HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella bivia (GCA_934149205.1)

Select a Genome:
BAKTA Annotations for GCA_934149205.1
Genome Selected: Prevotella bivia
ContigsBases CDSrRNA tmRNAtRNA
64 1981710 1702 2 1 45
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3513 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3513 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 CAKPED010000001.1 GCA934149205_00023 gene open 32560-32748 Bacteroidales-1
2 CAKPED010000001.1 GCA934149205_00023 ncRNA open 32560-32748 Bacteroidales-1 6S-Bacteroidales RNA suggested
3 CAKPED010000001.1 repeat_region open 134297-134968 CRISPR array with 9 repeats of length 47%2C consensus sequence GTTGTGATTTGCTTGAAAATTTCTATCTTTGTGGTATCAAATACAAC and spacer length 29
4 CAKPED010000001.1 GCA934149205_00001 CDS open 61-351 _na     96_aa hypothetical protein
5 CAKPED010000001.1 GCA934149205_00002 CDS open 353-1588 _na     411_aa Cytosine-specific methyltransferase
6 CAKPED010000001.1 GCA934149205_00003 CDS open 1588-2304 _na     238_aa DNA cytosine methyltransferase
7 CAKPED010000001.1 GCA934149205_00004 CDS open 2307-4208 _na     633_aa ATPase family protein
8 CAKPED010000001.1 GCA934149205_00005 CDS open 4213-6618 _na     801_aa LlaJI restriction endonuclease
9 CAKPED010000001.1 GCA934149205_00006 CDS open 6633-6806 _na     57_aa hypothetical protein
10 CAKPED010000001.1 GCA934149205_00007 CDS open 7783-8760 _na     325_aa aldo/keto reductase
11 CAKPED010000001.1 GCA934149205_00008 CDS open 8766-9755 _na     329_aa sugar-transfer associated ATP-grasp domain-containing protein
12 CAKPED010000001.1 GCA934149205_00009 CDS open 9771-10760 _na     329_aa sugar-transfer associated ATP-grasp domain-containing protein
13 CAKPED010000001.1 GCA934149205_00010 CDS open 10847-10987 _na     46_aa hypothetical protein
14 CAKPED010000001.1 GCA934149205_00011 CDS open 10984-13119 _na     711_aa Outer membrane receptor protein
15 CAKPED010000001.1 GCA934149205_00012 CDS open 13710-16064 _na     784_aa Small-conductance mechanosensitive channel
16 CAKPED010000001.1 GCA934149205_00013 CDS open 16231-17118 _na     295_aa Putative N-acetylglucosamine kinase
17 CAKPED010000001.1 GCA934149205_00014 CDS open 17386-17766 _na     126_aa Glutaredoxin domain-containing protein
18 CAKPED010000001.1 GCA934149205_00015 CDS open 17773-20361 _na     862_aa mutS2 endonuclease MutS2
19 CAKPED010000001.1 GCA934149205_00016 CDS open 20456-22180 _na     574_aa Phosphoglycerol transferase family protein%2C alkaline phosphatase superfamily
20 CAKPED010000001.1 GCA934149205_00017 CDS open 22214-22822 _na     202_aa DUF4738 domain-containing protein
21 CAKPED010000001.1 GCA934149205_00018 CDS open 23041-23148 _na     35_aa hypothetical protein
22 CAKPED010000001.1 GCA934149205_00019 CDS open 23381-26248 _na     955_aa Peptidase M16
23 CAKPED010000001.1 GCA934149205_00020 CDS open 26277-27839 _na     520_aa DUF6850 domain-containing protein
24 CAKPED010000001.1 GCA934149205_00021 CDS open 27972-29333 _na     453_aa DUF4876 domain-containing protein
25 CAKPED010000001.1 GCA934149205_00022 CDS open 29378-32461 _na     1027_aa TonB-dependent receptor
26 CAKPED010000001.1 GCA934149205_00024 CDS open 32797-33402 _na     201_aa riboflavin synthase
27 CAKPED010000001.1 GCA934149205_00025 CDS open 33574-34359 _na     261_aa gldB Gliding motility-associated lipoprotein GldB
28 CAKPED010000001.1 GCA934149205_00026 CDS open 34955-35743 _na     262_aa Putative HAD superfamily hydrolase
29 CAKPED010000001.1 GCA934149205_00027 CDS open 35743-36414 _na     223_aa Cation efflux family protein
30 CAKPED010000001.1 GCA934149205_00029 CDS open 36710-37144 _na     144_aa Transcriptional regulator%2C Fur family
31 CAKPED010000001.1 GCA934149205_00030 CDS open 37307-39787 _na     826_aa bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase
32 CAKPED010000001.1 GCA934149205_00031 CDS open 39807-41240 _na     477_aa rmuC DNA recombination protein RmuC
33 CAKPED010000001.1 GCA934149205_00032 CDS open 41378-42175 _na     265_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
34 CAKPED010000001.1 GCA934149205_00033 CDS open 42416-43294 _na     292_aa beta-galactosidase
35 CAKPED010000001.1 GCA934149205_00034 CDS open 43337-44284 _na     315_aa Beta-galactosidase
36 CAKPED010000001.1 GCA934149205_00035 CDS open 44756-46186 _na     476_aa histidine kinase
37 CAKPED010000001.1 GCA934149205_00036 CDS open 46194-46886 _na     230_aa saeR Putative response regulator SaeR
38 CAKPED010000001.1 GCA934149205_00037 CDS open 47110-48372 _na     420_aa nqrF NADH:ubiquinone reductase (Na(+)-transporting) subunit F
39 CAKPED010000001.1 GCA934149205_00038 CDS open 48378-49004 _na     208_aa nqrE NADH:ubiquinone reductase (Na(+)-transporting) subunit E
40 CAKPED010000001.1 GCA934149205_00039 CDS open 49007-49639 _na     210_aa NADH:ubiquinone reductase (Na(+)-transporting) subunit D
41 CAKPED010000001.1 GCA934149205_00040 CDS open 49668-50381 _na     237_aa nqrC NADH:ubiquinone reductase (Na(+)-transporting) subunit C
42 CAKPED010000001.1 GCA934149205_00041 CDS open 50395-51555 _na     386_aa NADH:ubiquinone reductase (Na(+)-transporting) subunit B
43 CAKPED010000001.1 GCA934149205_00042 CDS open 51595-52953 _na     452_aa Na(+)-translocating NADH-quinone reductase subunit A
44 CAKPED010000001.1 GCA934149205_00043 CDS open 53091-57557 _na     1488_aa tamB Translocation/assembly module TamB
45 CAKPED010000001.1 GCA934149205_00044 CDS open 57671-59440 _na     589_aa rpsA 30S ribosomal protein S1
46 CAKPED010000001.1 GCA934149205_00045 CDS open 60157-61758 _na     533_aa Dipeptidase
47 CAKPED010000001.1 GCA934149205_00046 CDS open 61805-62161 _na     118_aa Interferon-induced transmembrane protein
48 CAKPED010000001.1 GCA934149205_00047 CDS open 62285-62548 _na     87_aa DUF2752 domain-containing protein
