HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria mucosa (GCA_000173875.1)

Select a Genome:
BAKTA Annotations for GCA_000173875.1
Genome Selected: Neisseria mucosa
ContigsBases CDSrRNA tmRNAtRNA
67 2,578,748 2378 5 1 55
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4915 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4915 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 ACDX02000004.1 GCA000173875_01798 gene open 126757-127131
1502 ACDX02000004.1 GCA000173875_01799 gene open 127519-129780 nuoG
1503 ACDX02000004.1 GCA000173875_01800 gene open 129783-130859 nuoH
1504 ACDX02000004.1 GCA000173875_01801 gene open 130939-131418 nuoI
1505 ACDX02000004.1 GCA000173875_01802 gene open 131430-132101 nuoJ
1506 ACDX02000004.1 GCA000173875_01803 gene open 132098-132403 nuoK
1507 ACDX02000004.1 GCA000173875_01804 gene open 132409-132945
1508 ACDX02000004.1 GCA000173875_01805 gene open 133123-135147 nuoL
1509 ACDX02000004.1 GCA000173875_01806 gene open 135366-135671 pheA
1510 ACDX02000004.1 GCA000173875_01807 gene open 135896-136216 manC
1511 ACDX02000004.1 GCA000173875_01808 gene open 136457-137953 nuoM
1512 ACDX02000004.1 GCA000173875_01809 gene open 137963-139438 nuoN
1513 ACDX02000004.1 GCA000173875_01810 gene open 139766-140065
1514 ACDX02000004.1 GCA000173875_01811 gene open 140120-141244 proB
1515 ACDX02000004.1 GCA000173875_01812 gene open 141677-141808
1516 ACDX02000004.1 GCA000173875_01813 gene open 142355-143638
1517 ACDX02000004.1 GCA000173875_01814 gene open 143762-144907 yccC
1518 ACDX02000004.1 GCA000173875_01815 gene open 144962-145411
1519 ACDX02000004.1 GCA000173875_01816 gene open 145491-146459 terC
1520 ACDX02000004.1 GCA000173875_01817 gene open 146751-147272 frr
1521 ACDX02000004.1 GCA000173875_01818 gene open 147330-148076 uppS
1522 ACDX02000004.1 GCA000173875_01819 gene open 148079-148873 cdsA
1523 ACDX02000004.1 GCA000173875_01820 gene open 148995-150179 ispC
1524 ACDX02000004.1 GCA000173875_01821 gene open 150391-151731 rseP
1525 ACDX02000004.1 GCA000173875_01822 gene open 151736-154135 bamA
1526 ACDX02000004.1 GCA000173875_01823 gene open 154289-154801 hlpA
1527 ACDX02000004.1 GCA000173875_01824 gene open 154998-156041 lpxD
1528 ACDX02000004.1 GCA000173875_01825 gene open 156167-156616 fabZ
1529 ACDX02000004.1 GCA000173875_01826 gene open 156702-157478 lpxA
1530 ACDX02000004.1 GCA000173875_01827 gene open 157801-158811 pdxA
1531 ACDX02000004.1 GCA000173875_01828 gene open 159010-159780 parA
1532 ACDX02000004.1 GCA000173875_01829 gene open 159869-160282
1533 ACDX02000005.1 GCA000173875_01544 CDS open 267-1592 _na     441_aa YD repeat protein (3 repeats)
1534 ACDX02000005.1 GCA000173875_01545 CDS open 1770-2306 _na     178_aa hypothetical protein
1535 ACDX02000005.1 GCA000173875_01546 CDS open 2319-2642 _na     107_aa hypothetical protein
1536 ACDX02000005.1 GCA000173875_01547 CDS open 2828-4171 _na     447_aa YD repeat protein (3 repeats)
1537 ACDX02000005.1 GCA000173875_01548 CDS open 4168-5175 _na     335_aa iS5 IS5 family transposase
1538 ACDX02000005.1 GCA000173875_01549 CDS open 5342-7822 _na     826_aa glgP Alpha-1%2C4 glucan phosphorylase
1539 ACDX02000005.1 GCA000173875_01550 CDS open 8141-10141 _na     666_aa glgX glycogen debranching protein GlgX
1540 ACDX02000005.1 GCA000173875_01551 CDS open 10116-10358 _na     80_aa Transposase
1541 ACDX02000005.1 GCA000173875_01552 CDS open 10426-11481 _na     351_aa emrA HlyD family efflux transporter periplasmic adaptor subunit
1542 ACDX02000005.1 GCA000173875_01553 CDS open 11502-12140 _na     212_aa HTH tetR-type domain-containing protein
1543 ACDX02000005.1 GCA000173875_01554 CDS open 12585-13619 _na     344_aa trpD Anthranilate phosphoribosyltransferase
1544 ACDX02000005.1 GCA000173875_01555 CDS open 13686-14276 _na     196_aa pabA Aminodeoxychorismate/anthranilate synthase component II
