BAKTAGenome Explorer: Pyramidobacter piscolens (GCA_937925425.1)
Select a Genome:
|
BAKTA Annotations for GCA_937925425.1
|
Search & Sort all 4831 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | CALEVY010000001.1 | GCA937925425_00001 | CDS | open | 530-1816 | _na 428_aa | hypothetical protein | |
| 2 | CALEVY010000001.1 | GCA937925425_00002 | CDS | open | 1818-2201 | _na 127_aa | hypothetical protein | |
| 3 | CALEVY010000001.1 | GCA937925425_00003 | CDS | open | 2176-3639 | _na 487_aa | DEAD/DEAH box helicase | |
| 4 | CALEVY010000001.1 | GCA937925425_00004 | CDS | open | 3636-4562 | _na 308_aa | hypothetical protein | |
| 5 | CALEVY010000001.1 | GCA937925425_00005 | CDS | open | 4534-5655 | _na 373_aa | phosphoadenosine phosphosulfate reductase family protein | |
| 6 | CALEVY010000001.1 | GCA937925425_00006 | CDS | open | 5655-6203 | _na 182_aa | ParB/RepB/Spo0J family partition protein | |
| 7 | CALEVY010000001.1 | GCA937925425_00007 | CDS | open | 6184-6858 | _na 224_aa | Methyltransferase | |
| 8 | CALEVY010000001.1 | GCA937925425_00008 | CDS | open | 6858-7208 | _na 116_aa | hypothetical protein | |
| 9 | CALEVY010000001.1 | GCA937925425_00009 | CDS | open | 7256-7534 | _na 92_aa | hypothetical protein | |
| 10 | CALEVY010000001.1 | GCA937925425_00010 | CDS | open | 8178-8510 | _na 110_aa | tolA | Cell envelope biogenesis protein TolA |
| 11 | CALEVY010000001.1 | GCA937925425_00011 | CDS | open | 8491-10500 | _na 669_aa | ntpI | V-type ATP synthase subunit I |
| 12 | CALEVY010000001.1 | GCA937925425_00012 | CDS | open | 10550-11026 | _na 158_aa | V-type ATP synthase subunit K | |
| 13 | CALEVY010000001.1 | GCA937925425_00013 | CDS | open | 11041-11625 | _na 194_aa | ntpE | V-ATPase subunit E |
| 14 | CALEVY010000001.1 | GCA937925425_00014 | CDS | open | 11638-12651 | _na 337_aa | ntpC | V-type ATP synthase subunit C |
| 15 | CALEVY010000001.1 | GCA937925425_00015 | CDS | open | 12641-12976 | _na 111_aa | ntpF | V-type ATP synthase subunit F |
| 16 | CALEVY010000001.1 | GCA937925425_00016 | CDS | open | 13001-14785 | _na 594_aa | ntpA | V-type ATP synthase alpha chain |
| 17 | CALEVY010000001.1 | GCA937925425_00017 | CDS | open | 14785-16197 | _na 470_aa | ntpB | V-type ATP synthase beta chain |
| 18 | CALEVY010000001.1 | GCA937925425_00018 | CDS | open | 16213-16836 | _na 207_aa | ntpD | V-type ATP synthase subunit D |
| 19 | CALEVY010000001.1 | GCA937925425_00019 | CDS | open | 17161-18255 | _na 364_aa | wecB | non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase |
| 20 | CALEVY010000001.1 | GCA937925425_00020 | CDS | open | 18320-18529 | _na 69_aa | DUF1858 domain-containing protein | |
| 21 | CALEVY010000001.1 | GCA937925425_00021 | CDS | open | 18654-20114 | _na 486_aa | cls | cardiolipin synthase |
| 22 | CALEVY010000001.1 | GCA937925425_00022 | CDS | open | 20558-21589 | _na 343_aa | ansA | Asparaginase |
| 23 | CALEVY010000001.1 | GCA937925425_00023 | CDS | open | 21645-22289 | _na 214_aa | deoC | deoxyribose-phosphate aldolase |
| 24 | CALEVY010000001.1 | GCA937925425_00024 | CDS | open | 22405-23208 | _na 267_aa | erfK | L%2CD-transpeptidase |
| 25 | CALEVY010000001.1 | GCA937925425_00027 | CDS | open | 23626-25020 | _na 464_aa | citX | citrate lyase holo-[acyl-carrier protein] synthase |
| 26 | CALEVY010000001.1 | GCA937925425_00028 | CDS | open | 25063-26445 | _na 460_aa | AmmeMemoRadiSam system protein A | |
| 27 | CALEVY010000001.1 | GCA937925425_00029 | CDS | open | 26442-27269 | _na 275_aa | pflA | AmmeMemoRadiSam system radical SAM enzyme |
| 28 | CALEVY010000001.1 | GCA937925425_00030 | CDS | open | 27579-29711 | _na 710_aa | glnA3 | Glutamine synthetase type III |
| 29 | CALEVY010000001.1 | GCA937925425_00031 | CDS | open | 29957-30652 | _na 231_aa | ulaG | metal-dependent hydrolase |
| 30 | CALEVY010000001.1 | GCA937925425_00032 | CDS | open | 30684-31205 | _na 173_aa | btuR | Cob(I)yrinic acid a%2Cc-diamide adenosyltransferase |
| 31 | CALEVY010000001.1 | GCA937925425_00033 | CDS | open | 31269-33017 | _na 582_aa | ptsA | Phosphoenolpyruvate-protein phosphotransferase |
| 32 | CALEVY010000001.1 | GCA937925425_00034 | CDS | open | 33303-33590 | _na 95_aa | groES | co-chaperone GroES |
| 33 | CALEVY010000001.1 | GCA937925425_00035 | CDS | open | 33633-35270 | _na 545_aa | groL | chaperonin GroEL |
| 34 | CALEVY010000001.1 | GCA937925425_00036 | CDS | open | 35419-37623 | _na 734_aa | mrcA | peptidoglycan glycosyltransferase |
| 35 | CALEVY010000001.1 | GCA937925425_00001 | gene | open | 530-1816 | |||
| 36 | CALEVY010000001.1 | GCA937925425_00002 | gene | open | 1818-2201 | |||
| 37 | CALEVY010000001.1 | GCA937925425_00003 | gene | open | 2176-3639 | |||
| 38 | CALEVY010000001.1 | GCA937925425_00004 | gene | open | 3636-4562 | |||
| 39 | CALEVY010000001.1 | GCA937925425_00005 | gene | open | 4534-5655 | |||
| 40 | CALEVY010000001.1 | GCA937925425_00006 | gene | open | 5655-6203 | |||
| 41 | CALEVY010000001.1 | GCA937925425_00007 | gene | open | 6184-6858 | |||
| 42 | CALEVY010000001.1 | GCA937925425_00008 | gene | open | 6858-7208 | |||
| 43 | CALEVY010000001.1 | GCA937925425_00009 | gene | open | 7256-7534 | |||
| 44 | CALEVY010000001.1 | GCA937925425_00010 | gene | open | 8178-8510 | tolA | ||
| 45 | CALEVY010000001.1 | GCA937925425_00011 | gene | open | 8491-10500 | ntpI | ||
| 46 | CALEVY010000001.1 | GCA937925425_00012 | gene | open | 10550-11026 | |||
| 47 | CALEVY010000001.1 | GCA937925425_00013 | gene | open | 11041-11625 | ntpE | ||
| 48 | CALEVY010000001.1 | GCA937925425_00014 | gene | open | 11638-12651 | ntpC | ||
| 49 | CALEVY010000001.1 | GCA937925425_00015 | gene | open | 12641-12976 | ntpF | ||
| 50 | CALEVY010000001.1 | GCA937925425_00016 | gene | open | 13001-14785 | ntpA | ||
| 51 | CALEVY010000001.1 | GCA937925425_00017 | gene | open | 14785-16197 | ntpB | ||
| 52 | CALEVY010000001.1 | GCA937925425_00018 | gene | open | 16213-16836 | ntpD | ||
| 53 | CALEVY010000001.1 | GCA937925425_00019 | gene | open | 17161-18255 | wecB | ||
| 54 | CALEVY010000001.1 | GCA937925425_00020 | gene | open | 18320-18529 | |||
| 55 | CALEVY010000001.1 | GCA937925425_00021 | gene | open | 18654-20114 | cls | ||
| 56 | CALEVY010000001.1 | GCA937925425_00022 | gene | open | 20558-21589 | ansA | ||
| 57 | CALEVY010000001.1 | GCA937925425_00023 | gene | open | 21645-22289 | deoC | ||
| 58 | CALEVY010000001.1 | GCA937925425_00024 | gene | open | 22405-23208 | erfK | ||
| 59 | CALEVY010000001.1 | GCA937925425_00027 | gene | open | 23626-25020 | citX | ||
| 60 | CALEVY010000001.1 | GCA937925425_00028 | gene | open | 25063-26445 | |||
| 61 | CALEVY010000001.1 | GCA937925425_00029 | gene | open | 26442-27269 | pflA | ||
| 62 | CALEVY010000001.1 | GCA937925425_00030 | gene | open | 27579-29711 | glnA3 | ||
| 63 | CALEVY010000001.1 | GCA937925425_00031 | gene | open | 29957-30652 | ulaG | ||