49 CAKPED010000001.1 GCA934149205_00048 CDS open 62564-62902 _na     112_aa TM2 domain protein
50 CAKPED010000001.1 GCA934149205_00049 CDS open 62986-64611 _na     541_aa Glycosyl hydrolase-like 10 domain-containing protein
51 CAKPED010000001.1 GCA934149205_00050 CDS open 64635-65054 _na     139_aa Periplasmic heavy metal sensor
52 CAKPED010000001.1 GCA934149205_00051 CDS open 65072-65461 _na     129_aa Signal peptide protein%2C YSIRK family
53 CAKPED010000001.1 GCA934149205_00052 CDS open 65528-66076 _na     182_aa RNA polymerase sigma factor
54 CAKPED010000001.1 GCA934149205_00053 CDS open 66143-67057 _na     304_aa ribonuclease Z
55 CAKPED010000001.1 GCA934149205_00054 CDS open 67063-67620 _na     185_aa Lipocalin-like domain-containing protein
56 CAKPED010000001.1 GCA934149205_00055 CDS open 67652-68542 _na     296_aa mazG nucleoside triphosphate pyrophosphohydrolase
57 CAKPED010000001.1 GCA934149205_00056 CDS open 68691-71387 _na     898_aa valine--tRNA ligase
58 CAKPED010000001.1 GCA934149205_00057 CDS open 71590-72057 _na     155_aa Cytosine/adenosine deaminase
59 CAKPED010000001.1 GCA934149205_00058 CDS open 72195-72839 _na     214_aa Phosphohydrolase
60 CAKPED010000001.1 GCA934149205_00059 CDS open 72842-73801 _na     319_aa menA 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase
61 CAKPED010000001.1 GCA934149205_00060 CDS open 73947-76325 _na     792_aa Porin
62 CAKPED010000001.1 GCA934149205_00061 CDS open 76326-76556 _na     76_aa mscS Mechanosensitive ion channel protein MscS
63 CAKPED010000001.1 GCA934149205_00062 CDS open 76584-77642 _na     352_aa DUF4468 domain-containing protein
64 CAKPED010000001.1 GCA934149205_00063 CDS open 77688-79733 _na     681_aa uvrB excinuclease ABC subunit UvrB
65 CAKPED010000001.1 GCA934149205_00064 CDS open 80350-82002 _na     550_aa Lipoprotein
66 CAKPED010000001.1 GCA934149205_00065 CDS open 82015-82470 _na     151_aa Lipocalin-like domain-containing protein
67 CAKPED010000001.1 GCA934149205_00066 CDS open 82479-83117 _na     212_aa DUF4903 domain-containing protein
68 CAKPED010000001.1 GCA934149205_00067 CDS open 83196-85547 _na     783_aa TonB-dependent receptor
69 CAKPED010000001.1 GCA934149205_00068 CDS open 85544-86242 _na     232_aa hmuY HmuY protein
70 CAKPED010000001.1 GCA934149205_00069 CDS open 86310-87839 _na     509_aa Hemerythrin-like domain-containing protein
71 CAKPED010000001.1 GCA934149205_00070 CDS open 87854-88735 _na     293_aa Transmembrane protein
72 CAKPED010000001.1 GCA934149205_00071 CDS open 88996-89376 _na     126_aa Outer membrane protein beta-barrel domain-containing protein
73 CAKPED010000001.1 GCA934149205_00072 CDS open 89985-90599 _na     204_aa acrR Transcriptional regulator%2C TetR family
74 CAKPED010000001.1 GCA934149205_00073 CDS open 90627-92381 _na     584_aa msbA Lipid A export ATP-binding/permease protein MsbA
75 CAKPED010000001.1 GCA934149205_00074 CDS open 92402-94129 _na     575_aa msbA Lipid A export ATP-binding/permease protein MsbA
76 CAKPED010000001.1 GCA934149205_00075 CDS open 94143-96500 _na     785_aa SSD domain-containing protein
77 CAKPED010000001.1 GCA934149205_00076 CDS open 96561-97205 _na     214_aa hypothetical protein
78 CAKPED010000001.1 GCA934149205_00077 CDS open 97296-98603 _na     435_aa Porin
79 CAKPED010000001.1 GCA934149205_00078 CDS open 98506-99090 _na     194_aa IS982 family transposase
80 CAKPED010000001.1 GCA934149205_00079 CDS open 99566-100939 _na     457_aa Phage integrase SAM-like domain-containing protein
81 CAKPED010000001.1 GCA934149205_00080 CDS open 100990-103191 _na     733_aa Outer membrane protein beta-barrel domain-containing protein
82 CAKPED010000001.1 GCA934149205_00081 CDS open 103380-105653 _na     757_aa hypothetical protein
83 CAKPED010000001.1 GCA934149205_00082 CDS open 105660-106973 _na     437_aa hypothetical protein
84 CAKPED010000001.1 GCA934149205_00083 CDS open 106984-107463 _na     159_aa ytxH YtxH domain-containing protein
85 CAKPED010000001.1 GCA934149205_00084 CDS open 107556-107864 _na     102_aa hypothetical protein
86 CAKPED010000001.1 GCA934149205_00085 CDS open 108235-109716 _na     493_aa Phage integrase SAM-like domain-containing protein
87 CAKPED010000001.1 GCA934149205_00086 CDS open 109957-112680 _na     907_aa ppdK pyruvate%2C phosphate dikinase
88 CAKPED010000001.1 GCA934149205_00087 CDS open 113037-114467 _na     476_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
89 CAKPED010000001.1 GCA934149205_00088 CDS open 114917-115801 _na     294_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
90 CAKPED010000001.1 GCA934149205_00089 CDS open 115974-116918 _na     314_aa Putative membrane protein
91 CAKPED010000001.1 GCA934149205_00090 CDS open 117031-117798 _na     255_aa truA tRNA pseudouridine(38-40) synthase TruA
92 CAKPED010000001.1 GCA934149205_00091 CDS open 117822-119393 _na     523_aa ComEC/Rec2-like protein
93 CAKPED010000001.1 GCA934149205_00092 CDS open 119442-119630 _na     62_aa xseB exodeoxyribonuclease VII small subunit
94 CAKPED010000001.1 GCA934149205_00093 CDS open 119635-120936 _na     433_aa xseA exodeoxyribonuclease VII large subunit
95 CAKPED010000001.1 GCA934149205_00094 CDS open 121079-122473 _na     464_aa mepA Multidrug export protein MepA
96 CAKPED010000001.1 GCA934149205_00095 CDS open 122458-123081 _na     207_aa Cytidylate kinase
97 CAKPED010000001.1 GCA934149205_00096 CDS open 123071-123346 _na     91_aa hypothetical protein
98 CAKPED010000001.1 GCA934149205_00097 CDS open 123496-126075 _na     859_aa TonB-dependent receptor
99 CAKPED010000001.1 GCA934149205_00098 CDS open 126072-126926 _na     284_aa GLPGLI family protein
100 CAKPED010000001.1 GCA934149205_00099 CDS open 126991-127167 _na     58_aa hypothetical protein
101 CAKPED010000001.1 GCA934149205_00100 CDS open 127635-128459 _na     274_aa C4-type zinc ribbon domain-containing protein