1545 ACDX02000005.1 GCA000173875_01556 CDS open 14291-14626 _na     111_aa hypothetical protein
1546 ACDX02000005.1 GCA000173875_01557 CDS open 14769-15647 _na     292_aa jmjC JmjC domain-containing protein 5
1547 ACDX02000005.1 GCA000173875_01558 CDS open 15714-16175 _na     153_aa DUF4124 domain-containing protein
1548 ACDX02000005.1 GCA000173875_01559 CDS open 16198-16392 _na     64_aa Amino acid permease
1549 ACDX02000005.1 GCA000173875_01560 CDS open 16492-18120 _na     542_aa uup ABC-F family ATPase
1550 ACDX02000005.1 GCA000173875_01561 CDS open 18543-19124 _na     193_aa sodA Superoxide dismutase
1551 ACDX02000005.1 GCA000173875_01562 CDS open 19293-20699 _na     468_aa dnaB replicative DNA helicase
1552 ACDX02000005.1 GCA000173875_01563 CDS open 20856-21548 _na     230_aa fimT Type II secretion system protein H
1553 ACDX02000005.1 GCA000173875_01564 CDS open 21561-22265 _na     234_aa pilV type IV pilus modification protein PilV
1554 ACDX02000005.1 GCA000173875_01565 CDS open 22265-23290 _na     341_aa Prepilin-type cleavage/methylation N-terminal domain protein
1555 ACDX02000005.1 GCA000173875_01566 CDS open 23269-23868 _na     199_aa PilX/PilW C-terminal domain-containing protein
1556 ACDX02000005.1 GCA000173875_01567 CDS open 23886-24377 _na     163_aa Prepilin-type cleavage/methylation N-terminal domain protein
1557 ACDX02000005.1 GCA000173875_01568 CDS open 24550-25386 _na     278_aa panC pantoate--beta-alanine ligase
1558 ACDX02000005.1 GCA000173875_01569 CDS open 25712-26500 _na     262_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
1559 ACDX02000005.1 GCA000173875_01572 CDS open 27071-27862 _na     263_aa speE polyamine aminopropyltransferase
1560 ACDX02000005.1 GCA000173875_01573 CDS open 28012-29265 _na     417_aa hemA glutamyl-tRNA reductase
1561 ACDX02000005.1 GCA000173875_01574 CDS open 29802-30104 _na     100_aa arsR Transcriptional regulator%2C ArsR family
1562 ACDX02000005.1 GCA000173875_01575 CDS open 30184-30705 _na     173_aa pspE Rhodanese domain-containing protein
1563 ACDX02000005.1 GCA000173875_01576 CDS open 30718-30912 _na     64_aa Inner membrane protein YgaP-like transmembrane domain-containing protein
1564 ACDX02000005.1 GCA000173875_01577 CDS open 32022-32714 _na     230_aa FAD-binding domain-containing protein
1565 ACDX02000005.1 GCA000173875_01578 CDS open 33152-34306 _na     384_aa emrA HlyD family secretion protein
1566 ACDX02000005.1 GCA000173875_01579 CDS open 34572-36233 _na     553_aa MFS transporter
1567 ACDX02000005.1 GCA000173875_01580 CDS open 36299-37723 _na     474_aa DGQHR domain protein
1568 ACDX02000005.1 GCA000173875_01581 CDS open 37720-39138 _na     472_aa Type I restriction modification DNA specificity domain protein
1569 ACDX02000005.1 GCA000173875_01582 CDS open 39125-41287 _na     720_aa hsdM N-6 DNA methylase
1570 ACDX02000005.1 GCA000173875_01583 CDS open 41397-42827 _na     476_aa tolC Outer membrane multidrug resistance lipoprotein
1571 ACDX02000005.1 GCA000173875_01584 CDS open 43060-44067 _na     335_aa tnp IS5 family transposase
1572 ACDX02000005.1 GCA000173875_01585 CDS open 44233-44748 _na     171_aa ssb Single-stranded DNA-binding protein
1573 ACDX02000005.1 GCA000173875_01586 CDS open 44752-46134 _na     460_aa araJ Major facilitator superfamily (MFS) profile domain-containing protein
1574 ACDX02000005.1 GCA000173875_01587 CDS open 46265-46894 _na     209_aa mltE Transglycosylase
1575 ACDX02000005.1 GCA000173875_01588 CDS open 47301-48809 _na     502_aa ppx exopolyphosphatase
1576 ACDX02000005.1 GCA000173875_01589 CDS open 48952-49842 _na     296_aa argB Acetylglutamate kinase
1577 ACDX02000005.1 GCA000173875_01590 CDS open 50151-51281 _na     376_aa mpaA Peptidase M14 carboxypeptidase A domain-containing protein
1578 ACDX02000005.1 GCA000173875_01591 CDS open 51394-52248 _na     284_aa lgt prolipoprotein diacylglyceryl transferase