| 64 | CALEVY010000001.1 | GCA937925425_00032 | gene | open | 30684-31205 | btuR | ||
| 65 | CALEVY010000001.1 | GCA937925425_00033 | gene | open | 31269-33017 | ptsA | ||
| 66 | CALEVY010000001.1 | GCA937925425_00034 | gene | open | 33303-33590 | groES | ||
| 67 | CALEVY010000001.1 | GCA937925425_00035 | gene | open | 33633-35270 | groL | ||
| 68 | CALEVY010000001.1 | GCA937925425_00036 | gene | open | 35419-37623 | mrcA | ||
| 69 | CALEVY010000001.1 | GCA937925425_00025 | gene | open | 23285-23361 | trnfM | ||
| 70 | CALEVY010000001.1 | GCA937925425_00026 | gene | open | 23368-23444 | trnM | ||
| 71 | CALEVY010000001.1 | GCA937925425_00025 | tRNA | open | 23285-23361 | trnfM | tRNA-fMet(cat) | |
| 72 | CALEVY010000001.1 | GCA937925425_00026 | tRNA | open | 23368-23444 | trnM | tRNA-Met(cat) | |
| 73 | CALEVY010000002.1 | GCA937925425_00183 | gene | open | 171277-171386 | rrf | ||
| 74 | CALEVY010000002.1 | GCA937925425_00184 | gene | open | 171550-171664 | rrf | ||
| 75 | CALEVY010000002.1 | GCA937925425_00185 | gene | open | 171818-172795 | rrl | ||
| 76 | CALEVY010000002.1 | regulatory_region | open | 32289-32373 | NiCo (Nickel/Cobalt) riboswitch aptamer | |||
| 77 | CALEVY010000002.1 | regulatory_region | open | 159087-159255 | Cobalamin riboswitch aptamer | |||
| 78 | CALEVY010000002.1 | GCA937925425_00183 | rRNA | open | 171277-171386 | rrf | 5S ribosomal RNA | |
| 79 | CALEVY010000002.1 | GCA937925425_00184 | rRNA | open | 171550-171664 | rrf | 5S ribosomal RNA | |
| 80 | CALEVY010000002.1 | GCA937925425_00185 | rRNA | open | 171818-172795 | rrl | 23S ribosomal RNA | |
| 81 | CALEVY010000002.1 | repeat_region | open | 45214-46760 | CRISPR array with 24 repeats of length 31%2C consensus sequence CTTTCAATTCGCGCGCCCGTGAGGGCGCGAC and spacer length 34 | |||
| 82 | CALEVY010000002.1 | repeat_region | open | 77428-86493 | CRISPR array with 149 repeats of length 28%2C consensus sequence CAAAACCCCGCTCACGCGGGGATGAACC and spacer length 33 | |||
| 83 | CALEVY010000002.1 | GCA937925425_00037 | CDS | open | 183-1127 | _na 314_aa | tctC | Tripartite tricarboxylate transporter substrate binding protein |
| 84 | CALEVY010000002.1 | GCA937925425_00038 | CDS | open | 1155-1658 | _na 167_aa | DUF1468 domain-containing protein | |
| 85 | CALEVY010000002.1 | GCA937925425_00039 | CDS | open | 1674-3140 | _na 488_aa | C4-dicarboxylate ABC transporter permease | |
| 86 | CALEVY010000002.1 | GCA937925425_00040 | CDS | open | 3334-4704 | _na 456_aa | trkA | Trk system potassium transporter TrkA |
| 87 | CALEVY010000002.1 | GCA937925425_00041 | CDS | open | 4701-6167 | _na 488_aa | trkG | TrkH family potassium uptake protein |
| 88 | CALEVY010000002.1 | GCA937925425_00042 | CDS | open | 6460-6825 | _na 121_aa | MATE family efflux transporter | |
| 89 | CALEVY010000002.1 | GCA937925425_00043 | CDS | open | 6825-7880 | _na 351_aa | MATE family efflux transporter | |
| 90 | CALEVY010000002.1 | GCA937925425_00044 | CDS | open | 8019-9413 | _na 464_aa | arAAA | ATP-binding protein |
| 91 | CALEVY010000002.1 | GCA937925425_00045 | CDS | open | 9630-10514 | _na 294_aa | yitT | DUF2179 domain-containing protein |
| 92 | CALEVY010000002.1 | GCA937925425_00046 | CDS | open | 10579-11328 | _na 249_aa | LUD domain-containing protein | |
| 93 | CALEVY010000002.1 | GCA937925425_00047 | CDS | open | 11538-11909 | _na 123_aa | ridA | RidA family protein |
| 94 | CALEVY010000002.1 | GCA937925425_00048 | CDS | open | 12079-12927 | _na 282_aa | Endonuclease/exonuclease/phosphatase domain-containing protein | |
| 95 | CALEVY010000002.1 | GCA937925425_00049 | CDS | open | 12931-14913 | _na 660_aa | DUF2207 domain-containing protein | |
| 96 | CALEVY010000002.1 | GCA937925425_00050 | CDS | open | 15164-16066 | _na 300_aa | mmsB | NAD(P)-dependent oxidoreductase |
| 97 | CALEVY010000002.1 | GCA937925425_00051 | CDS | open | 16078-17997 | _na 639_aa | TRAP transporter fused permease subunit | |
| 98 | CALEVY010000002.1 | GCA937925425_00052 | CDS | open | 18155-19141 | _na 328_aa | imp | TAXI family TRAP transporter solute-binding subunit |
| 99 | CALEVY010000002.1 | GCA937925425_00053 | CDS | open | 19275-20459 | _na 394_aa | paaJ | Thiolase family protein |
| 100 | CALEVY010000002.1 | GCA937925425_00054 | CDS | open | 20461-21159 | _na 232_aa | atoA | 3-oxoacid CoA-transferase subunit B |
| 101 | CALEVY010000002.1 | GCA937925425_00055 | CDS | open | 21143-21832 | _na 229_aa | atoD | CoA transferase subunit A |
| 102 | CALEVY010000002.1 | GCA937925425_00056 | CDS | open | 22029-23612 | _na 527_aa | cdaR | PucR family transcriptional regulator |
| 103 | CALEVY010000002.1 | GCA937925425_00057 | CDS | open | 23881-24594 | _na 237_aa | comB | putative 2-phosphosulfolactate phosphatase |
| 104 | CALEVY010000002.1 | GCA937925425_00058 | CDS | open | 24699-25316 | _na 205_aa | rbr | rubrerythrin |
| 105 | CALEVY010000002.1 | GCA937925425_00059 | CDS | open | 25353-25730 | _na 125_aa | fur | Transcriptional repressor |
| 106 | CALEVY010000002.1 | GCA937925425_00060 | CDS | open | 25877-26755 | _na 292_aa | mmsB | NAD(P)-dependent oxidoreductase |
| 107 | CALEVY010000002.1 | GCA937925425_00061 | CDS | open | 26939-28129 | _na 396_aa | aRO8 | Aminotransferase class I/classII large domain-containing protein |
| 108 | CALEVY010000002.1 | GCA937925425_00062 | CDS | open | 28501-29694 | _na 397_aa | DUF819 domain-containing protein | |
| 109 | CALEVY010000002.1 | GCA937925425_00063 | CDS | open | 29885-31042 | _na 385_aa | yqdH | Iron-containing alcohol dehydrogenase |
| 110 | CALEVY010000002.1 | GCA937925425_00064 | CDS | open | 31297-32202 | _na 301_aa | cation diffusion facilitator family transporter | |
| 111 | CALEVY010000002.1 | GCA937925425_00065 | CDS | open | 32534-33067 | _na 177_aa | GNAT family N-acetyltransferase | |
| 112 | CALEVY010000002.1 | GCA937925425_00066 | CDS | open | 33474-35024 | _na 516_aa | hypothetical protein | |
| 113 | CALEVY010000002.1 | GCA937925425_00067 | CDS | open | 35329-36063 | _na 244_aa | pncA | Isochorismatase family protein |
| 114 | CALEVY010000002.1 | GCA937925425_00068 | CDS | open | 36231-37628 | _na 465_aa | hydA | dihydropyrimidinase |
| 115 | CALEVY010000002.1 | GCA937925425_00069 | CDS | open | 37789-38418 | _na 209_aa | ftcD | Methenyltetrahydrofolate cyclohydrolase |
| 116 | CALEVY010000002.1 | GCA937925425_00070 | CDS | open | 38433-39347 | _na 304_aa | ftcD | glutamate formimidoyltransferase |
| 117 | CALEVY010000002.1 | GCA937925425_00071 | CDS | open | 39418-40695 | _na 425_aa | ssnA | amidohydrolase family protein |
| 118 | CALEVY010000002.1 | GCA937925425_00072 | CDS | open | 41015-42277 | _na 420_aa | gltS | sodium/glutamate symporter |
| 119 | CALEVY010000002.1 | GCA937925425_00073 | CDS | open | 42582-43058 | _na 158_aa | D-Ala-D-Ala carboxypeptidase family metallohydrolase | |