102 CAKPED010000001.1 GCA934149205_00101 CDS open 128495-129310 _na     271_aa Nif3-like dinuclear metal center hexameric protein
103 CAKPED010000001.1 GCA934149205_00102 CDS open 129664-129774 _na     36_aa hypothetical protein
104 CAKPED010000001.1 GCA934149205_00103 CDS open 130072-131136 _na     354_aa Peptidylarginine deiminase-like enzyme
105 CAKPED010000001.1 GCA934149205_00104 CDS open 131148-132035 _na     295_aa Acyltransferase
106 CAKPED010000001.1 GCA934149205_00106 CDS open 132731-133273 _na     180_aa Phage integrase SAM-like domain-containing protein
107 CAKPED010000001.1 GCA934149205_00107 CDS open 135068-135409 _na     113_aa cas2 CRISPR-associated endonuclease Cas2
108 CAKPED010000001.1 GCA934149205_00108 CDS open 135411-136343 _na     310_aa cas1 type II CRISPR-associated endonuclease Cas1
109 CAKPED010000001.1 GCA934149205_00109 CDS open 136353-140810 _na     1485_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
110 CAKPED010000001.1 GCA934149205_00110 CDS open 141238-141414 _na     58_aa hypothetical protein
111 CAKPED010000001.1 GCA934149205_00111 CDS open 141470-142114 _na     214_aa luxR Transcriptional regulator%2C LuxR family
112 CAKPED010000001.1 GCA934149205_00001 gene open 61-351
113 CAKPED010000001.1 GCA934149205_00002 gene open 353-1588
114 CAKPED010000001.1 GCA934149205_00003 gene open 1588-2304
115 CAKPED010000001.1 GCA934149205_00004 gene open 2307-4208
116 CAKPED010000001.1 GCA934149205_00005 gene open 4213-6618
117 CAKPED010000001.1 GCA934149205_00006 gene open 6633-6806
118 CAKPED010000001.1 GCA934149205_00007 gene open 7783-8760
119 CAKPED010000001.1 GCA934149205_00008 gene open 8766-9755
120 CAKPED010000001.1 GCA934149205_00009 gene open 9771-10760
121 CAKPED010000001.1 GCA934149205_00010 gene open 10847-10987
122 CAKPED010000001.1 GCA934149205_00011 gene open 10984-13119
123 CAKPED010000001.1 GCA934149205_00012 gene open 13710-16064
124 CAKPED010000001.1 GCA934149205_00013 gene open 16231-17118
125 CAKPED010000001.1 GCA934149205_00014 gene open 17386-17766
126 CAKPED010000001.1 GCA934149205_00015 gene open 17773-20361 mutS2
127 CAKPED010000001.1 GCA934149205_00016 gene open 20456-22180
128 CAKPED010000001.1 GCA934149205_00017 gene open 22214-22822
129 CAKPED010000001.1 GCA934149205_00018 gene open 23041-23148
130 CAKPED010000001.1 GCA934149205_00019 gene open 23381-26248
131 CAKPED010000001.1 GCA934149205_00020 gene open 26277-27839
132 CAKPED010000001.1 GCA934149205_00021 gene open 27972-29333
133 CAKPED010000001.1 GCA934149205_00022 gene open 29378-32461
134 CAKPED010000001.1 GCA934149205_00024 gene open 32797-33402
135 CAKPED010000001.1 GCA934149205_00025 gene open 33574-34359 gldB
136 CAKPED010000001.1 GCA934149205_00026 gene open 34955-35743
137 CAKPED010000001.1 GCA934149205_00027 gene open 35743-36414
138 CAKPED010000001.1 GCA934149205_00029 gene open 36710-37144
139 CAKPED010000001.1 GCA934149205_00030 gene open 37307-39787
140 CAKPED010000001.1 GCA934149205_00031 gene open 39807-41240 rmuC
141 CAKPED010000001.1 GCA934149205_00032 gene open 41378-42175 trmB
142 CAKPED010000001.1 GCA934149205_00033 gene open 42416-43294
143 CAKPED010000001.1 GCA934149205_00034 gene open 43337-44284
144 CAKPED010000001.1 GCA934149205_00035 gene open 44756-46186
145 CAKPED010000001.1 GCA934149205_00036 gene open 46194-46886 saeR
146 CAKPED010000001.1 GCA934149205_00037 gene open 47110-48372 nqrF
147 CAKPED010000001.1 GCA934149205_00038 gene open 48378-49004 nqrE
148 CAKPED010000001.1 GCA934149205_00039 gene open 49007-49639
149 CAKPED010000001.1 GCA934149205_00040 gene open 49668-50381 nqrC
150 CAKPED010000001.1 GCA934149205_00041 gene open 50395-51555
151 CAKPED010000001.1 GCA934149205_00042 gene open 51595-52953
152 CAKPED010000001.1 GCA934149205_00043 gene open 53091-57557 tamB
153 CAKPED010000001.1 GCA934149205_00044 gene open 57671-59440 rpsA
154 CAKPED010000001.1 GCA934149205_00045 gene open 60157-61758
155 CAKPED010000001.1 GCA934149205_00046 gene open 61805-62161
156 CAKPED010000001.1 GCA934149205_00047 gene open 62285-62548
157 CAKPED010000001.1 GCA934149205_00048 gene open 62564-62902
158 CAKPED010000001.1 GCA934149205_00049 gene open 62986-64611
159 CAKPED010000001.1 GCA934149205_00050 gene open 64635-65054
160 CAKPED010000001.1 GCA934149205_00051 gene open 65072-65461
161 CAKPED010000001.1 GCA934149205_00052 gene open 65528-66076
162 CAKPED010000001.1 GCA934149205_00053 gene open 66143-67057
163 CAKPED010000001.1 GCA934149205_00054 gene open 67063-67620
164 CAKPED010000001.1 GCA934149205_00055 gene open 67652-68542 mazG
165 CAKPED010000001.1 GCA934149205_00056 gene open 68691-71387
166 CAKPED010000001.1 GCA934149205_00057 gene open 71590-72057
167 CAKPED010000001.1 GCA934149205_00058 gene open 72195-72839
168 CAKPED010000001.1 GCA934149205_00059 gene open 72842-73801 menA
169 CAKPED010000001.1 GCA934149205_00060 gene open 73947-76325
170 CAKPED010000001.1 GCA934149205_00061 gene open 76326-76556 mscS
171 CAKPED010000001.1 GCA934149205_00062 gene open 76584-77642
172 CAKPED010000001.1 GCA934149205_00063 gene open 77688-79733 uvrB
173 CAKPED010000001.1 GCA934149205_00064 gene open 80350-82002
174 CAKPED010000001.1 GCA934149205_00065 gene open 82015-82470
175 CAKPED010000001.1 GCA934149205_00066 gene open 82479-83117
176 CAKPED010000001.1 GCA934149205_00067 gene open 83196-85547
177 CAKPED010000001.1 GCA934149205_00068 gene open 85544-86242 hmuY
178 CAKPED010000001.1 GCA934149205_00069 gene open 86310-87839
179 CAKPED010000001.1 GCA934149205_00070 gene open 87854-88735
180 CAKPED010000001.1 GCA934149205_00071 gene open 88996-89376
181 CAKPED010000001.1 GCA934149205_00072 gene open 89985-90599 acrR
182 CAKPED010000001.1 GCA934149205_00073 gene open 90627-92381 msbA
183 CAKPED010000001.1 GCA934149205_00074 gene open 92402-94129 msbA
184 CAKPED010000001.1 GCA934149205_00075 gene open 94143-96500
185 CAKPED010000001.1 GCA934149205_00076 gene open 96561-97205