1579 ACDX02000005.1 GCA000173875_01592 CDS open 52451-52597 _na     48_aa CCGSCS motif protein
1580 ACDX02000005.1 GCA000173875_01593 CDS open 52725-53321 _na     198_aa lemA LemA family protein
1581 ACDX02000005.1 GCA000173875_01594 CDS open 53527-54612 _na     361_aa yaeI Ser/Thr protein phosphatase
1582 ACDX02000005.1 GCA000173875_01595 CDS open 54746-55654 _na     302_aa efeB Dyp-type peroxidase family protein
1583 ACDX02000005.1 GCA000173875_01596 CDS open 55753-58326 _na     857_aa clpB ATP-dependent chaperone ClpB
1584 ACDX02000005.1 GCA000173875_01597 CDS open 58587-59597 _na     336_aa trpS tryptophan--tRNA ligase
1585 ACDX02000005.1 GCA000173875_01598 CDS open 59675-60214 _na     179_aa Lipoprotein
1586 ACDX02000005.1 GCA000173875_01599 CDS open 60232-61236 _na     334_aa add adenosine deaminase
1587 ACDX02000005.1 GCA000173875_01600 CDS open 61561-63060 _na     499_aa cls Phospholipase D domain protein
1588 ACDX02000005.1 GCA000173875_01601 CDS open 63133-64263 _na     376_aa potD Putrescine-binding periplasmic protein
1589 ACDX02000005.1 GCA000173875_01602 CDS open 64492-67113 _na     873_aa alaS alanine--tRNA ligase
1590 ACDX02000005.1 GCA000173875_01603 CDS open 67186-67860 _na     224_aa hypothetical protein
1591 ACDX02000005.1 GCA000173875_01604 CDS open 68056-68292 _na     78_aa DUF6429 domain-containing protein
1592 ACDX02000005.1 GCA000173875_01605 CDS open 68497-68733 _na     78_aa DUF6429 domain-containing protein
1593 ACDX02000005.1 GCA000173875_01606 CDS open 69502-70107 _na     201_aa putative S-adenosylmethionine-dependent methyltransferase MSMEG_2350
1594 ACDX02000005.1 GCA000173875_01607 CDS open 70389-71396 _na     335_aa rlhA Ubiquinone biosynthesis protein UbiU
1595 ACDX02000005.1 GCA000173875_01608 CDS open 71410-72327 _na     305_aa rlhA U32 family peptidase
1596 ACDX02000005.1 GCA000173875_01609 CDS open 72314-72754 _na     146_aa ubiT Ubiquinone biosynthesis accessory factor UbiT
1597 ACDX02000005.1 GCA000173875_01610 CDS open 72888-74633 _na     581_aa proS proline--tRNA ligase
1598 ACDX02000005.1 GCA000173875_01611 CDS open 75050-75898 _na     282_aa fghA S-formylglutathione hydrolase
1599 ACDX02000005.1 GCA000173875_01612 CDS open 75982-76821 _na     279_aa Nickel uptake substrate-specific transmembrane region
1600 ACDX02000005.1 GCA000173875_01613 CDS open 77052-77873 _na     273_aa ppsR Putative phosphoenolpyruvate synthase regulatory protein
1601 ACDX02000005.1 GCA000173875_01614 CDS open 78292-80676 _na     794_aa ppsA phosphoenolpyruvate synthase
1602 ACDX02000005.1 GCA000173875_01615 CDS open 80914-81600 _na     228_aa nlpD Peptidoglycan DD-metalloendopeptidase family protein
1603 ACDX02000005.1 GCA000173875_01616 CDS open 81932-83242 _na     436_aa tig trigger factor
1604 ACDX02000005.1 GCA000173875_01617 CDS open 83330-83950 _na     206_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
1605 ACDX02000005.1 GCA000173875_01618 CDS open 84310-86535 _na     741_aa comEC DNA internalization-related competence protein ComEC/Rec2
1606 ACDX02000005.1 GCA000173875_01619 CDS open 86685-88037 _na     450_aa gshA glutamate--cysteine ligase
1607 ACDX02000005.1 GCA000173875_01620 CDS open 88305-89714 _na     469_aa leuC 3-isopropylmalate dehydratase large subunit
1608 ACDX02000005.1 GCA000173875_01621 CDS open 89808-90032 _na     74_aa Lipoprotein
1609 ACDX02000005.1 GCA000173875_01622 CDS open 90249-90386 _na     45_aa ecnA Entericidin A/B family lipoprotein
1610 ACDX02000005.1 GCA000173875_01623 CDS open 90635-91276 _na     213_aa leuD 3-isopropylmalate dehydratase small subunit
1611 ACDX02000005.1 GCA000173875_01624 CDS open 91369-91830 _na     153_aa nanQ YhcH/YjgK/YiaL family protein
1612 ACDX02000005.1 GCA000173875_01625 CDS open 92232-93302 _na     356_aa leuB 3-isopropylmalate dehydrogenase
1613 ACDX02000005.1 GCA000173875_01626 CDS open 93731-94129 _na     132_aa yjfL DUF350 domain-containing protein
