905372485_00149 gene open 161961-162959
423 CAJPPW010000001.1 GCA905372485_00150 gene open 163007-163930 nusB
424 CAJPPW010000001.1 GCA905372485_00151 gene open 163952-164965
425 CAJPPW010000001.1 GCA905372485_00152 gene open 164984-165403
426 CAJPPW010000001.1 GCA905372485_00153 gene open 165730-167166
427 CAJPPW010000001.1 GCA905372485_00154 gene open 167200-169932
428 CAJPPW010000001.1 GCA905372485_00155 gene open 170037-171293 ampG
429 CAJPPW010000001.1 GCA905372485_00156 gene open 171652-172650
430 CAJPPW010000001.1 GCA905372485_00157 gene open 173251-174000
431 CAJPPW010000001.1 GCA905372485_00158 gene open 173979-174647 ung
432 CAJPPW010000001.1 GCA905372485_00159 gene open 174656-175003 ccmA
433 CAJPPW010000001.1 GCA905372485_00160 gene open 175083-175517
434 CAJPPW010000001.1 GCA905372485_00161 gene open 175755-176369
435 CAJPPW010000001.1 GCA905372485_00162 gene open 176406-176981
436 CAJPPW010000001.1 GCA905372485_00163 gene open 177222-179204
437 CAJPPW010000001.1 GCA905372485_00164 gene open 179355-180491
438 CAJPPW010000001.1 GCA905372485_00165 gene open 180731-181276
439 CAJPPW010000001.1 GCA905372485_00166 gene open 181307-182068
440 CAJPPW010000001.1 GCA905372485_00167 gene open 182150-182242
441 CAJPPW010000001.1 GCA905372485_00168 gene open 182246-182659
442 CAJPPW010000001.1 GCA905372485_00169 gene open 182662-183075
443 CAJPPW010000001.1 GCA905372485_00170 gene open 183079-183492
444 CAJPPW010000001.1 GCA905372485_00171 gene open 183495-183911
445 CAJPPW010000001.1 GCA905372485_00172 gene open 184040-185122
446 CAJPPW010000001.1 GCA905372485_00173 gene open 185143-185370
447 CAJPPW010000001.1 GCA905372485_00174 gene open 185552-188266
448 CAJPPW010000001.1 GCA905372485_00175 gene open 188750-188932
449 CAJPPW010000001.1 GCA905372485_00176 gene open 188945-189124
450 CAJPPW010000001.1 GCA905372485_00177 gene open 189215-190141
451 CAJPPW010000001.1 GCA905372485_00178 gene open 190524-190856
452 CAJPPW010000001.1 GCA905372485_00179 gene open 191013-193106 recG
453 CAJPPW010000001.1 GCA905372485_00180 gene open 193135-193815
454 CAJPPW010000001.1 GCA905372485_00181 gene open 193991-194344 rplT
455 CAJPPW010000001.1 GCA905372485_00182 gene open 194436-194633 rpmI
456 CAJPPW010000001.1 GCA905372485_00183 gene open 194682-195143 infC
457 CAJPPW010000001.1 GCA905372485_00184 gene open 195372-197099
458 CAJPPW010000001.1 GCA905372485_00185 gene open 197128-198084
459 CAJPPW010000001.1 GCA905372485_00186 gene open 198110-198820 deoD
460 CAJPPW010000001.1 GCA905372485_00187 gene open 198917-200665
461 CAJPPW010000001.1 GCA905372485_00188 gene open 200814-201308
462 CAJPPW010000001.1 GCA905372485_00189 gene open 201555-201869 rplU
463 CAJPPW010000001.1 GCA905372485_00190 gene open 201894-202157 rpmA
464 CAJPPW010000001.1 GCA905372485_00191 gene open 202319-202876
465 CAJPPW010000001.1 GCA905372485_00192 gene open 202988-203851
466 CAJPPW010000001.1 GCA905372485_00193 gene open 203950-204219 rpsO
467 CAJPPW010000001.1 GCA905372485_00194 gene open 204316-205401
468 CAJPPW010000001.1 GCA905372485_00195 gene open 205661-206122
469 CAJPPW010000001.1 GCA905372485_00196 gene open 206270-207325 queA
470 CAJPPW010000001.1 GCA905372485_00197 gene open 207353-208714 hisS
471 CAJPPW010000001.1 GCA905372485_00198 gene open 208714-209322
472 CAJPPW010000001.1 GCA905372485_00199 gene open 209451-211574
473 CAJPPW010000001.1 GCA905372485_00200 gene open 211826-212818
474 CAJPPW010000001.1 GCA905372485_00201 gene open 212838-212987
475 CAJPPW010000001.1 GCA905372485_00202 gene open 213061-213603
476 CAJPPW010000001.1 GCA905372485_00203 gene open 213636-214583 corA
477 CAJPPW010000001.1 GCA905372485_00204 gene open 214645-215409 rsmA
478 CAJPPW010000001.1 GCA905372485_00205 gene open 215581-216252
479 CAJPPW010000001.1 GCA905372485_00206 gene open 216275-216955
480 CAJPPW010000001.1 GCA905372485_00207 gene open 216962-217672 truB
481 CAJPPW010000001.1 GCA905372485_00209 gene open 218143-221202
482 CAJPPW010000001.1 GCA905372485_00210 gene open 221290-223026
483 CAJPPW010000001.1 GCA905372485_00211 gene open 223039-224247
484 CAJPPW010000001.1 GCA905372485_00212 gene open 224254-225435
485 CAJPPW010000001.1 GCA905372485_00213 gene open 225432-227426
486 CAJPPW010000001.1 GCA905372485_00214 gene open 227898-228851
487 CAJPPW010000001.1 GCA905372485_00215 gene open 228911-230386 trkH
488 CAJPPW010000001.1 GCA905372485_00216 gene open 230410-231741 trkA
489 CAJPPW010000001.1 GCA905372485_00217 gene open 231815-233719 dxs
490 CAJPPW010000001.1 GCA905372485_00218 gene open 233835-234695 panC
491 CAJPPW010000001.1 GCA905372485_00219 gene open 234747-235835
492 CAJPPW010000001.1 GCA905372485_00220 gene open 235863-237212
493 CAJPPW010000001.1 GCA905372485_00222 gene open 237741-238127 rpsI
494 CAJPPW010000001.1 GCA905372485_00223 gene open 238136-238591 rplM
495 CAJPPW010000001.1 GCA905372485_00224 gene open 238843-241407
496 CAJPPW010000001.1 GCA905372485_00225 gene open 241477-242295 cmk
497 CAJPPW010000001.1 GCA905372485_00226 gene open 242437-243660
498 CAJPPW010000001.1 GCA905372485_00227 gene open 243698-244114 mscL
499 CAJPPW010000001.1 GCA905372485_00228 gene open 244128-245084
500 CAJPPW010000001.1 GCA905372485_00229 gene open 245219-246427 rocD