| 120 | CALEVY010000002.1 | GCA937925425_00074 | CDS | open | 43271-43633 | _na 120_aa | Zinc-ribbon domain-containing protein | |
| 121 | CALEVY010000002.1 | GCA937925425_00075 | CDS | open | 43823-44353 | _na 176_aa | hypothetical protein | |
| 122 | CALEVY010000002.1 | GCA937925425_00076 | CDS | open | 46976-47266 | _na 96_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 123 | CALEVY010000002.1 | GCA937925425_00077 | CDS | open | 47276-48307 | _na 343_aa | cas1c | type I-C CRISPR-associated endonuclease Cas1c |
| 124 | CALEVY010000002.1 | GCA937925425_00078 | CDS | open | 48304-48957 | _na 217_aa | cas4 | CRISPR-associated protein Cas4 |
| 125 | CALEVY010000002.1 | GCA937925425_00079 | CDS | open | 48959-49825 | _na 288_aa | cas7c | type I-C CRISPR-associated protein Cas7/Csd2 |
| 126 | CALEVY010000002.1 | GCA937925425_00080 | CDS | open | 49846-51921 | _na 691_aa | cas8c | type I-C CRISPR-associated protein Cas8c/Csd1 |
| 127 | CALEVY010000002.1 | GCA937925425_00081 | CDS | open | 51918-52652 | _na 244_aa | cas5c | type I-C CRISPR-associated protein Cas5c |
| 128 | CALEVY010000002.1 | GCA937925425_00082 | CDS | open | 52683-55154 | _na 823_aa | cas3 | HD Cas3-type domain-containing protein |
| 129 | CALEVY010000002.1 | GCA937925425_00083 | CDS | open | 55305-55874 | _na 189_aa | ywlG | TIGR01440 family protein |
| 130 | CALEVY010000002.1 | GCA937925425_00084 | CDS | open | 56039-56917 | _na 292_aa | tyrosine-protein phosphatase | |
| 131 | CALEVY010000002.1 | GCA937925425_00085 | CDS | open | 57003-57527 | _na 174_aa | Phosphohydrolase | |
| 132 | CALEVY010000002.1 | GCA937925425_00086 | CDS | open | 57603-58688 | _na 361_aa | afuA | ABC transporter substrate-binding protein |
| 133 | CALEVY010000002.1 | GCA937925425_00087 | CDS | open | 59021-59818 | _na 265_aa | Metallo-beta-lactamase domain-containing protein | |
| 134 | CALEVY010000002.1 | GCA937925425_00088 | CDS | open | 60171-61340 | _na 389_aa | DUF2157 domain-containing protein | |
| 135 | CALEVY010000002.1 | GCA937925425_00089 | CDS | open | 61327-61890 | _na 187_aa | GDYXXLXY domain-containing protein | |
| 136 | CALEVY010000002.1 | GCA937925425_00090 | CDS | open | 62091-62783 | _na 230_aa | L-2-amino-thiazoline-4-carboxylic acid hydrolase | |
| 137 | CALEVY010000002.1 | GCA937925425_00091 | CDS | open | 63529-63873 | _na 114_aa | DUF2023 domain-containing protein | |
| 138 | CALEVY010000002.1 | GCA937925425_00092 | CDS | open | 64166-64678 | _na 170_aa | fldA | flavodoxin |
| 139 | CALEVY010000002.1 | GCA937925425_00093 | CDS | open | 64885-65253 | _na 122_aa | mntR | Metal-dependent transcriptional regulator |
| 140 | CALEVY010000002.1 | GCA937925425_00094 | CDS | open | 65265-65585 | _na 106_aa | hypothetical protein | |
| 141 | CALEVY010000002.1 | GCA937925425_00095 | CDS | open | 65615-66760 | _na 381_aa | hypothetical protein | |
| 142 | CALEVY010000002.1 | GCA937925425_00096 | CDS | open | 66865-67731 | _na 288_aa | OB-fold protein | |
| 143 | CALEVY010000002.1 | GCA937925425_00097 | CDS | open | 67977-70709 | _na 910_aa | cas3 | HD Cas3-type domain-containing protein |
| 144 | CALEVY010000002.1 | GCA937925425_00098 | CDS | open | 71006-72616 | _na 536_aa | cas8e | Type I-E CRISPR-associated protein Cse1/CasA |
| 145 | CALEVY010000002.1 | GCA937925425_00099 | CDS | open | 72617-73252 | _na 211_aa | casB | type I-E CRISPR-associated protein Cse2/CasB |
| 146 | CALEVY010000002.1 | GCA937925425_00100 | CDS | open | 73255-74475 | _na 406_aa | cas7e | type I-E CRISPR-associated protein Cas7/Cse4/CasC |
| 147 | CALEVY010000002.1 | GCA937925425_00101 | CDS | open | 74479-75288 | _na 269_aa | cas5e | type I-E CRISPR-associated protein Cas5/CasD |
| 148 | CALEVY010000002.1 | GCA937925425_00102 | CDS | open | 75290-76042 | _na 250_aa | Type I-E CRISPR-associated protein Cas6/Cse3/CasE | |
| 149 | CALEVY010000002.1 | GCA937925425_00103 | CDS | open | 76043-76918 | _na 291_aa | cas1e | type I-E CRISPR-associated endonuclease Cas1e |
| 150 | CALEVY010000002.1 | GCA937925425_00104 | CDS | open | 76919-77266 | _na 115_aa | cas2e | type I-E CRISPR-associated endoribonuclease Cas2e |
| 151 | CALEVY010000002.1 | GCA937925425_00105 | CDS | open | 86585-86809 | _na 74_aa | hypothetical protein | |
| 152 | CALEVY010000002.1 | GCA937925425_00106 | CDS | open | 86971-87135 | _na 54_aa | hypothetical protein | |
| 153 | CALEVY010000002.1 | GCA937925425_00107 | CDS | open | 87448-87708 | _na 86_aa | relB | Type II toxin-antitoxin system RelB/DinJ family antitoxin |
| 154 | CALEVY010000002.1 | GCA937925425_00108 | CDS | open | 87695-87988 | _na 97_aa | yafQ | type II toxin-antitoxin system YafQ family toxin |
| 155 | CALEVY010000002.1 | GCA937925425_00109 | CDS | open | 88810-89274 | _na 154_aa | resIII | Type III restriction endonuclease |
| 156 | CALEVY010000002.1 | GCA937925425_00110 | CDS | open | 89401-90294 | _na 297_aa | soxR | helix-turn-helix domain-containing protein |
| 157 | CALEVY010000002.1 | GCA937925425_00111 | CDS | open | 90471-91496 | _na 341_aa | dihydrodipicolinate reductase | |
| 158 | CALEVY010000002.1 | GCA937925425_00112 | CDS | open | 91833-91985 | _na 50_aa | hypothetical protein | |
| 159 | CALEVY010000002.1 | GCA937925425_00113 | CDS | open | 92498-94228 | _na 576_aa | mdlB | ABC transporter ATP-binding protein |
| 160 | CALEVY010000002.1 | GCA937925425_00114 | CDS | open | 94222-95988 | _na 588_aa | mdlB | ABC transporter ATP-binding protein |
| 161 | CALEVY010000002.1 | GCA937925425_00115 | CDS | open | 96059-96673 | _na 204_aa | acrR | TetR/AcrR family transcriptional regulator |
| 162 | CALEVY010000002.1 | GCA937925425_00116 | CDS | open | 96870-97541 | _na 223_aa | aNKYR | ankyrin repeat domain-containing protein |
| 163 | CALEVY010000002.1 | GCA937925425_00117 | CDS | open | 97747-98700 | _na 317_aa | DUF362 domain-containing protein | |
| 164 | CALEVY010000002.1 | GCA937925425_00118 | CDS | open | 98693-99592 | _na 299_aa | yraQ | Permease |
| 165 | CALEVY010000002.1 | GCA937925425_00119 | CDS | open | 99674-100144 | _na 156_aa | ATPase P | |
| 166 | CALEVY010000002.1 | GCA937925425_00120 | CDS | open | 100151-100930 | _na 259_aa | coaX | Type III pantothenate kinase |
| 167 | CALEVY010000002.1 | GCA937925425_00121 | CDS | open | 101120-102313 | _na 397_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 168 | CALEVY010000002.1 | GCA937925425_00122 | CDS | open | 102421-103755 | _na 444_aa | pepC | Aminopeptidase |
| 169 | CALEVY010000002.1 | GCA937925425_00123 | CDS | open | 103892-104335 | _na 147_aa | DUF1795 domain-containing protein | |
| 170 | CALEVY010000002.1 | GCA937925425_00124 | CDS | open | 104556-105173 | _na 205_aa | citB | HTH luxR-type domain-containing protein |