1614 ACDX02000005.1 GCA000173875_01627 CDS open 94216-95238 _na     340_aa ydjI SPFH/Band 7/PHB domain protein
1615 ACDX02000005.1 GCA000173875_01628 CDS open 95509-97029 _na     506_aa DUF4178 domain-containing protein
1616 ACDX02000005.1 GCA000173875_01629 CDS open 97032-97178 _na     48_aa hypothetical protein
1617 ACDX02000005.1 GCA000173875_01630 CDS open 97175-97567 _na     130_aa speD adenosylmethionine decarboxylase
1618 ACDX02000005.1 GCA000173875_01631 CDS open 97635-99245 _na     536_aa Tat pathway signal sequence domain protein
1619 ACDX02000005.1 GCA000173875_01632 CDS open 99370-99810 _na     146_aa holC DNA polymerase III%2C chi subunit
1620 ACDX02000005.1 GCA000173875_01633 CDS open 99941-100762 _na     273_aa fkpA Peptidyl-prolyl cis-trans isomerase
1621 ACDX02000005.1 GCA000173875_01634 CDS open 100981-101607 _na     208_aa purN phosphoribosylglycinamide formyltransferase
1622 ACDX02000005.1 GCA000173875_01635 CDS open 101752-102450 _na     232_aa DUF3108 domain-containing protein
1623 ACDX02000005.1 GCA000173875_01636 CDS open 102513-103340 _na     275_aa ydfG Oxidoreductase%2C short chain dehydrogenase/reductase family protein
1624 ACDX02000005.1 GCA000173875_01637 CDS open 103467-103925 _na     152_aa cytC556 Cytochrome C
1625 ACDX02000005.1 GCA000173875_01638 CDS open 104133-104351 _na     72_aa pptA Tautomerase
1626 ACDX02000005.1 GCA000173875_01639 CDS open 104528-105493 _na     321_aa dusA tRNA-dihydrouridine(16) synthase
1627 ACDX02000005.1 GCA000173875_01640 CDS open 105582-106541 _na     319_aa uRH1 Inosine/uridine-preferring nucleoside hydrolase domain-containing protein
1628 ACDX02000005.1 GCA000173875_01641 CDS open 106590-108143 _na     517_aa wcaA Beta-1%2C4-glucosyltransferase
1629 ACDX02000005.1 GCA000173875_01642 CDS open 108308-109069 _na     253_aa elsH Endonuclease/exonuclease/phosphatase domain-containing protein
1630 ACDX02000005.1 GCA000173875_01643 CDS open 109321-110169 _na     282_aa rnfB Electron transport complex%2C RnfABCDGE type%2C B subunit
1631 ACDX02000005.1 GCA000173875_01644 CDS open 110514-111857 _na     447_aa adhE Aldehyde dehydrogenase family protein
1632 ACDX02000005.1 GCA000173875_01645 CDS open 112348-113004 _na     218_aa hypothetical protein
1633 ACDX02000005.1 GCA000173875_01646 CDS open 112839-115601 _na     920_aa Type I secretion target GGXGXDXXX repeat (2 copies)
1634 ACDX02000005.1 GCA000173875_01647 CDS open 115794-116294 _na     166_aa Transposase Helix-turn-helix domain-containing protein
1635 ACDX02000005.1 GCA000173875_01648 CDS open 116267-116587 _na     106_aa tnp IS5 family transposase
1636 ACDX02000005.1 GCA000173875_01649 CDS open 116584-117162 _na     192_aa Integrase
1637 ACDX02000005.1 GCA000173875_01650 CDS open 117235-117477 _na     80_aa hypothetical protein
1638 ACDX02000005.1 GCA000173875_01651 CDS open 118364-119593 _na     409_aa ATPase
1639 ACDX02000005.1 GCA000173875_01652 CDS open 119617-121029 _na     470_aa Phage associated protein
1640 ACDX02000005.1 GCA000173875_01653 CDS open 121414-121983 _na     189_aa Lipoprotein
1641 ACDX02000005.1 GCA000173875_01654 CDS open 122049-122531 _na     160_aa hypothetical protein
1642 ACDX02000005.1 GCA000173875_01655 CDS open 122624-123463 _na     279_aa Nudix hydrolase domain-containing protein
1643 ACDX02000005.1 GCA000173875_01656 CDS open 123577-124236 _na     219_aa Ser/Thr phosphatase family protein
1644 ACDX02000005.1 GCA000173875_01657 CDS open 124276-126039 _na     587_aa Transporter%2C CPA2 family
1645 ACDX02000005.1 GCA000173875_01658 CDS open 126159-126998 _na     279_aa Metallo-beta-lactamase domain protein
1646 ACDX02000005.1 GCA000173875_01659 CDS open 127002-127175 _na     57_aa hypothetical protein
1647 ACDX02000005.1 GCA000173875_01660 CDS open 127249-128214 _na     321_aa ssuD Dehydrogenase