186 CAKPED010000001.1 GCA934149205_00077 gene open 97296-98603
187 CAKPED010000001.1 GCA934149205_00078 gene open 98506-99090
188 CAKPED010000001.1 GCA934149205_00079 gene open 99566-100939
189 CAKPED010000001.1 GCA934149205_00080 gene open 100990-103191
190 CAKPED010000001.1 GCA934149205_00081 gene open 103380-105653
191 CAKPED010000001.1 GCA934149205_00082 gene open 105660-106973
192 CAKPED010000001.1 GCA934149205_00083 gene open 106984-107463 ytxH
193 CAKPED010000001.1 GCA934149205_00084 gene open 107556-107864
194 CAKPED010000001.1 GCA934149205_00085 gene open 108235-109716
195 CAKPED010000001.1 GCA934149205_00086 gene open 109957-112680 ppdK
196 CAKPED010000001.1 GCA934149205_00087 gene open 113037-114467 rlmD
197 CAKPED010000001.1 GCA934149205_00088 gene open 114917-115801 dapA
198 CAKPED010000001.1 GCA934149205_00089 gene open 115974-116918
199 CAKPED010000001.1 GCA934149205_00090 gene open 117031-117798 truA
200 CAKPED010000001.1 GCA934149205_00091 gene open 117822-119393
201 CAKPED010000001.1 GCA934149205_00092 gene open 119442-119630 xseB
202 CAKPED010000001.1 GCA934149205_00093 gene open 119635-120936 xseA
203 CAKPED010000001.1 GCA934149205_00094 gene open 121079-122473 mepA
204 CAKPED010000001.1 GCA934149205_00095 gene open 122458-123081
205 CAKPED010000001.1 GCA934149205_00096 gene open 123071-123346
206 CAKPED010000001.1 GCA934149205_00097 gene open 123496-126075
207 CAKPED010000001.1 GCA934149205_00098 gene open 126072-126926
208 CAKPED010000001.1 GCA934149205_00099 gene open 126991-127167
209 CAKPED010000001.1 GCA934149205_00100 gene open 127635-128459
210 CAKPED010000001.1 GCA934149205_00101 gene open 128495-129310
211 CAKPED010000001.1 GCA934149205_00102 gene open 129664-129774
212 CAKPED010000001.1 GCA934149205_00103 gene open 130072-131136
213 CAKPED010000001.1 GCA934149205_00104 gene open 131148-132035
214 CAKPED010000001.1 GCA934149205_00106 gene open 132731-133273
215 CAKPED010000001.1 GCA934149205_00107 gene open 135068-135409 cas2
216 CAKPED010000001.1 GCA934149205_00108 gene open 135411-136343 cas1
217 CAKPED010000001.1 GCA934149205_00109 gene open 136353-140810 cas9
218 CAKPED010000001.1 GCA934149205_00110 gene open 141238-141414
219 CAKPED010000001.1 GCA934149205_00111 gene open 141470-142114 luxR
220 CAKPED010000001.1 GCA934149205_00028 gene open 36478-36550 trnK
221 CAKPED010000001.1 GCA934149205_00105 gene open 132567-132638 trnR
222 CAKPED010000001.1 GCA934149205_00028 tRNA open 36478-36550 trnK tRNA-Lys(ttt)
223 CAKPED010000001.1 GCA934149205_00105 tRNA open 132567-132638 trnR tRNA-Arg(ccg)
224 CAKPED010000002.1 GCA934149205_00113 CDS open 173-514 _na     113_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
225 CAKPED010000002.1 GCA934149205_00114 CDS open 495-1397 _na     300_aa xerD Site-specific recombinase XerD
226 CAKPED010000002.1 GCA934149205_00115 CDS open 1446-1637 _na     63_aa rpsU 30S ribosomal protein S21
227 CAKPED010000002.1 GCA934149205_00116 CDS open 1836-2615 _na     259_aa Restriction endonuclease HincII
228 CAKPED010000002.1 GCA934149205_00117 CDS open 2612-4156 _na     514_aa site-specific DNA-methyltransferase (adenine-specific)
229 CAKPED010000002.1 GCA934149205_00118 CDS open 4448-4579 _na     43_aa hypothetical protein
230 CAKPED010000002.1 GCA934149205_00119 CDS open 4801-5787 _na     328_aa Malate/lactate dehydrogenase
231 CAKPED010000002.1 GCA934149205_00120 CDS open 5918-6595 _na     225_aa PAP2 family protein
232 CAKPED010000002.1 GCA934149205_00121 CDS open 6644-8722 _na     692_aa Phosphoglycerol transferase family protein%2C alkaline phosphatase superfamily
233 CAKPED010000002.1 GCA934149205_00122 CDS open 8970-9812 _na     280_aa DUF3737 domain-containing protein
234 CAKPED010000002.1 GCA934149205_00123 CDS open 9895-11058 _na     387_aa cysteine-S-conjugate beta-lyase
235 CAKPED010000002.1 GCA934149205_00124 CDS open 11074-11712 _na     212_aa DUF4294 domain-containing protein
236 CAKPED010000002.1 GCA934149205_00125 CDS open 12185-13504 _na     439_aa Anaerobic c4-dicarboxylate membrane transporter family protein
237 CAKPED010000002.1 GCA934149205_00126 CDS open 13557-14612 _na     351_aa ansB L-asparaginase 2
238 CAKPED010000002.1 GCA934149205_00127 CDS open 14691-15899 _na     402_aa Phosphate-selective porin O and P
239 CAKPED010000002.1 GCA934149205_00128 CDS open 15975-17405 _na     476_aa Aspartate ammonia-lyase
240 CAKPED010000002.1 GCA934149205_00129 CDS open 17489-17953 _na     154_aa Lipocalin-like domain-containing protein
241 CAKPED010000002.1 GCA934149205_00130 CDS open 18610-19014 _na     134_aa hypothetical protein
242 CAKPED010000002.1 GCA934149205_00131 CDS open 19076-22819 _na     1247_aa purL phosphoribosylformylglycinamidine synthase
243 CAKPED010000002.1 GCA934149205_00132 CDS open 23091-23954 _na     287_aa Flagellar motor protein
244 CAKPED010000002.1 GCA934149205_00133 CDS open 24229-25632 _na     467_aa rseP RIP metalloprotease RseP
245 CAKPED010000002.1 GCA934149205_00134 CDS open 25677-26831 _na     384_aa 1-deoxy-D-xylulose-5-phosphate reductoisomerase
246 CAKPED010000002.1 GCA934149205_00135 CDS open 26897-27418 _na     173_aa rimM ribosome maturation factor RimM
247 CAKPED010000002.1 GCA934149205_00136 CDS open 27439-28752 _na     437_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
248 CAKPED010000002.1 GCA934149205_00137 CDS open 28759-29355 _na     198_aa DUF4290 domain-containing protein
249 CAKPED010000002.1 GCA934149205_00138 CDS open 29428-30120 _na     230_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
250 CAKPED010000002.1 GCA934149205_00139 CDS open 30213-31091 _na     292_aa TIGR00255 family protein
251 CAKPED010000002.1 GCA934149205_00140 CDS open 31156-31728 _na     190_aa gmk guanylate kinase
252 CAKPED010000002.1 GCA934149205_00141 CDS open 31827-32393 _na     188_aa nadD nicotinate (nicotinamide) nucleotide adenylyltransferase