| 171 | CALEVY010000002.1 | GCA937925425_00125 | CDS | open | 105386-105868 | _na 160_aa | proX | Prolyl-tRNA synthetase associated domain-containing protein |
| 172 | CALEVY010000002.1 | GCA937925425_00126 | CDS | open | 105964-107259 | _na 431_aa | cdaR | Sugar diacid utilization regulator |
| 173 | CALEVY010000002.1 | GCA937925425_00127 | CDS | open | 107419-108705 | _na 428_aa | Beta-aspartyl-peptidase | |
| 174 | CALEVY010000002.1 | GCA937925425_00128 | CDS | open | 108719-109765 | _na 348_aa | Sarcosine reductase complex component B subunit beta | |
| 175 | CALEVY010000002.1 | GCA937925425_00129 | CDS | open | 109793-110032 | _na 79_aa | hypothetical protein | |
| 176 | CALEVY010000002.1 | GCA937925425_00130 | CDS | open | 110228-110584 | _na 118_aa | grdX | GrdX family protein |
| 177 | CALEVY010000002.1 | GCA937925425_00131 | CDS | open | 110699-112084 | _na 461_aa | yocR | Sodium-dependent transporter |
| 178 | CALEVY010000002.1 | GCA937925425_00132 | CDS | open | 112260-113789 | _na 509_aa | mdoB | LTA synthase family protein |
| 179 | CALEVY010000002.1 | GCA937925425_00133 | CDS | open | 113981-114799 | _na 272_aa | iclR | IclR family transcriptional regulator |
| 180 | CALEVY010000002.1 | GCA937925425_00134 | CDS | open | 115001-116191 | _na 396_aa | abgB | Peptidase M20 domain-containing protein 2 |
| 181 | CALEVY010000002.1 | GCA937925425_00135 | CDS | open | 116255-117667 | _na 470_aa | yfcC | YfcC family protein |
| 182 | CALEVY010000002.1 | GCA937925425_00136 | CDS | open | 117852-118895 | _na 347_aa | wcaA | glycosyltransferase family 2 protein |
| 183 | CALEVY010000002.1 | GCA937925425_00137 | CDS | open | 118988-120199 | _na 403_aa | abgB | Peptidase M20 dimerisation domain-containing protein |
| 184 | CALEVY010000002.1 | GCA937925425_00138 | CDS | open | 120464-122128 | _na 554_aa | pucR | PucR family transcriptional regulator |
| 185 | CALEVY010000002.1 | GCA937925425_00139 | CDS | open | 122382-123710 | _na 442_aa | codB | cytosine permease |
| 186 | CALEVY010000002.1 | GCA937925425_00140 | CDS | open | 123748-124794 | _na 348_aa | ampS | leucyl aminopeptidase |
| 187 | CALEVY010000002.1 | GCA937925425_00141 | CDS | open | 124820-125461 | _na 213_aa | hisJ | ABC transporter substrate-binding protein |
| 188 | CALEVY010000002.1 | GCA937925425_00142 | CDS | open | 125835-126644 | _na 269_aa | aspB | aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme |
| 189 | CALEVY010000002.1 | GCA937925425_00143 | CDS | open | 126641-126865 | _na 74_aa | aspB | aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme |
| 190 | CALEVY010000002.1 | GCA937925425_00144 | CDS | open | 126906-128084 | _na 392_aa | glxK | Glycerate kinase |
| 191 | CALEVY010000002.1 | GCA937925425_00145 | CDS | open | 128282-129709 | _na 475_aa | aNKYR | ankyrin repeat domain-containing protein |
| 192 | CALEVY010000002.1 | GCA937925425_00146 | CDS | open | 130369-131616 | _na 415_aa | fadL | Transporter |
| 193 | CALEVY010000002.1 | GCA937925425_00147 | CDS | open | 131712-132290 | _na 192_aa | rhtB | Lysine transporter LysE |
| 194 | CALEVY010000002.1 | GCA937925425_00149 | CDS | open | 132716-133129 | _na 137_aa | hicB | type II toxin-antitoxin system HicB family antitoxin |
| 195 | CALEVY010000002.1 | GCA937925425_00150 | CDS | open | 133726-134961 | _na 411_aa | gltP | Dicarboxylate/amino acid:cation symporter |
| 196 | CALEVY010000002.1 | GCA937925425_00151 | CDS | open | 134986-136023 | _na 345_aa | gLY1 | Low specificity L-threonine aldolase |
| 197 | CALEVY010000002.1 | GCA937925425_00152 | CDS | open | 136173-137123 | _na 316_aa | lysR | LysR family transcriptional regulator |
| 198 | CALEVY010000002.1 | GCA937925425_00153 | CDS | open | 137361-138278 | _na 305_aa | dppB | ABC transporter permease |
| 199 | CALEVY010000002.1 | GCA937925425_00154 | CDS | open | 138271-139131 | _na 286_aa | opp1C | nickel/cobalt ABC transporter permease |
| 200 | CALEVY010000002.1 | GCA937925425_00155 | CDS | open | 139138-140115 | _na 325_aa | dppD | ABC transporter ATP-binding protein |
| 201 | CALEVY010000002.1 | GCA937925425_00156 | CDS | open | 140102-141070 | _na 322_aa | dppD | ATP-binding cassette domain-containing protein |
| 202 | CALEVY010000002.1 | GCA937925425_00157 | CDS | open | 141164-142735 | _na 523_aa | ddpA | Glutathione ABC transporter substrate-binding protein |
| 203 | CALEVY010000002.1 | GCA937925425_00158 | CDS | open | 142878-143711 | _na 277_aa | dppA | Aminopeptidase |
| 204 | CALEVY010000002.1 | GCA937925425_00159 | CDS | open | 143810-145321 | _na 503_aa | DUF112 domain-containing protein | |
| 205 | CALEVY010000002.1 | GCA937925425_00160 | CDS | open | 145333-145812 | _na 159_aa | DUF1468 domain-containing protein | |
| 206 | CALEVY010000002.1 | GCA937925425_00161 | CDS | open | 145892-146854 | _na 320_aa | tctC | Tripartite tricarboxylate transporter substrate binding protein |
| 207 | CALEVY010000002.1 | GCA937925425_00162 | CDS | open | 146868-147899 | _na 343_aa | serA | 3-phosphoglycerate dehydrogenase |
| 208 | CALEVY010000002.1 | GCA937925425_00163 | CDS | open | 147930-148655 | _na 241_aa | rraA | Regulator of ribonuclease activity-like protein |
| 209 | CALEVY010000002.1 | GCA937925425_00164 | CDS | open | 148813-149781 | _na 322_aa | lysR | HTH lysR-type domain-containing protein |
| 210 | CALEVY010000002.1 | GCA937925425_00165 | CDS | open | 149946-150860 | _na 304_aa | rhaT | DMT family transporter |
| 211 | CALEVY010000002.1 | GCA937925425_00166 | CDS | open | 150937-151452 | _na 171_aa | nimA | Pyridoxamine 5'-phosphate oxidase family protein |
| 212 | CALEVY010000002.1 | GCA937925425_00167 | CDS | open | 151546-152202 | _na 218_aa | Transporter | |
| 213 | CALEVY010000002.1 | GCA937925425_00168 | CDS | open | 152216-152839 | _na 207_aa | DUF5058 domain-containing protein | |
| 214 | CALEVY010000002.1 | GCA937925425_00169 | CDS | open | 152996-154426 | _na 476_aa | gatA | Amidase domain-containing protein |
| 215 | CALEVY010000002.1 | GCA937925425_00170 | CDS | open | 154716-155501 | _na 261_aa | fepC | ABC transporter ATP-binding protein |
| 216 | CALEVY010000002.1 | GCA937925425_00171 | CDS | open | 155498-156559 | _na 353_aa | fepD | Iron ABC transporter permease |
| 217 | CALEVY010000002.1 | GCA937925425_00172 | CDS | open | 156560-157564 | _na 334_aa | fepB | ABC transporter substrate-binding protein |
| 218 | CALEVY010000002.1 | GCA937925425_00173 | CDS | open | 157929-158936 | _na 335_aa | fepB | Iron ABC transporter substrate-binding protein |
| 219 | CALEVY010000002.1 | GCA937925425_00174 | CDS | open | 159398-160060 | _na 220_aa | L%2CD-TPase catalytic domain-containing protein | |
| 220 | CALEVY010000002.1 | GCA937925425_00175 | CDS | open | 160175-161278 | _na 367_aa | LOR/SDH bifunctional protein | |
| 221 | CALEVY010000002.1 | GCA937925425_00176 | CDS | open | 161275-162441 | _na 388_aa | Arginine dihydrolase ArgZ/ArgE-like C-terminal second subdomain domain-containing protein | |