1648 ACDX02000005.1 GCA000173875_01661 CDS open 128394-129293 _na     299_aa lysR LysR family transcriptional regulator
1649 ACDX02000005.1 GCA000173875_01662 CDS open 129410-129760 _na     116_aa Insertion element IS150 protein InsJ-like helix-turn-helix domain-containing protein
1650 ACDX02000005.1 GCA000173875_01663 CDS open 129964-130560 _na     198_aa insO IS3 family transposase
1651 ACDX02000005.1 GCA000173875_01664 CDS open 130783-131790 _na     335_aa iS5 IS5 family transposase
1652 ACDX02000005.1 GCA000173875_01665 CDS open 132263-133699 _na     478_aa dltB putative alginate O-acetylase AlgI
1653 ACDX02000005.1 GCA000173875_01666 CDS open 133715-134791 _na     358_aa patB peptidoglycan O-acetyltransferase PatB
1654 ACDX02000005.1 GCA000173875_01667 CDS open 134905-136014 _na     369_aa tesA SGNH hydrolase-type esterase domain-containing protein
1655 ACDX02000005.1 GCA000173875_01668 CDS open 136362-137186 _na     274_aa hisJ Amino acid ABC transporter substrate-binding protein
1656 ACDX02000005.1 GCA000173875_01669 CDS open 137209-137892 _na     227_aa hisM Amino acid ABC transporter%2C permease protein
1657 ACDX02000005.1 GCA000173875_01670 CDS open 137902-138669 _na     255_aa glnQ ABC transporter ATP-binding protein%2C amino acid
1658 ACDX02000005.1 GCA000173875_01671 CDS open 139018-140940 _na     640_aa abc-f ribosomal protection-like ABC-F family protein
1659 ACDX02000005.1 GCA000173875_01672 CDS open 141074-141442 _na     122_aa Nucleolar protein
1660 ACDX02000005.1 GCA000173875_01673 CDS open 141598-142149 _na     183_aa Periplasmic protein
1661 ACDX02000005.1 GCA000173875_01674 CDS open 142464-143237 _na     257_aa folE2 GTP cyclohydrolase FolE2
1662 ACDX02000005.1 GCA000173875_01675 CDS open 143419-144576 _na     385_aa metC Putative 8-amino-7-oxononanoate synthase
1663 ACDX02000005.1 GCA000173875_01676 CDS open 144774-145232 _na     152_aa hslJ DUF306 domain-containing protein
1664 ACDX02000005.1 GCA000173875_01677 CDS open 145360-146139 _na     259_aa fpr ferredoxin--NADP(+) reductase
1665 ACDX02000005.1 GCA000173875_01678 CDS open 146166-147344 _na     392_aa hflX GTPase HflX
1666 ACDX02000005.1 GCA000173875_01679 CDS open 147403-148071 _na     222_aa hypothetical protein
1667 ACDX02000005.1 GCA000173875_01680 CDS open 148171-148296 _na     41_aa hypothetical protein
1668 ACDX02000005.1 GCA000173875_01681 CDS open 148715-151186 _na     823_aa zntA Copper-exporting ATPase
1669 ACDX02000005.1 GCA000173875_01682 CDS open 151524-153590 _na     688_aa betT BCCT family osmoprotectant transporter
1670 ACDX02000005.1 GCA000173875_01683 CDS open 154035-154826 _na     263_aa nadE NH(3)-dependent NAD(+) synthetase
1671 ACDX02000005.1 GCA000173875_01684 CDS open 154983-157007 _na     674_aa Site-specific recombinase
1672 ACDX02000005.1 GCA000173875_01544 gene open 267-1592
1673 ACDX02000005.1 GCA000173875_01545 gene open 1770-2306
1674 ACDX02000005.1 GCA000173875_01546 gene open 2319-2642
1675 ACDX02000005.1 GCA000173875_01547 gene open 2828-4171
1676 ACDX02000005.1 GCA000173875_01548 gene open 4168-5175 iS5
1677 ACDX02000005.1 GCA000173875_01549 gene open 5342-7822 glgP
1678 ACDX02000005.1 GCA000173875_01550 gene open 8141-10141 glgX
1679 ACDX02000005.1 GCA000173875_01551 gene open 10116-10358
1680 ACDX02000005.1 GCA000173875_01552 gene open 10426-11481 emrA
1681 ACDX02000005.1 GCA000173875_01553 gene open 11502-12140
1682 ACDX02000005.1 GCA000173875_01554 gene open 12585-13619 trpD
1683 ACDX02000005.1 GCA000173875_01555 gene open 13686-14276 pabA
1684 ACDX02000005.1 GCA000173875_01556 gene open 14291-14626
1685 ACDX02000005.1 GCA000173875_01557 gene open 14769-15647 jmjC
1686 ACDX02000005.1 GCA000173875_01558 gene open 15714-16175
1687 ACDX02000005.1 GCA000173875_01559 gene open 16198-16392
1688 ACDX02000005.1 GCA000173875_01560 gene open 16492-18120 uup