253 CAKPED010000002.1 GCA934149205_00142 CDS open 32725-34632 _na     635_aa Putative membrane-associated%2C metal-dependent hydrolase
254 CAKPED010000002.1 GCA934149205_00143 CDS open 34639-35703 _na     354_aa Acyltransferase 3 domain-containing protein
255 CAKPED010000002.1 GCA934149205_00144 CDS open 35707-36735 _na     342_aa Acyltransferase
256 CAKPED010000002.1 GCA934149205_00145 CDS open 36732-37610 _na     292_aa decaprenyl-phosphate phosphoribosyltransferase
257 CAKPED010000002.1 GCA934149205_00146 CDS open 37610-38206 _na     198_aa HAD-superfamily subfamily IB hydrolase%2C TIGR01490
258 CAKPED010000002.1 GCA934149205_00147 CDS open 38166-38576 _na     136_aa gtrA Polysaccharide biosynthesis protein GtrA
259 CAKPED010000002.1 GCA934149205_00148 CDS open 38626-39978 _na     450_aa DUF6080 domain-containing protein
260 CAKPED010000002.1 GCA934149205_00149 CDS open 39975-41405 _na     476_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
261 CAKPED010000002.1 GCA934149205_00150 CDS open 41418-42398 _na     326_aa Glycosyl transferase
262 CAKPED010000002.1 GCA934149205_00151 CDS open 42371-43816 _na     481_aa Polysaccharide biosynthesis protein
263 CAKPED010000002.1 GCA934149205_00152 CDS open 44008-44841 _na     277_aa LICD family protein
264 CAKPED010000002.1 GCA934149205_00153 CDS open 44881-45600 _na     239_aa Putative 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
265 CAKPED010000002.1 GCA934149205_00154 CDS open 45602-46642 _na     346_aa NAD dependent epimerase/dehydratase family protein
266 CAKPED010000002.1 GCA934149205_00155 CDS open 46758-47540 _na     260_aa Rhamnan synthesis protein F
267 CAKPED010000002.1 GCA934149205_00156 CDS open 47677-48126 _na     149_aa bcp thioredoxin-dependent thiol peroxidase
268 CAKPED010000002.1 GCA934149205_00157 CDS open 48181-48972 _na     263_aa TIGR02757 family protein
269 CAKPED010000002.1 GCA934149205_00158 CDS open 49019-49945 _na     308_aa Transcriptional regulator
270 CAKPED010000002.1 GCA934149205_00159 CDS open 49976-51331 _na     451_aa SGNH hydrolase-type esterase domain-containing protein
271 CAKPED010000002.1 GCA934149205_00160 CDS open 51747-51971 _na     74_aa hypothetical protein
272 CAKPED010000002.1 GCA934149205_00161 CDS open 52014-53531 _na     505_aa gpmI 2%2C3-bisphosphoglycerate-independent phosphoglycerate mutase
273 CAKPED010000002.1 GCA934149205_00162 CDS open 53606-54271 _na     221_aa ung uracil-DNA glycosylase
274 CAKPED010000002.1 GCA934149205_00163 CDS open 54271-54864 _na     197_aa DUF3109 domain-containing protein
275 CAKPED010000002.1 GCA934149205_00164 CDS open 55021-55899 _na     292_aa DNA-binding domain-containing protein%2C AraC-type
276 CAKPED010000002.1 GCA934149205_00165 CDS open 56030-58000 _na     656_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
277 CAKPED010000002.1 GCA934149205_00166 CDS open 58154-58408 _na     84_aa rpsT 30S ribosomal protein S20
278 CAKPED010000002.1 GCA934149205_00168 CDS open 58617-59342 _na     241_aa recO DNA repair protein RecO
279 CAKPED010000002.1 GCA934149205_00169 CDS open 59778-61946 _na     722_aa AAA+ ATPase domain-containing protein
280 CAKPED010000002.1 GCA934149205_00170 CDS open 62905-65094 _na     729_aa Glutamine synthetase
281 CAKPED010000002.1 GCA934149205_00171 CDS open 65161-66192 _na     343_aa Peptidase%2C M28 family
282 CAKPED010000002.1 GCA934149205_00172 CDS open 66228-68084 _na     618_aa Glutamine amidotransferase
283 CAKPED010000002.1 GCA934149205_00173 CDS open 68194-68691 _na     165_aa Transcriptional regulator
284 CAKPED010000002.1 GCA934149205_00174 CDS open 69073-70038 _na     321_aa peptidylprolyl isomerase
285 CAKPED010000002.1 GCA934149205_00175 CDS open 70124-71035 _na     303_aa Peptidyl-prolyl cis-trans isomerase
286 CAKPED010000002.1 GCA934149205_00176 CDS open 71070-71675 _na     201_aa Peptidyl-prolyl cis-trans isomerase
287 CAKPED010000002.1 GCA934149205_00177 CDS open 71822-72442 _na     206_aa Glutathione peroxidase
288 CAKPED010000002.1 GCA934149205_00178 CDS open 72881-73492 _na     203_aa hypothetical protein
289 CAKPED010000002.1 GCA934149205_00179 CDS open 73500-74045 _na     181_aa Corrinoid adenosyltransferase
290 CAKPED010000002.1 GCA934149205_00180 CDS open 74103-74324 _na     73_aa DUF2795 domain-containing protein
291 CAKPED010000002.1 GCA934149205_00181 CDS open 74435-75043 _na     202_aa Outer membrane protein beta-barrel domain-containing protein
292 CAKPED010000002.1 GCA934149205_00182 CDS open 75098-77395 _na     765_aa priA primosomal protein N'
293 CAKPED010000002.1 GCA934149205_00183 CDS open 77544-79067 _na     507_aa Outer membrane protein beta-barrel domain-containing protein
294 CAKPED010000002.1 GCA934149205_00184 CDS open 79293-81368 _na     691_aa 7TM receptor with intracellular HD hydrolase
295 CAKPED010000002.1 GCA934149205_00185 CDS open 81475-82992 _na     505_aa gltX glutamate--tRNA ligase
296 CAKPED010000002.1 GCA934149205_00186 CDS open 83040-84260 _na     406_aa 3-deoxy-D-manno-octulosonic acid transferase
297 CAKPED010000002.1 GCA934149205_00187 CDS open 84257-84772 _na     171_aa Viral beta C/D like family protein
298 CAKPED010000002.1 GCA934149205_00188 CDS open 84872-85960 _na     362_aa trpS tryptophan--tRNA ligase
299 CAKPED010000002.1 GCA934149205_00189 CDS open 86377-86856 _na     159_aa Pyruvate ferredoxin oxidoreductase
300 CAKPED010000002.1 GCA934149205_00190 CDS open 86846-87358 _na     170_aa Sigma-70 region 2
301 CAKPED010000002.1 GCA934149205_00191 CDS open 87517-89409 _na     630_aa speA biosynthetic arginine decarboxylase
302 CAKPED010000002.1 GCA934149205_00192 CDS open 89461-90042 _na     193_aa shikimate kinase
303 CAKPED010000002.1 GCA934149205_00193 CDS open 90066-92414 _na     782_aa topA type I DNA topoisomerase
304 CAKPED010000002.1 GCA934149205_00194 CDS open 92492-93031 _na     179_aa mutT Mutator mutT protein