| 222 | CALEVY010000002.1 | GCA937925425_00177 | CDS | open | 162438-163769 | _na 443_aa | araC | HTH araC/xylS-type domain-containing protein |
| 223 | CALEVY010000002.1 | GCA937925425_00178 | CDS | open | 163820-164749 | _na 309_aa | arcC | Carbamate kinase |
| 224 | CALEVY010000002.1 | GCA937925425_00179 | CDS | open | 164785-167274 | _na 829_aa | clpA | Clp R domain-containing protein |
| 225 | CALEVY010000002.1 | GCA937925425_00180 | CDS | open | 167284-168441 | _na 385_aa | Transporter gate domain protein | |
| 226 | CALEVY010000002.1 | GCA937925425_00181 | CDS | open | 168539-169918 | _na 459_aa | alsT | Sodium:alanine symporter family protein |
| 227 | CALEVY010000002.1 | GCA937925425_00182 | CDS | open | 170003-170995 | _na 330_aa | argF | ornithine carbamoyltransferase |
| 228 | CALEVY010000002.1 | GCA937925425_00037 | gene | open | 183-1127 | tctC | ||
| 229 | CALEVY010000002.1 | GCA937925425_00038 | gene | open | 1155-1658 | |||
| 230 | CALEVY010000002.1 | GCA937925425_00039 | gene | open | 1674-3140 | |||
| 231 | CALEVY010000002.1 | GCA937925425_00040 | gene | open | 3334-4704 | trkA | ||
| 232 | CALEVY010000002.1 | GCA937925425_00041 | gene | open | 4701-6167 | trkG | ||
| 233 | CALEVY010000002.1 | GCA937925425_00042 | gene | open | 6460-6825 | |||
| 234 | CALEVY010000002.1 | GCA937925425_00043 | gene | open | 6825-7880 | |||
| 235 | CALEVY010000002.1 | GCA937925425_00044 | gene | open | 8019-9413 | arAAA | ||
| 236 | CALEVY010000002.1 | GCA937925425_00045 | gene | open | 9630-10514 | yitT | ||
| 237 | CALEVY010000002.1 | GCA937925425_00046 | gene | open | 10579-11328 | |||
| 238 | CALEVY010000002.1 | GCA937925425_00047 | gene | open | 11538-11909 | ridA | ||
| 239 | CALEVY010000002.1 | GCA937925425_00048 | gene | open | 12079-12927 | |||
| 240 | CALEVY010000002.1 | GCA937925425_00049 | gene | open | 12931-14913 | |||
| 241 | CALEVY010000002.1 | GCA937925425_00050 | gene | open | 15164-16066 | mmsB | ||
| 242 | CALEVY010000002.1 | GCA937925425_00051 | gene | open | 16078-17997 | |||
| 243 | CALEVY010000002.1 | GCA937925425_00052 | gene | open | 18155-19141 | imp | ||
| 244 | CALEVY010000002.1 | GCA937925425_00053 | gene | open | 19275-20459 | paaJ | ||
| 245 | CALEVY010000002.1 | GCA937925425_00054 | gene | open | 20461-21159 | atoA | ||
| 246 | CALEVY010000002.1 | GCA937925425_00055 | gene | open | 21143-21832 | atoD | ||
| 247 | CALEVY010000002.1 | GCA937925425_00056 | gene | open | 22029-23612 | cdaR | ||
| 248 | CALEVY010000002.1 | GCA937925425_00057 | gene | open | 23881-24594 | comB | ||
| 249 | CALEVY010000002.1 | GCA937925425_00058 | gene | open | 24699-25316 | rbr | ||
| 250 | CALEVY010000002.1 | GCA937925425_00059 | gene | open | 25353-25730 | fur | ||
| 251 | CALEVY010000002.1 | GCA937925425_00060 | gene | open | 25877-26755 | mmsB | ||
| 252 | CALEVY010000002.1 | GCA937925425_00061 | gene | open | 26939-28129 | aRO8 | ||
| 253 | CALEVY010000002.1 | GCA937925425_00062 | gene | open | 28501-29694 | |||
| 254 | CALEVY010000002.1 | GCA937925425_00063 | gene | open | 29885-31042 | yqdH | ||
| 255 | CALEVY010000002.1 | GCA937925425_00064 | gene | open | 31297-32202 | |||
| 256 | CALEVY010000002.1 | GCA937925425_00065 | gene | open | 32534-33067 | |||
| 257 | CALEVY010000002.1 | GCA937925425_00066 | gene | open | 33474-35024 | |||
| 258 | CALEVY010000002.1 | GCA937925425_00067 | gene | open | 35329-36063 | pncA | ||
| 259 | CALEVY010000002.1 | GCA937925425_00068 | gene | open | 36231-37628 | hydA | ||
| 260 | CALEVY010000002.1 | GCA937925425_00069 | gene | open | 37789-38418 | ftcD | ||
| 261 | CALEVY010000002.1 | GCA937925425_00070 | gene | open | 38433-39347 | ftcD | ||
| 262 | CALEVY010000002.1 | GCA937925425_00071 | gene | open | 39418-40695 | ssnA | ||
| 263 | CALEVY010000002.1 | GCA937925425_00072 | gene | open | 41015-42277 | gltS | ||
| 264 | CALEVY010000002.1 | GCA937925425_00073 | gene | open | 42582-43058 | |||
| 265 | CALEVY010000002.1 | GCA937925425_00074 | gene | open | 43271-43633 | |||
| 266 | CALEVY010000002.1 | GCA937925425_00075 | gene | open | 43823-44353 | |||
| 267 | CALEVY010000002.1 | GCA937925425_00076 | gene | open | 46976-47266 | cas2 | ||
| 268 | CALEVY010000002.1 | GCA937925425_00077 | gene | open | 47276-48307 | cas1c | ||
| 269 | CALEVY010000002.1 | GCA937925425_00078 | gene | open | 48304-48957 | cas4 | ||
| 270 | CALEVY010000002.1 | GCA937925425_00079 | gene | open | 48959-49825 | cas7c | ||
| 271 | CALEVY010000002.1 | GCA937925425_00080 | gene | open | 49846-51921 | cas8c | ||
| 272 | CALEVY010000002.1 | GCA937925425_00081 | gene | open | 51918-52652 | cas5c | ||
| 273 | CALEVY010000002.1 | GCA937925425_00082 | gene | open | 52683-55154 | cas3 | ||
| 274 | CALEVY010000002.1 | GCA937925425_00083 | gene | open | 55305-55874 | ywlG | ||
| 275 | CALEVY010000002.1 | GCA937925425_00084 | gene | open | 56039-56917 | |||
| 276 | CALEVY010000002.1 | GCA937925425_00085 | gene | open | 57003-57527 | |||
| 277 | CALEVY010000002.1 | GCA937925425_00086 | gene | open | 57603-58688 | afuA | ||
| 278 | CALEVY010000002.1 | GCA937925425_00087 | gene | open | 59021-59818 | |||
| 279 | CALEVY010000002.1 | GCA937925425_00088 | gene | open | 60171-61340 | |||
| 280 | CALEVY010000002.1 | GCA937925425_00089 | gene | open | 61327-61890 | |||
| 281 | CALEVY010000002.1 | GCA937925425_00090 | gene | open | 62091-62783 | |||
| 282 | CALEVY010000002.1 | GCA937925425_00091 | gene | open | 63529-63873 | |||
| 283 | CALEVY010000002.1 | GCA937925425_00092 | gene | open | 64166-64678 | fldA | ||
| 284 | CALEVY010000002.1 | GCA937925425_00093 | gene | open | 64885-65253 | mntR | ||
| 285 | CALEVY010000002.1 | GCA937925425_00094 | gene | open | 65265-65585 | |||
| 286 | CALEVY010000002.1 | GCA937925425_00095 | gene | open | 65615-66760 | |||
| 287 | CALEVY010000002.1 | GCA937925425_00096 | gene | open | 66865-67731 | |||
| 288 | CALEVY010000002.1 | GCA937925425_00097 | gene | open | 67977-70709 | cas3 | ||
| 289 | CALEVY010000002.1 | GCA937925425_00098 | gene | open | 71006-72616 | cas8e | ||
| 290 | CALEVY010000002.1 | GCA937925425_00099 | gene | open | 72617-73252 | casB | ||
| 291 | CALEVY010000002.1 | GCA937925425_00100 | gene | open | 73255-74475 | cas7e | ||
| 292 | CALEVY010000002.1 | GCA937925425_00101 | gene | open | 74479-75288 | cas5e | ||
| 293 | CALEVY010000002.1 | GCA937925425_00102 | gene | open | 75290-76042 | |||
| 294 | CALEVY010000002.1 | GCA937925425_00103 | gene | open | 76043-76918 | cas1e | ||
| 295 | CALEVY010000002.1 | GCA937925425_00104 | gene | open | 76919-77266 | cas2e | ||
| 296 | CALEVY010000002.1 | GCA937925425_00105 | gene | open | 86585-86809 | |||
| 297 | CALEVY010000002.1 | GCA937925425_00106 | gene | open | 86971-87135 | |||