1689 ACDX02000005.1 GCA000173875_01561 gene open 18543-19124 sodA
1690 ACDX02000005.1 GCA000173875_01562 gene open 19293-20699 dnaB
1691 ACDX02000005.1 GCA000173875_01563 gene open 20856-21548 fimT
1692 ACDX02000005.1 GCA000173875_01564 gene open 21561-22265 pilV
1693 ACDX02000005.1 GCA000173875_01565 gene open 22265-23290
1694 ACDX02000005.1 GCA000173875_01566 gene open 23269-23868
1695 ACDX02000005.1 GCA000173875_01567 gene open 23886-24377
1696 ACDX02000005.1 GCA000173875_01568 gene open 24550-25386 panC
1697 ACDX02000005.1 GCA000173875_01569 gene open 25712-26500 panB
1698 ACDX02000005.1 GCA000173875_01572 gene open 27071-27862 speE
1699 ACDX02000005.1 GCA000173875_01573 gene open 28012-29265 hemA
1700 ACDX02000005.1 GCA000173875_01574 gene open 29802-30104 arsR
1701 ACDX02000005.1 GCA000173875_01575 gene open 30184-30705 pspE
1702 ACDX02000005.1 GCA000173875_01576 gene open 30718-30912
1703 ACDX02000005.1 GCA000173875_01577 gene open 32022-32714
1704 ACDX02000005.1 GCA000173875_01578 gene open 33152-34306 emrA
1705 ACDX02000005.1 GCA000173875_01579 gene open 34572-36233
1706 ACDX02000005.1 GCA000173875_01580 gene open 36299-37723
1707 ACDX02000005.1 GCA000173875_01581 gene open 37720-39138
1708 ACDX02000005.1 GCA000173875_01582 gene open 39125-41287 hsdM
1709 ACDX02000005.1 GCA000173875_01583 gene open 41397-42827 tolC
1710 ACDX02000005.1 GCA000173875_01584 gene open 43060-44067 tnp
1711 ACDX02000005.1 GCA000173875_01585 gene open 44233-44748 ssb
1712 ACDX02000005.1 GCA000173875_01586 gene open 44752-46134 araJ
1713 ACDX02000005.1 GCA000173875_01587 gene open 46265-46894 mltE
1714 ACDX02000005.1 GCA000173875_01588 gene open 47301-48809 ppx
1715 ACDX02000005.1 GCA000173875_01589 gene open 48952-49842 argB
1716 ACDX02000005.1 GCA000173875_01590 gene open 50151-51281 mpaA
1717 ACDX02000005.1 GCA000173875_01591 gene open 51394-52248 lgt
1718 ACDX02000005.1 GCA000173875_01592 gene open 52451-52597
1719 ACDX02000005.1 GCA000173875_01593 gene open 52725-53321 lemA
1720 ACDX02000005.1 GCA000173875_01594 gene open 53527-54612 yaeI
1721 ACDX02000005.1 GCA000173875_01595 gene open 54746-55654 efeB
1722 ACDX02000005.1 GCA000173875_01596 gene open 55753-58326 clpB
1723 ACDX02000005.1 GCA000173875_01597 gene open 58587-59597 trpS
1724 ACDX02000005.1 GCA000173875_01598 gene open 59675-60214
1725 ACDX02000005.1 GCA000173875_01599 gene open 60232-61236 add
1726 ACDX02000005.1 GCA000173875_01600 gene open 61561-63060 cls
1727 ACDX02000005.1 GCA000173875_01601 gene open 63133-64263 potD
1728 ACDX02000005.1 GCA000173875_01602 gene open 64492-67113 alaS
1729 ACDX02000005.1 GCA000173875_01603 gene open 67186-67860
1730 ACDX02000005.1 GCA000173875_01604 gene open 68056-68292
1731 ACDX02000005.1 GCA000173875_01605 gene open 68497-68733
1732 ACDX02000005.1 GCA000173875_01606 gene open 69502-70107
1733 ACDX02000005.1 GCA000173875_01607 gene open 70389-71396 rlhA
1734 ACDX02000005.1 GCA000173875_01608 gene open 71410-72327 rlhA
1735 ACDX02000005.1 GCA000173875_01609 gene open 72314-72754 ubiT
1736 ACDX02000005.1 GCA000173875_01610 gene open 72888-74633 proS
1737 ACDX02000005.1 GCA000173875_01611 gene open 75050-75898 fghA
1738 ACDX02000005.1 GCA000173875_01612 gene open 75982-76821
1739 ACDX02000005.1 GCA000173875_01613 gene open 77052-77873 ppsR
1740 ACDX02000005.1 GCA000173875_01614 gene open 78292-80676 ppsA
1741 ACDX02000005.1 GCA000173875_01615 gene open 80914-81600 nlpD
1742 ACDX02000005.1 GCA000173875_01616 gene open 81932-83242 tig
1743 ACDX02000005.1 GCA000173875_01617 gene open 83330-83950 clpP
1744 ACDX02000005.1 GCA000173875_01618 gene open 84310-86535 comEC
1745 ACDX02000005.1 GCA000173875_01619 gene open 86685-88037 gshA
1746 ACDX02000005.1 GCA000173875_01620 gene open 88305-89714 leuC
1747 ACDX02000005.1 GCA000173875_01621 gene open 89808-90032
1748 ACDX02000005.1 GCA000173875_01622 gene open 90249-90386 ecnA