305 CAKPED010000002.1 GCA934149205_00195 CDS open 93311-94135 _na     274_aa BD-FAE-like domain-containing protein
306 CAKPED010000002.1 GCA934149205_00196 CDS open 94301-94528 _na     75_aa ABC transporter permease
307 CAKPED010000002.1 GCA934149205_00197 CDS open 94533-94646 _na     37_aa hypothetical protein
308 CAKPED010000002.1 GCA934149205_00198 CDS open 94743-95897 _na     384_aa Peroxiredoxin
309 CAKPED010000002.1 GCA934149205_00199 CDS open 96275-96466 _na     63_aa hypothetical protein
310 CAKPED010000002.1 GCA934149205_00200 CDS open 96702-99794 _na     1030_aa TonB-dependent receptor plug domain protein
311 CAKPED010000002.1 GCA934149205_00201 CDS open 99813-101417 _na     534_aa SusD/RagB family nutrient-binding outer membrane lipoprotein
312 CAKPED010000002.1 GCA934149205_00202 CDS open 101454-102548 _na     364_aa Endo-beta-N-acetylglucosaminidase F2
313 CAKPED010000002.1 GCA934149205_00203 CDS open 102586-103725 _na     379_aa BT-3987-like N-terminal domain-containing protein
314 CAKPED010000002.1 GCA934149205_00113 gene open 173-514 hpf
315 CAKPED010000002.1 GCA934149205_00114 gene open 495-1397 xerD
316 CAKPED010000002.1 GCA934149205_00115 gene open 1446-1637 rpsU
317 CAKPED010000002.1 GCA934149205_00116 gene open 1836-2615
318 CAKPED010000002.1 GCA934149205_00117 gene open 2612-4156
319 CAKPED010000002.1 GCA934149205_00118 gene open 4448-4579
320 CAKPED010000002.1 GCA934149205_00119 gene open 4801-5787
321 CAKPED010000002.1 GCA934149205_00120 gene open 5918-6595
322 CAKPED010000002.1 GCA934149205_00121 gene open 6644-8722
323 CAKPED010000002.1 GCA934149205_00122 gene open 8970-9812
324 CAKPED010000002.1 GCA934149205_00123 gene open 9895-11058
325 CAKPED010000002.1 GCA934149205_00124 gene open 11074-11712
326 CAKPED010000002.1 GCA934149205_00125 gene open 12185-13504
327 CAKPED010000002.1 GCA934149205_00126 gene open 13557-14612 ansB
328 CAKPED010000002.1 GCA934149205_00127 gene open 14691-15899
329 CAKPED010000002.1 GCA934149205_00128 gene open 15975-17405
330 CAKPED010000002.1 GCA934149205_00129 gene open 17489-17953
331 CAKPED010000002.1 GCA934149205_00130 gene open 18610-19014
332 CAKPED010000002.1 GCA934149205_00131 gene open 19076-22819 purL
333 CAKPED010000002.1 GCA934149205_00132 gene open 23091-23954
334 CAKPED010000002.1 GCA934149205_00133 gene open 24229-25632 rseP
335 CAKPED010000002.1 GCA934149205_00134 gene open 25677-26831
336 CAKPED010000002.1 GCA934149205_00135 gene open 26897-27418 rimM
337 CAKPED010000002.1 GCA934149205_00136 gene open 27439-28752 murA
338 CAKPED010000002.1 GCA934149205_00137 gene open 28759-29355
339 CAKPED010000002.1 GCA934149205_00138 gene open 29428-30120 tsaB
340 CAKPED010000002.1 GCA934149205_00139 gene open 30213-31091
341 CAKPED010000002.1 GCA934149205_00140 gene open 31156-31728 gmk
342 CAKPED010000002.1 GCA934149205_00141 gene open 31827-32393 nadD
343 CAKPED010000002.1 GCA934149205_00142 gene open 32725-34632
344 CAKPED010000002.1 GCA934149205_00143 gene open 34639-35703
345 CAKPED010000002.1 GCA934149205_00144 gene open 35707-36735
346 CAKPED010000002.1 GCA934149205_00145 gene open 36732-37610
347 CAKPED010000002.1 GCA934149205_00146 gene open 37610-38206
348 CAKPED010000002.1 GCA934149205_00147 gene open 38166-38576 gtrA
349 CAKPED010000002.1 GCA934149205_00148 gene open 38626-39978
350 CAKPED010000002.1 GCA934149205_00149 gene open 39975-41405
351 CAKPED010000002.1 GCA934149205_00150 gene open 41418-42398
352 CAKPED010000002.1 GCA934149205_00151 gene open 42371-43816
353 CAKPED010000002.1 GCA934149205_00152 gene open 44008-44841
354 CAKPED010000002.1 GCA934149205_00153 gene open 44881-45600
355 CAKPED010000002.1 GCA934149205_00154 gene open 45602-46642
356 CAKPED010000002.1 GCA934149205_00155 gene open 46758-47540
357 CAKPED010000002.1 GCA934149205_00156 gene open 47677-48126 bcp
358 CAKPED010000002.1 GCA934149205_00157 gene open 48181-48972
359 CAKPED010000002.1 GCA934149205_00158 gene open 49019-49945
360 CAKPED010000002.1 GCA934149205_00159 gene open 49976-51331
361 CAKPED010000002.1 GCA934149205_00160 gene open 51747-51971
362 CAKPED010000002.1 GCA934149205_00161 gene open 52014-53531 gpmI
363 CAKPED010000002.1 GCA934149205_00162 gene open 53606-54271 ung
364 CAKPED010000002.1 GCA934149205_00163 gene open 54271-54864
365 CAKPED010000002.1 GCA934149205_00164 gene open 55021-55899
366 CAKPED010000002.1 GCA934149205_00165 gene open 56030-58000 gyrB
367 CAKPED010000002.1 GCA934149205_00166 gene open 58154-58408 rpsT
368 CAKPED010000002.1 GCA934149205_00168 gene open 58617-59342 recO
369 CAKPED010000002.1 GCA934149205_00169 gene open 59778-61946
370 CAKPED010000002.1 GCA934149205_00170 gene open 62905-65094
371 CAKPED010000002.1 GCA934149205_00171 gene open 65161-66192
372 CAKPED010000002.1 GCA934149205_00172 gene open 66228-68084
373 CAKPED010000002.1 GCA934149205_00173 gene open 68194-68691
374 CAKPED010000002.1 GCA934149205_00174 gene open 69073-70038
375 CAKPED010000002.1 GCA934149205_00175 gene open 70124-71035
376 CAKPED010000002.1 GCA934149205_00176 gene open 71070-71675
377 CAKPED010000002.1 GCA934149205_00177 gene open 71822-72442
378 CAKPED010000002.1 GCA934149205_00178 gene open 72881-73492
379 CAKPED010000002.1 GCA934149205_00179 gene open 73500-74045
380 CAKPED010000002.1 GCA934149205_00180 gene open 74103-74324
381 CAKPED010000002.1 GCA934149205_00181 gene open 74435-75043
382 CAKPED010000002.1 GCA934149205_00182 gene open 75098-77395 priA
383 CAKPED010000002.1 GCA934149205_00183 gene open 77544-79067
384 CAKPED010000002.1 GCA934149205_00184 gene open 79293-81368
385 CAKPED010000002.1 GCA934149205_00185 gene open 81475-82992 gltX
386 CAKPED010000002.1 GCA934149205_00186 gene open 83040-84260
387 CAKPED010000002.1 GCA934149205_00187 gene open 84257-84772
388 CAKPED010000002.1 GCA934149205_00188 gene open 84872-85960 trpS
389 CAKPED010000002.1 GCA934149205_00189 gene open 86377-86856