| 298 | CALEVY010000002.1 | GCA937925425_00107 | gene | open | 87448-87708 | relB | ||
| 299 | CALEVY010000002.1 | GCA937925425_00108 | gene | open | 87695-87988 | yafQ | ||
| 300 | CALEVY010000002.1 | GCA937925425_00109 | gene | open | 88810-89274 | resIII | ||
| 301 | CALEVY010000002.1 | GCA937925425_00110 | gene | open | 89401-90294 | soxR | ||
| 302 | CALEVY010000002.1 | GCA937925425_00111 | gene | open | 90471-91496 | |||
| 303 | CALEVY010000002.1 | GCA937925425_00112 | gene | open | 91833-91985 | |||
| 304 | CALEVY010000002.1 | GCA937925425_00113 | gene | open | 92498-94228 | mdlB | ||
| 305 | CALEVY010000002.1 | GCA937925425_00114 | gene | open | 94222-95988 | mdlB | ||
| 306 | CALEVY010000002.1 | GCA937925425_00115 | gene | open | 96059-96673 | acrR | ||
| 307 | CALEVY010000002.1 | GCA937925425_00116 | gene | open | 96870-97541 | aNKYR | ||
| 308 | CALEVY010000002.1 | GCA937925425_00117 | gene | open | 97747-98700 | |||
| 309 | CALEVY010000002.1 | GCA937925425_00118 | gene | open | 98693-99592 | yraQ | ||
| 310 | CALEVY010000002.1 | GCA937925425_00119 | gene | open | 99674-100144 | |||
| 311 | CALEVY010000002.1 | GCA937925425_00120 | gene | open | 100151-100930 | coaX | ||
| 312 | CALEVY010000002.1 | GCA937925425_00121 | gene | open | 101120-102313 | coaBC | ||
| 313 | CALEVY010000002.1 | GCA937925425_00122 | gene | open | 102421-103755 | pepC | ||
| 314 | CALEVY010000002.1 | GCA937925425_00123 | gene | open | 103892-104335 | |||
| 315 | CALEVY010000002.1 | GCA937925425_00124 | gene | open | 104556-105173 | citB | ||
| 316 | CALEVY010000002.1 | GCA937925425_00125 | gene | open | 105386-105868 | proX | ||
| 317 | CALEVY010000002.1 | GCA937925425_00126 | gene | open | 105964-107259 | cdaR | ||
| 318 | CALEVY010000002.1 | GCA937925425_00127 | gene | open | 107419-108705 | |||
| 319 | CALEVY010000002.1 | GCA937925425_00128 | gene | open | 108719-109765 | |||
| 320 | CALEVY010000002.1 | GCA937925425_00129 | gene | open | 109793-110032 | |||
| 321 | CALEVY010000002.1 | GCA937925425_00130 | gene | open | 110228-110584 | grdX | ||
| 322 | CALEVY010000002.1 | GCA937925425_00131 | gene | open | 110699-112084 | yocR | ||
| 323 | CALEVY010000002.1 | GCA937925425_00132 | gene | open | 112260-113789 | mdoB | ||
| 324 | CALEVY010000002.1 | GCA937925425_00133 | gene | open | 113981-114799 | iclR | ||
| 325 | CALEVY010000002.1 | GCA937925425_00134 | gene | open | 115001-116191 | abgB | ||
| 326 | CALEVY010000002.1 | GCA937925425_00135 | gene | open | 116255-117667 | yfcC | ||
| 327 | CALEVY010000002.1 | GCA937925425_00136 | gene | open | 117852-118895 | wcaA | ||
| 328 | CALEVY010000002.1 | GCA937925425_00137 | gene | open | 118988-120199 | abgB | ||
| 329 | CALEVY010000002.1 | GCA937925425_00138 | gene | open | 120464-122128 | pucR | ||
| 330 | CALEVY010000002.1 | GCA937925425_00139 | gene | open | 122382-123710 | codB | ||
| 331 | CALEVY010000002.1 | GCA937925425_00140 | gene | open | 123748-124794 | ampS | ||
| 332 | CALEVY010000002.1 | GCA937925425_00141 | gene | open | 124820-125461 | hisJ | ||
| 333 | CALEVY010000002.1 | GCA937925425_00142 | gene | open | 125835-126644 | aspB | ||
| 334 | CALEVY010000002.1 | GCA937925425_00143 | gene | open | 126641-126865 | aspB | ||
| 335 | CALEVY010000002.1 | GCA937925425_00144 | gene | open | 126906-128084 | glxK | ||
| 336 | CALEVY010000002.1 | GCA937925425_00145 | gene | open | 128282-129709 | aNKYR | ||
| 337 | CALEVY010000002.1 | GCA937925425_00146 | gene | open | 130369-131616 | fadL | ||
| 338 | CALEVY010000002.1 | GCA937925425_00147 | gene | open | 131712-132290 | rhtB | ||
| 339 | CALEVY010000002.1 | GCA937925425_00149 | gene | open | 132716-133129 | hicB | ||
| 340 | CALEVY010000002.1 | GCA937925425_00150 | gene | open | 133726-134961 | gltP | ||
| 341 | CALEVY010000002.1 | GCA937925425_00151 | gene | open | 134986-136023 | gLY1 | ||
| 342 | CALEVY010000002.1 | GCA937925425_00152 | gene | open | 136173-137123 | lysR | ||
| 343 | CALEVY010000002.1 | GCA937925425_00153 | gene | open | 137361-138278 | dppB | ||
| 344 | CALEVY010000002.1 | GCA937925425_00154 | gene | open | 138271-139131 | opp1C | ||
| 345 | CALEVY010000002.1 | GCA937925425_00155 | gene | open | 139138-140115 | dppD | ||
| 346 | CALEVY010000002.1 | GCA937925425_00156 | gene | open | 140102-141070 | dppD | ||
| 347 | CALEVY010000002.1 | GCA937925425_00157 | gene | open | 141164-142735 | ddpA | ||
| 348 | CALEVY010000002.1 | GCA937925425_00158 | gene | open | 142878-143711 | dppA | ||
| 349 | CALEVY010000002.1 | GCA937925425_00159 | gene | open | 143810-145321 | |||
| 350 | CALEVY010000002.1 | GCA937925425_00160 | gene | open | 145333-145812 | |||
| 351 | CALEVY010000002.1 | GCA937925425_00161 | gene | open | 145892-146854 | tctC | ||
| 352 | CALEVY010000002.1 | GCA937925425_00162 | gene | open | 146868-147899 | serA | ||
| 353 | CALEVY010000002.1 | GCA937925425_00163 | gene | open | 147930-148655 | rraA | ||
| 354 | CALEVY010000002.1 | GCA937925425_00164 | gene | open | 148813-149781 | lysR | ||
| 355 | CALEVY010000002.1 | GCA937925425_00165 | gene | open | 149946-150860 | rhaT | ||
| 356 | CALEVY010000002.1 | GCA937925425_00166 | gene | open | 150937-151452 | nimA | ||
| 357 | CALEVY010000002.1 | GCA937925425_00167 | gene | open | 151546-152202 | |||
| 358 | CALEVY010000002.1 | GCA937925425_00168 | gene | open | 152216-152839 | |||
| 359 | CALEVY010000002.1 | GCA937925425_00169 | gene | open | 152996-154426 | gatA | ||
| 360 | CALEVY010000002.1 | GCA937925425_00170 | gene | open | 154716-155501 | fepC | ||
| 361 | CALEVY010000002.1 | GCA937925425_00171 | gene | open | 155498-156559 | fepD | ||
| 362 | CALEVY010000002.1 | GCA937925425_00172 | gene | open | 156560-157564 | fepB | ||
| 363 | CALEVY010000002.1 | GCA937925425_00173 | gene | open | 157929-158936 | fepB | ||
| 364 | CALEVY010000002.1 | GCA937925425_00174 | gene | open | 159398-160060 | |||
| 365 | CALEVY010000002.1 | GCA937925425_00175 | gene | open | 160175-161278 | |||
| 366 | CALEVY010000002.1 | GCA937925425_00176 | gene | open | 161275-162441 | |||
| 367 | CALEVY010000002.1 | GCA937925425_00177 | gene | open | 162438-163769 | araC | ||
| 368 | CALEVY010000002.1 | GCA937925425_00178 | gene | open | 163820-164749 | arcC | ||
| 369 | CALEVY010000002.1 | GCA937925425_00179 | gene | open | 164785-167274 | clpA | ||
| 370 | CALEVY010000002.1 | GCA937925425_00180 | gene | open | 167284-168441 | |||
| 371 | CALEVY010000002.1 | GCA937925425_00181 | gene | open | 168539-169918 | alsT | ||
| 372 | CALEVY010000002.1 | GCA937925425_00182 | gene | open | 170003-170995 | argF | ||
| 373 | CALEVY010000002.1 | GCA937925425_00148 | gene | open | 132358-132443 | trnS | ||
| 374 | CALEVY010000002.1 | GCA937925425_00148 | tRNA | open | 132358-132443 | trnS | tRNA-Ser(tga) | |