1749 ACDX02000005.1 GCA000173875_01623 gene open 90635-91276 leuD
1750 ACDX02000005.1 GCA000173875_01624 gene open 91369-91830 nanQ
1751 ACDX02000005.1 GCA000173875_01625 gene open 92232-93302 leuB
1752 ACDX02000005.1 GCA000173875_01626 gene open 93731-94129 yjfL
1753 ACDX02000005.1 GCA000173875_01627 gene open 94216-95238 ydjI
1754 ACDX02000005.1 GCA000173875_01628 gene open 95509-97029
1755 ACDX02000005.1 GCA000173875_01629 gene open 97032-97178
1756 ACDX02000005.1 GCA000173875_01630 gene open 97175-97567 speD
1757 ACDX02000005.1 GCA000173875_01631 gene open 97635-99245
1758 ACDX02000005.1 GCA000173875_01632 gene open 99370-99810 holC
1759 ACDX02000005.1 GCA000173875_01633 gene open 99941-100762 fkpA
1760 ACDX02000005.1 GCA000173875_01634 gene open 100981-101607 purN
1761 ACDX02000005.1 GCA000173875_01635 gene open 101752-102450
1762 ACDX02000005.1 GCA000173875_01636 gene open 102513-103340 ydfG
1763 ACDX02000005.1 GCA000173875_01637 gene open 103467-103925 cytC556
1764 ACDX02000005.1 GCA000173875_01638 gene open 104133-104351 pptA
1765 ACDX02000005.1 GCA000173875_01639 gene open 104528-105493 dusA
1766 ACDX02000005.1 GCA000173875_01640 gene open 105582-106541 uRH1
1767 ACDX02000005.1 GCA000173875_01641 gene open 106590-108143 wcaA
1768 ACDX02000005.1 GCA000173875_01642 gene open 108308-109069 elsH
1769 ACDX02000005.1 GCA000173875_01643 gene open 109321-110169 rnfB
1770 ACDX02000005.1 GCA000173875_01644 gene open 110514-111857 adhE
1771 ACDX02000005.1 GCA000173875_01645 gene open 112348-113004
1772 ACDX02000005.1 GCA000173875_01646 gene open 112839-115601
1773 ACDX02000005.1 GCA000173875_01647 gene open 115794-116294
1774 ACDX02000005.1 GCA000173875_01648 gene open 116267-116587 tnp
1775 ACDX02000005.1 GCA000173875_01649 gene open 116584-117162
1776 ACDX02000005.1 GCA000173875_01650 gene open 117235-117477
1777 ACDX02000005.1 GCA000173875_01651 gene open 118364-119593
1778 ACDX02000005.1 GCA000173875_01652 gene open 119617-121029
1779 ACDX02000005.1 GCA000173875_01653 gene open 121414-121983
1780 ACDX02000005.1 GCA000173875_01654 gene open 122049-122531
1781 ACDX02000005.1 GCA000173875_01655 gene open 122624-123463
1782 ACDX02000005.1 GCA000173875_01656 gene open 123577-124236
1783 ACDX02000005.1 GCA000173875_01657 gene open 124276-126039
1784 ACDX02000005.1 GCA000173875_01658 gene open 126159-126998
1785 ACDX02000005.1 GCA000173875_01659 gene open 127002-127175
1786 ACDX02000005.1 GCA000173875_01660 gene open 127249-128214 ssuD
1787 ACDX02000005.1 GCA000173875_01661 gene open 128394-129293 lysR
1788 ACDX02000005.1 GCA000173875_01662 gene open 129410-129760
1789 ACDX02000005.1 GCA000173875_01663 gene open 129964-130560 insO
1790 ACDX02000005.1 GCA000173875_01664 gene open 130783-131790 iS5
1791 ACDX02000005.1 GCA000173875_01665 gene open 132263-133699 dltB
1792 ACDX02000005.1 GCA000173875_01666 gene open 133715-134791 patB
1793 ACDX02000005.1 GCA000173875_01667 gene open 134905-136014 tesA
1794 ACDX02000005.1 GCA000173875_01668 gene open 136362-137186 hisJ
1795 ACDX02000005.1 GCA000173875_01669 gene open 137209-137892 hisM
1796 ACDX02000005.1 GCA000173875_01670 gene open 137902-138669 glnQ
1797 ACDX02000005.1 GCA000173875_01671 gene open 139018-140940 abc-f
1798 ACDX02000005.1 GCA000173875_01672 gene open 141074-141442
1799 ACDX02000005.1 GCA000173875_01673 gene open 141598-142149
1800 ACDX02000005.1 GCA000173875_01674 gene open 142464-143237 folE2
1801 ACDX02000005.1 GCA000173875_01675 gene open 143419-144576 metC
1802 ACDX02000005.1 GCA000173875_01676 gene open 144774-145232 hslJ
1803 ACDX02000005.1 GCA000173875_01677 gene open 145360-146139 fpr
1804 ACDX02000005.1 GCA000173875_01678 gene open 146166-147344 hflX
1805 ACDX02000005.1 GCA000173875_01679 gene open 147403-148071
1806 ACDX02000005.1 GCA000173875_01680 gene open 148171-148296
1807 ACDX02000005.1 GCA000173875_01681 gene open 148715-151186 zntA