390 CAKPED010000002.1 GCA934149205_00190 gene open 86846-87358
391 CAKPED010000002.1 GCA934149205_00191 gene open 87517-89409 speA
392 CAKPED010000002.1 GCA934149205_00192 gene open 89461-90042
393 CAKPED010000002.1 GCA934149205_00193 gene open 90066-92414 topA
394 CAKPED010000002.1 GCA934149205_00194 gene open 92492-93031 mutT
395 CAKPED010000002.1 GCA934149205_00195 gene open 93311-94135
396 CAKPED010000002.1 GCA934149205_00196 gene open 94301-94528
397 CAKPED010000002.1 GCA934149205_00197 gene open 94533-94646
398 CAKPED010000002.1 GCA934149205_00198 gene open 94743-95897
399 CAKPED010000002.1 GCA934149205_00199 gene open 96275-96466
400 CAKPED010000002.1 GCA934149205_00200 gene open 96702-99794
401 CAKPED010000002.1 GCA934149205_00201 gene open 99813-101417
402 CAKPED010000002.1 GCA934149205_00202 gene open 101454-102548
403 CAKPED010000002.1 GCA934149205_00203 gene open 102586-103725
404 CAKPED010000002.1 GCA934149205_00112 gene open 1-74 trnT
405 CAKPED010000002.1 GCA934149205_00167 gene open 58433-58504 trnE
406 CAKPED010000002.1 GCA934149205_00112 tRNA open 1-74 trnT tRNA-Thr(tgt)
407 CAKPED010000002.1 GCA934149205_00167 tRNA open 58433-58504 trnE tRNA-Glu(ttc)
408 CAKPED010000003.1 GCA934149205_00204 CDS open 156-620 _na     154_aa Acyl dehydratase
409 CAKPED010000003.1 GCA934149205_00205 CDS open 736-1584 _na     282_aa Outer membrane insertion signal domain protein
410 CAKPED010000003.1 GCA934149205_00206 CDS open 2354-3421 _na     355_aa 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase
411 CAKPED010000003.1 GCA934149205_00207 CDS open 3452-4432 _na     326_aa Endonuclease/exonuclease/phosphatase family protein
412 CAKPED010000003.1 GCA934149205_00208 CDS open 4425-5261 _na     278_aa GYF domain-containing protein
413 CAKPED010000003.1 GCA934149205_00209 CDS open 5597-6958 _na     453_aa ffh signal recognition particle protein
414 CAKPED010000003.1 GCA934149205_00210 CDS open 6982-7866 _na     294_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
415 CAKPED010000003.1 GCA934149205_00211 CDS open 7886-8065 _na     59_aa Tetratricopeptide repeat protein
416 CAKPED010000003.1 GCA934149205_00212 CDS open 8078-8311 _na     77_aa Ferredoxin
417 CAKPED010000003.1 GCA934149205_00213 CDS open 8308-9402 _na     364_aa 2-ketoisovalerate ferredoxin oxidoreductase
418 CAKPED010000003.1 GCA934149205_00214 CDS open 9411-10178 _na     255_aa 2-oxoacid:ferredoxin oxidoreductase%2C beta subunit
419 CAKPED010000003.1 GCA934149205_00215 CDS open 10264-10806 _na     180_aa 2-oxoacid:ferredoxin/flavodoxin oxidoreductase%2C gamma subunit
420 CAKPED010000003.1 GCA934149205_00216 CDS open 11104-12216 _na     370_aa ompA OmpA family protein
421 CAKPED010000003.1 GCA934149205_00217 CDS open 12662-13087 _na     141_aa BT0820 family HAD-type phosphatase
422 CAKPED010000003.1 GCA934149205_00218 CDS open 13094-15592 _na     832_aa non-specific protein-tyrosine kinase
423 CAKPED010000003.1 GCA934149205_00219 CDS open 15627-16505 _na     292_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
424 CAKPED010000003.1 GCA934149205_00220 CDS open 16797-17429 _na     210_aa Bacteriophage Mx8 p63 C-terminal domain-containing protein
425 CAKPED010000003.1 GCA934149205_00221 CDS open 17495-17788 _na     97_aa Phenylalanyl-tRNA synthetase subunit beta
426 CAKPED010000003.1 GCA934149205_00222 CDS open 17807-18097 _na     96_aa zapA Cell division protein ZapA
427 CAKPED010000003.1 GCA934149205_00223 CDS open 18135-19676 _na     513_aa rny ribonuclease Y
428 CAKPED010000003.1 GCA934149205_00224 CDS open 19827-21002 _na     391_aa ABC-2 type transporter
429 CAKPED010000003.1 GCA934149205_00225 CDS open 21007-22179 _na     390_aa ABC-2 type transporter transmembrane domain-containing protein
430 CAKPED010000003.1 GCA934149205_00226 CDS open 22187-23170 _na     327_aa Auxiliary transport protein%2C membrane fusion protein family protein
431 CAKPED010000003.1 GCA934149205_00227 CDS open 23234-24706 _na     490_aa Alkaline protease
432 CAKPED010000003.1 GCA934149205_00228 CDS open 24919-25137 _na     72_aa DUF4492 domain-containing protein
433 CAKPED010000003.1 GCA934149205_00229 CDS open 25225-26760 _na     511_aa Cytochrome bd-type quinol oxidase%2C subunit 1
434 CAKPED010000003.1 GCA934149205_00230 CDS open 26757-27899 _na     380_aa Cytochrome bd-type quinol oxidase%2C subunit 2
435 CAKPED010000003.1 GCA934149205_00231 CDS open 28386-28724 _na     112_aa hypothetical protein
436 CAKPED010000003.1 GCA934149205_00232 CDS open 28790-31372 _na     860_aa Xanthan lyase
437 CAKPED010000003.1 GCA934149205_00233 CDS open 31374-31919 _na     181_aa Acyltransferase
438 CAKPED010000003.1 GCA934149205_00234 CDS open 31938-32210 _na     90_aa rteC RteC protein
439 CAKPED010000003.1 GCA934149205_00235 CDS open 32411-34054 _na     547_aa pfkA diphosphate--fructose-6-phosphate 1-phosphotransferase
440 CAKPED010000003.1 GCA934149205_00236 CDS open 34221-35108 _na     295_aa Lysozyme M1 (1%2C4-beta-N-acetylmuramidase)
441 CAKPED010000003.1 GCA934149205_00237 CDS open 35032-35901 _na     289_aa prmA 50S ribosomal protein L11 methyltransferase
442 CAKPED010000003.1 GCA934149205_00238 CDS open 36065-37057 _na     330_aa Vitellogenin II
443 CAKPED010000003.1 GCA934149205_00239 CDS open 37149-38792 _na     547_aa Hemin receptor
444 CAKPED010000003.1 GCA934149205_00240 CDS open 39175-39567 _na     130_aa Lipoprotein
445 CAKPED010000003.1 GCA934149205_00241 CDS open 39682-41463 _na     593_aa lepA translation elongation factor 4
446 CAKPED010000003.1 GCA934149205_00242 CDS open 41509-42108 _na     199_aa Cyclic nucleotide-binding protein
447 CAKPED010000003.1 GCA934149205_00243 CDS open 42235-43896 _na     553_aa AMP-binding enzyme
448 CAKPED010000003.1 GCA934149205_00244 CDS open 44124-45371 _na     415_aa ABC-type transport system%2C involved in lipoprotein release%2C permease component