| 375 | CALEVY010000003.1 | GCA937925425_00186 | CDS | open | 292-2115 | _na 607_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 376 | CALEVY010000003.1 | GCA937925425_00187 | CDS | open | 2456-2929 | _na 157_aa | ibpA | Hsp20/alpha crystallin family protein |
| 377 | CALEVY010000003.1 | GCA937925425_00186 | gene | open | 292-2115 | ftsH | ||
| 378 | CALEVY010000003.1 | GCA937925425_00187 | gene | open | 2456-2929 | ibpA | ||
| 379 | CALEVY010000004.1 | GCA937925425_00188 | CDS | open | 36-428 | _na 130_aa | Trimeric autotransporter adhesin YadA-like C-terminal membrane anchor domain-containing protein | |
| 380 | CALEVY010000004.1 | GCA937925425_00189 | CDS | open | 532-1047 | _na 171_aa | ompH | OmpH family outer membrane protein |
| 381 | CALEVY010000004.1 | GCA937925425_00190 | CDS | open | 1150-1404 | _na 84_aa | hypothetical protein | |
| 382 | CALEVY010000004.1 | GCA937925425_00191 | CDS | open | 1407-2807 | _na 466_aa | degQ | DegQ family serine endoprotease |
| 383 | CALEVY010000004.1 | GCA937925425_00193 | CDS | open | 3710-4537 | _na 275_aa | yciV | PHP domain-containing protein |
| 384 | CALEVY010000004.1 | GCA937925425_00194 | CDS | open | 4549-5898 | _na 449_aa | tldD | TldD/PmbA family protein |
| 385 | CALEVY010000004.1 | GCA937925425_00195 | CDS | open | 5840-7522 | _na 560_aa | amiC | MurNAc-LAA domain-containing protein |
| 386 | CALEVY010000004.1 | GCA937925425_00196 | CDS | open | 7571-8230 | _na 219_aa | GerMN domain-containing protein | |
| 387 | CALEVY010000004.1 | GCA937925425_00197 | CDS | open | 8320-9075 | _na 251_aa | rph | ribonuclease PH |
| 388 | CALEVY010000004.1 | GCA937925425_00198 | CDS | open | 9072-9683 | _na 203_aa | rdgB | RdgB/HAM1 family non-canonical purine NTP pyrophosphatase |
| 389 | CALEVY010000004.1 | GCA937925425_00199 | CDS | open | 9827-10048 | _na 73_aa | secG | preprotein translocase subunit SecG |
| 390 | CALEVY010000004.1 | GCA937925425_00200 | CDS | open | 10071-11108 | _na 345_aa | pncB | nicotinate phosphoribosyltransferase |
| 391 | CALEVY010000004.1 | GCA937925425_00201 | CDS | open | 11297-11731 | _na 144_aa | rplM | 50S ribosomal protein L13 |
| 392 | CALEVY010000004.1 | GCA937925425_00202 | CDS | open | 11748-12140 | _na 130_aa | rpsI | 30S ribosomal protein S9 |
| 393 | CALEVY010000004.1 | GCA937925425_00204 | CDS | open | 12402-12650 | _na 82_aa | glutaredoxin | |
| 394 | CALEVY010000004.1 | GCA937925425_00205 | CDS | open | 12702-13799 | _na 365_aa | Adenine DNA glycosylase | |
| 395 | CALEVY010000004.1 | GCA937925425_00206 | CDS | open | 14038-14400 | _na 120_aa | hypA | hydrogenase maturation nickel metallochaperone HypA |
| 396 | CALEVY010000004.1 | GCA937925425_00207 | CDS | open | 14417-15052 | _na 211_aa | hypB | hydrogenase nickel incorporation protein HypB |
| 397 | CALEVY010000004.1 | GCA937925425_00208 | CDS | open | 15084-17060 | _na 658_aa | uvrD | DNA 3'-5' helicase |
| 398 | CALEVY010000004.1 | GCA937925425_00209 | CDS | open | 17014-17625 | _na 203_aa | coaE | dephospho-CoA kinase |
| 399 | CALEVY010000004.1 | GCA937925425_00210 | CDS | open | 17643-18278 | _na 211_aa | spoIVFB | Site-2 protease family protein |
| 400 | CALEVY010000004.1 | GCA937925425_00211 | CDS | open | 18317-19378 | _na 353_aa | abrB | AbrB family transcriptional regulator |
| 401 | CALEVY010000004.1 | GCA937925425_00212 | CDS | open | 19502-19927 | _na 141_aa | slpA | Peptidyl-prolyl cis-trans isomerase |
| 402 | CALEVY010000004.1 | GCA937925425_00213 | CDS | open | 19931-21865 | _na 644_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 403 | CALEVY010000004.1 | GCA937925425_00214 | CDS | open | 21862-22857 | _na 331_aa | Chromosome partition protein Smc | |
| 404 | CALEVY010000004.1 | GCA937925425_00215 | CDS | open | 22905-25265 | _na 786_aa | yhiN | aminoacetone oxidase family FAD-binding enzyme |
| 405 | CALEVY010000004.1 | GCA937925425_00216 | CDS | open | 25429-25998 | _na 189_aa | pncA | bifunctional nicotinamidase/pyrazinamidase |
| 406 | CALEVY010000004.1 | GCA937925425_00217 | CDS | open | 26086-27609 | _na 507_aa | hypothetical protein | |
| 407 | CALEVY010000004.1 | GCA937925425_00218 | CDS | open | 27645-27977 | _na 110_aa | ybjQ | putative pentameric protein YbjQ%2C UPF0145 family |
| 408 | CALEVY010000004.1 | GCA937925425_00219 | CDS | open | 28038-30197 | _na 719_aa | tex | RNA-binding transcriptional accessory protein |
| 409 | CALEVY010000004.1 | GCA937925425_00220 | CDS | open | 30337-32271 | _na 644_aa | C4-dicarboxylate ABC transporter permease | |
| 410 | CALEVY010000004.1 | GCA937925425_00221 | CDS | open | 32447-33445 | _na 332_aa | imp | TAXI family TRAP transporter solute-binding subunit |
| 411 | CALEVY010000004.1 | GCA937925425_00222 | CDS | open | 33772-34410 | _na 212_aa | gph | Haloacid dehalogenase |
| 412 | CALEVY010000004.1 | GCA937925425_00223 | CDS | open | 34407-36197 | _na 596_aa | yyaL | thioredoxin domain-containing protein |
| 413 | CALEVY010000004.1 | GCA937925425_00224 | CDS | open | 36589-39273 | _na 894_aa | nrdA | adenosylcobalamin-dependent ribonucleoside-diphosphate reductase |
| 414 | CALEVY010000004.1 | GCA937925425_00225 | CDS | open | 39438-41384 | _na 648_aa | dAP2 | Peptidase S9 prolyl oligopeptidase catalytic domain-containing protein |
| 415 | CALEVY010000004.1 | GCA937925425_00226 | CDS | open | 41488-41754 | _na 88_aa | hypothetical protein | |
| 416 | CALEVY010000004.1 | GCA937925425_00227 | CDS | open | 41945-43312 | _na 455_aa | glmU | bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU |
| 417 | CALEVY010000004.1 | GCA937925425_00228 | CDS | open | 43316-44287 | _na 323_aa | prsA | Ribose-phosphate pyrophosphokinase |
| 418 | CALEVY010000004.1 | GCA937925425_00229 | CDS | open | 44337-44642 | _na 101_aa | rplY | 50S ribosomal protein L25 |
| 419 | CALEVY010000004.1 | GCA937925425_00230 | CDS | open | 44647-45240 | _na 197_aa | pth | aminoacyl-tRNA hydrolase |
| 420 | CALEVY010000004.1 | GCA937925425_00231 | CDS | open | 45419-48361 | _na 980_aa | mfd | Transcription-repair-coupling factor |
| 421 | CALEVY010000004.1 | GCA937925425_00232 | CDS | open | 48389-49201 | _na 270_aa | mazG | nucleoside triphosphate pyrophosphohydrolase |
| 422 | CALEVY010000004.1 | GCA937925425_00233 | CDS | open | 49274-50785 | _na 503_aa | oadA1 | Oxaloacetate decarboxylase subunit alpha |
| 423 | CALEVY010000004.1 | GCA937925425_00234 | CDS | open | 50936-51892 | _na 318_aa | phoH | PhoH-like protein |
| 424 | CALEVY010000004.1 | GCA937925425_00235 | CDS | open | 51910-54018 | _na 702_aa | pgpH | HD/PDEase domain-containing protein |
| 425 | CALEVY010000004.1 | GCA937925425_00236 | CDS | open | 53960-54547 | _na 195_aa | ybeY | rRNA maturation RNase YbeY |
| 426 | CALEVY010000004.1 | GCA937925425_00237 | CDS | open | 54544-55836 | _na 430_aa | mpfA | HlyC/CorC family transporter |
| 427 | CALEVY010000004.1 | GCA937925425_00238 | CDS | open | 55840-57105 | _na 421_aa | HlyC/CorC family transporter | |
| 428 | CALEVY010000004.1 | GCA937925425_00239 | CDS | open | 57112-58023 | _na 303_aa | era | GTPase Era |
| 429 | CALEVY010000004.1 | GCA937925425_00240 | CDS | open | 57978-58721 | _na 247_aa | recO | DNA repair protein RecO |
| 430 | CALEVY010000004.1 | GCA937925425_00241 | CDS | open | 58746-59618 | _na 290_aa | glyQ | glycine--tRNA ligase subunit alpha |
| 431 | CALEVY010000004.1 | GCA937925425_00242 | CDS | open | 59633-61690 | _na 685_aa | glyS | Glycine--tRNA ligase beta subunit |
| 432 | CALEVY010000004.1 | GCA937925425_00243 | CDS | open | 61706-62512 | _na 268_aa | ppsR | Kinase/pyrophosphorylase |
| 433 | CALEVY010000004.1 | GCA937925425_00244 | CDS | open | 62626-63774 | _na 382_aa | Aldo/keto reductase | |
| 434 | CALEVY010000004.1 | GCA937925425_00245 | CDS | open | 63972-64769 | _na 265_aa | aspartate dehydrogenase domain-containing protein | |
| 435 | CALEVY010000004.1 | GCA937925425_00246 | CDS | open | 64852-65490 | _na 212_aa | Transcriptional regulator | |
| 436 | CALEVY010000004.1 | GCA937925425_00247 | CDS | open | 65580-66896 | _na 438_aa | Peptidase M20 domain-containing protein 2 | |
| 437 | CALEVY010000004.1 | GCA937925425_00248 | CDS | open | 66901-67365 | _na 154_aa | DUF340 domain-containing protein | |
| 438 | CALEVY010000004.1 | GCA937925425_00249 | CDS | open | 67384-68223 | _na 279_aa | DUF3100 domain-containing protein | |
| 439 | CALEVY010000004.1 | GCA937925425_00250 | CDS | open | 68260-68979 | _na 239_aa | Carbon-nitrogen hydrolase family protein | |
| 440 | CALEVY010000004.1 | GCA937925425_00251 | CDS | open | 69095-70204 | _na 369_aa | D-TA family PLP-dependent enzyme | |
| 441 | CALEVY010000004.1 | GCA937925425_00252 | CDS | open | 70237-70614 | _na 125_aa | ridA | RidA family protein |
| 442 | CALEVY010000004.1 | GCA937925425_00188 | gene | open | 36-428 | |||
| 443 | CALEVY010000004.1 | GCA937925425_00189 | gene | open | 532-1047 | ompH | ||
| 444 | CALEVY010000004.1 | GCA937925425_00190 | gene | open | 1150-1404 | |||
| 445 | CALEVY010000004.1 | GCA937925425_00191 | gene | open | 1407-2807 | degQ | ||
| 446 | CALEVY010000004.1 | GCA937925425_00193 | gene | open | 3710-4537 | yciV | ||
| 447 | CALEVY010000004.1 | GCA937925425_00194 | gene | open | 4549-5898 | tldD | ||
| 448 | CALEVY010000004.1 | GCA937925425_00195 | gene | open | 5840-7522 | amiC | ||
| 449 | CALEVY010000004.1 | GCA937925425_00196 | gene | open | 7571-8230 | |||
| 450 | CALEVY010000004.1 | GCA937925425_00197 | gene | open | 8320-9075 | rph | ||
| 451 | CALEVY010000004.1 | GCA937925425_00198 | gene | open | 9072-9683 | rdgB | ||
| 452 | CALEVY010000004.1 | GCA937925425_00199 | gene | open | 9827-10048 | secG | ||
| 453 | CALEVY010000004.1 | GCA937925425_00200 | gene | open | 10071-11108 | pncB | ||
| 454 | CALEVY010000004.1 | GCA937925425_00201 | gene | open | 11297-11731 | rplM | ||
| 455 | CALEVY010000004.1 | GCA937925425_00202 | gene | open | 11748-12140 | rpsI | ||
| 456 | CALEVY010000004.1 | GCA937925425_00204 | gene | open | 12402-12650 | |||
| 457 | CALEVY010000004.1 | GCA937925425_00205 | gene | open | 12702-13799 | |||
| 458 | CALEVY010000004.1 | GCA937925425_00206 | gene | open | 14038-14400 | hypA | ||
| 459 | CALEVY010000004.1 | GCA937925425_00207 | gene | open | 14417-15052 | hypB | ||
| 460 | CALEVY010000004.1 | GCA937925425_00208 | gene | open | 15084-17060 | uvrD | ||
| 461 | CALEVY010000004.1 | GCA937925425_00209 | gene | open | 17014-17625 | coaE | ||
| 462 | CALEVY010000004.1 | GCA937925425_00210 | gene | open | 17643-18278 | spoIVFB | ||
| 463 | CALEVY010000004.1 | GCA937925425_00211 | gene | open | 18317-19378 | abrB | ||
| 464 | CALEVY010000004.1 | GCA937925425_00212 | gene | open | 19502-19927 | slpA | ||
| 465 | CALEVY010000004.1 | GCA937925425_00213 | gene | open | 19931-21865 | abc-f | ||
| 466 | CALEVY010000004.1 | GCA937925425_00214 | gene | open | 21862-22857 | |||
| 467 | CALEVY010000004.1 | GCA937925425_00215 | gene | open | 22905-25265 | yhiN | ||
| 468 | CALEVY010000004.1 | GCA937925425_00216 | gene | open | 25429-25998 | pncA | ||
| 469 | CALEVY010000004.1 | GCA937925425_00217 | gene | open | 26086-27609 | |||
| 470 | CALEVY010000004.1 | GCA937925425_00218 | gene | open | 27645-27977 | ybjQ | ||
| 471 | CALEVY010000004.1 | GCA937925425_00219 | gene | open | 28038-30197 | tex | ||
| 472 | CALEVY010000004.1 | GCA937925425_00220 | gene | open | 30337-32271 | |||
| 473 | CALEVY010000004.1 | GCA937925425_00221 | gene | open | 32447-33445 | imp | ||
| 474 | CALEVY010000004.1 | GCA937925425_00222 | gene | open | 33772-34410 | gph | ||
| 475 | CALEVY010000004.1 | GCA937925425_00223 | gene | open | 34407-36197 | yyaL | ||
| 476 | CALEVY010000004.1 | GCA937925425_00224 | gene | open | 36589-39273 | nrdA | ||
| 477 | CALEVY010000004.1 | GCA937925425_00225 | gene | open | 39438-41384 | dAP2 | ||
| 478 | CALEVY010000004.1 | GCA937925425_00226 | gene | open | 41488-41754 | |||
| 479 | CALEVY010000004.1 | GCA937925425_00227 | gene | open | 41945-43312 | glmU | ||
| 480 | CALEVY010000004.1 | GCA937925425_00228 | gene | open | 43316-44287 | prsA | ||
| 481 | CALEVY010000004.1 | GCA937925425_00229 | gene | open | 44337-44642 | rplY | ||
| 482 | CALEVY010000004.1 | GCA937925425_00230 | gene | open | 44647-45240 | pth | ||
| 483 | CALEVY010000004.1 | GCA937925425_00231 | gene | open | 45419-48361 | mfd | ||
| 484 | CALEVY010000004.1 | GCA937925425_00232 | gene | open | 48389-49201 | mazG | ||
| 485 | CALEVY010000004.1 | GCA937925425_00233 | gene | open | 49274-50785 | oadA1 | ||
| 486 | CALEVY010000004.1 | GCA937925425_00234 | gene | open | 50936-51892 | phoH | ||
| 487 | CALEVY010000004.1 | GCA937925425_00235 | gene | open | 51910-54018 | pgpH | ||
| 488 | CALEVY010000004.1 | GCA937925425_00236 | gene | open | 53960-54547 | ybeY | ||
| 489 | CALEVY010000004.1 | GCA937925425_00237 | gene | open | 54544-55836 | mpfA | ||
| 490 | CALEVY010000004.1 | GCA937925425_00238 | gene | open | 55840-57105 | |||
| 491 | CALEVY010000004.1 | GCA937925425_00239 | gene | open | 57112-58023 | era | ||
| 492 | CALEVY010000004.1 | GCA937925425_00240 | gene | open | 57978-58721 | recO | ||
| 493 | CALEVY010000004.1 | GCA937925425_00241 | gene | open | 58746-59618 | glyQ | ||
| 494 | CALEVY010000004.1 | GCA937925425_00242 | gene | open | 59633-61690 | glyS | ||
| 495 | CALEVY010000004.1 | GCA937925425_00243 | gene | open | 61706-62512 | ppsR | ||
| 496 | CALEVY010000004.1 | GCA937925425_00244 | gene | open | 62626-63774 | |||
| 497 | CALEVY010000004.1 | GCA937925425_00245 | gene | open | 63972-64769 | |||
| 498 | CALEVY010000004.1 | GCA937925425_00246 | gene | open | 64852-65490 | |||
| 499 | CALEVY010000004.1 | GCA937925425_00247 | gene | open | 65580-66896 | |||
| 500 | CALEVY010000004.1 | GCA937925425_00248 | gene | open | 66901-67365 |