449 CAKPED010000003.1 GCA934149205_00245 CDS open 45444-46646 _na     400_aa Aspartate aminotransferase
450 CAKPED010000003.1 GCA934149205_00246 CDS open 46670-46759 _na     29_aa hypothetical protein
451 CAKPED010000003.1 GCA934149205_00247 CDS open 46867-47346 _na     159_aa Phage tail protein
452 CAKPED010000003.1 GCA934149205_00248 CDS open 47383-48054 _na     223_aa Pyridoxal phosphate homeostasis protein
453 CAKPED010000003.1 GCA934149205_00249 CDS open 48068-48214 _na     48_aa hypothetical protein
454 CAKPED010000003.1 GCA934149205_00250 CDS open 48270-49355 _na     361_aa aroC chorismate synthase
455 CAKPED010000003.1 GCA934149205_00251 CDS open 49369-49974 _na     201_aa slyD FKBP-type peptidyl-prolyl cis-trans isomerase SlyD
456 CAKPED010000003.1 GCA934149205_00252 CDS open 50240-50728 _na     162_aa fldA flavodoxin FldA
457 CAKPED010000003.1 GCA934149205_00253 CDS open 50780-51139 _na     119_aa DUF2023 domain-containing protein
458 CAKPED010000003.1 GCA934149205_00254 CDS open 51354-51761 _na     135_aa Putative redox protein%2C regulator of disulfide bond formation
459 CAKPED010000003.1 GCA934149205_00255 CDS open 51820-53007 _na     395_aa IS256 family transposase
460 CAKPED010000003.1 GCA934149205_00256 CDS open 53224-54585 _na     453_aa dipeptidase
461 CAKPED010000003.1 GCA934149205_00257 CDS open 54953-55837 _na     294_aa fabD ACP S-malonyltransferase
462 CAKPED010000003.1 GCA934149205_00258 CDS open 55905-57575 _na     556_aa Alpha amylase%2C catalytic domain protein
463 CAKPED010000003.1 GCA934149205_00259 CDS open 57575-57997 _na     140_aa Threonine/alanine tRNA ligase second additional domain protein
464 CAKPED010000003.1 GCA934149205_00260 CDS open 58168-58269 _na     33_aa hypothetical protein
465 CAKPED010000003.1 GCA934149205_00261 CDS open 58606-60180 _na     524_aa Ribonuclease%2C Rne/Rng family
466 CAKPED010000003.1 GCA934149205_00263 CDS open 60470-60748 _na     92_aa DNA-binding protein HU
467 CAKPED010000003.1 GCA934149205_00264 CDS open 60931-61779 _na     282_aa coaW type II pantothenate kinase
468 CAKPED010000003.1 GCA934149205_00265 CDS open 61848-63617 _na     589_aa Cold-shock DEAD-box protein A family protein
469 CAKPED010000003.1 GCA934149205_00266 CDS open 63694-64911 _na     405_aa Putative permease
470 CAKPED010000003.1 GCA934149205_00267 CDS open 64931-66058 _na     375_aa tgt tRNA guanosine(34) transglycosylase Tgt
471 CAKPED010000003.1 GCA934149205_00268 CDS open 66059-68527 _na     822_aa lon endopeptidase La
472 CAKPED010000003.1 GCA934149205_00269 CDS open 68610-69314 _na     234_aa tRNA1(Val) (adenine(37)-N6)-methyltransferase
473 CAKPED010000003.1 GCA934149205_00270 CDS open 69320-70348 _na     342_aa DAGKc domain-containing protein
474 CAKPED010000003.1 GCA934149205_00271 CDS open 70556-71746 _na     396_aa spt serine palmitoyltransferase
475 CAKPED010000003.1 GCA934149205_00272 CDS open 72003-73160 _na     385_aa Cell division protein FtsI/penicillin-binding protein 2
476 CAKPED010000003.1 GCA934149205_00273 CDS open 73218-74438 _na     406_aa L-serine ammonia-lyase
477 CAKPED010000003.1 GCA934149205_00274 CDS open 74605-74754 _na     49_aa hypothetical protein
478 CAKPED010000003.1 GCA934149205_00275 CDS open 75036-75338 _na     100_aa type II toxin-antitoxin system RelE/ParE family toxin
479 CAKPED010000003.1 GCA934149205_00276 CDS open 75335-75592 _na     85_aa helix-turn-helix domain-containing protein
480 CAKPED010000003.1 GCA934149205_00277 CDS open 75739-76944 _na     401_aa pncB nicotinate phosphoribosyltransferase
481 CAKPED010000003.1 GCA934149205_00278 CDS open 76983-77996 _na     337_aa fmt methionyl-tRNA formyltransferase
482 CAKPED010000003.1 GCA934149205_00279 CDS open 78044-79858 _na     604_aa eriC Chloride channel protein EriC
483 CAKPED010000003.1 GCA934149205_00280 CDS open 79880-80449 _na     189_aa L-threonylcarbamoyladenylate synthase
484 CAKPED010000003.1 GCA934149205_00281 CDS open 80601-81578 _na     325_aa ROK family protein
485 CAKPED010000003.1 GCA934149205_00282 CDS open 81668-82384 _na     238_aa lysE Translocator protein%2C LysE family
486 CAKPED010000003.1 GCA934149205_00283 CDS open 82413-83024 _na     203_aa DUF4924 domain-containing protein
487 CAKPED010000003.1 GCA934149205_00284 CDS open 83058-83930 _na     290_aa rfbD dTDP-4-dehydrorhamnose reductase
488 CAKPED010000003.1 GCA934149205_00285 CDS open 83932-85500 _na     522_aa peptide chain release factor 3
489 CAKPED010000003.1 GCA934149205_00286 CDS open 86150-86608 _na     152_aa Membrane protein implicated in regulation of membrane protease activity
490 CAKPED010000003.1 GCA934149205_00287 CDS open 86625-87578 _na     317_aa Membrane protease subunit%2C stomatin/prohibitin
491 CAKPED010000003.1 GCA934149205_00288 CDS open 87587-88711 _na     374_aa UDP-N-acetylglucosamine 2-epimerase
492 CAKPED010000003.1 GCA934149205_00289 CDS open 88738-90129 _na     463_aa mepA Multidrug export protein MepA
493 CAKPED010000003.1 GCA934149205_00290 CDS open 90261-91139 _na     292_aa Peptidase M48 domain-containing protein
494 CAKPED010000003.1 GCA934149205_00291 CDS open 91277-92635 _na     452_aa Transporter%2C major facilitator family protein
495 CAKPED010000003.1 GCA934149205_00292 CDS open 92651-93973 _na     440_aa SpoIID/LytB domain protein
496 CAKPED010000003.1 GCA934149205_00293 CDS open 93989-94909 _na     306_aa DUF4922 domain-containing protein
497 CAKPED010000003.1 GCA934149205_00294 CDS open 94930-96414 _na     494_aa Glycosyltransferase%2C group 2 family protein
498 CAKPED010000003.1 GCA934149205_00295 CDS open 96517-97038 _na     173_aa Phosphopantetheinyl transferase component of siderophore synthetase
499 CAKPED010000003.1 GCA934149205_00296 CDS open 97025-98350 _na     441_aa gldE Gliding motility-associated protein GldE
500 CAKPED010000003.1 GCA934149205_00297 CDS open 98350-98793 _na     147_aa Single-stranded DNA-binding protein