1808 ACDX02000005.1 GCA000173875_01682 gene open 151524-153590 betT
1809 ACDX02000005.1 GCA000173875_01683 gene open 154035-154826 nadE
1810 ACDX02000005.1 GCA000173875_01684 gene open 154983-157007
1811 ACDX02000005.1 GCA000173875_01570 gene open 26641-26716 trnT
1812 ACDX02000005.1 GCA000173875_01571 gene open 26753-26828 trnT
1813 ACDX02000005.1 GCA000173875_01570 tRNA open 26641-26716 trnT tRNA-Thr(tgt)
1814 ACDX02000005.1 GCA000173875_01571 tRNA open 26753-26828 trnT tRNA-Thr(tgt)
1815 ACDX02000006.1 repeat_region open 41-6488 CRISPR array with 97 repeats of length 32%2C consensus sequence CCAGCCGCCTTCGGGCGGCTGTGTGTTGAAAC and spacer length 34
1816 ACDX02000006.1 GCA000173875_01408 CDS open 6930-7148 _na     72_aa ydcH DUF465 domain-containing protein
1817 ACDX02000006.1 GCA000173875_01409 CDS open 7232-8647 _na     471_aa cysG siroheme synthase CysG
1818 ACDX02000006.1 GCA000173875_01410 CDS open 8919-9833 _na     304_aa cysD sulfate adenylyltransferase subunit CysD
1819 ACDX02000006.1 GCA000173875_01411 CDS open 10163-10921 _na     252_aa cah Carbonic anhydrase
1820 ACDX02000006.1 GCA000173875_01412 CDS open 11397-12128 _na     243_aa cysH phosphoadenylyl-sulfate reductase
1821 ACDX02000006.1 GCA000173875_01413 CDS open 12254-13312 _na     352_aa dinB DNA polymerase IV
1822 ACDX02000006.1 GCA000173875_01414 CDS open 13407-14252 _na     281_aa rlmJ Ribosomal RNA large subunit methyltransferase J
1823 ACDX02000006.1 GCA000173875_01415 CDS open 14467-16224 _na     585_aa recD exodeoxyribonuclease V subunit alpha
1824 ACDX02000006.1 GCA000173875_01416 CDS open 16472-17590 _na     372_aa Porin
1825 ACDX02000006.1 GCA000173875_01417 CDS open 17741-18142 _na     133_aa hslR Ribosome-associated heat shock protein Hsp15
1826 ACDX02000006.1 GCA000173875_01418 CDS open 18361-19320 _na     319_aa accA acetyl-CoA carboxylase carboxyltransferase subunit alpha
1827 ACDX02000006.1 GCA000173875_01419 CDS open 19505-20755 _na     416_aa ttcA tRNA(Ile)-lysidine synthase
1828 ACDX02000006.1 GCA000173875_01420 CDS open 20839-21438 _na     199_aa rpoE RNA polymerase sigma factor RpoE
1829 ACDX02000006.1 GCA000173875_01421 CDS open 21443-22030 _na     195_aa rseA Anti sigma-E protein RseA domain protein
1830 ACDX02000006.1 GCA000173875_01422 CDS open 22209-23000 _na     263_aa spoU RNA methyltransferase%2C TrmH family
1831 ACDX02000006.1 GCA000173875_01423 CDS open 23126-24298 _na     390_aa lldD L-lactate dehydrogenase
1832 ACDX02000006.1 GCA000173875_01424 CDS open 24656-25102 _na     148_aa iscR Fe-S cluster assembly transcriptional regulator IscR
1833 ACDX02000006.1 GCA000173875_01425 CDS open 25132-26346 _na     404_aa iscS IscS subfamily cysteine desulfurase
1834 ACDX02000006.1 GCA000173875_01426 CDS open 26505-26738 _na     77_aa hypothetical protein
1835 ACDX02000006.1 GCA000173875_01427 CDS open 26900-27028 _na     42_aa FxLD family lantipeptide
1836 ACDX02000006.1 GCA000173875_01428 CDS open 27097-27483 _na     128_aa iscU Iron-sulfur cluster assembly scaffold protein IscU
1837 ACDX02000006.1 GCA000173875_01429 CDS open 27930-28175 _na     81_aa recA Recombinase RecA
1838 ACDX02000006.1 GCA000173875_01430 CDS open 28244-28564 _na     106_aa iscA iron-sulfur cluster assembly protein IscA
1839 ACDX02000006.1 GCA000173875_01431 CDS open 28524-28745 _na     73_aa arfA Alternative ribosome-rescue factor A
1840 ACDX02000006.1 GCA000173875_01432 CDS open 28828-29334 _na     168_aa hscB Fe-S protein assembly co-chaperone HscB
1841 ACDX02000006.1 GCA000173875_01433 CDS open 29692-31971 _na     759_aa nrdA class 1a ribonucleoside-diphosphate reductase subunit alpha
1842 ACDX02000006.1 GCA000173875_01434 CDS open 32010-32933 _na     307_aa Abi-like protein
1843 ACDX02000006.1 GCA000173875_01435 CDS open 33186-34340 _na     384_aa nrdB class Ia ribonucleoside-diphosphate reductase subunit beta
1844 ACDX02000006.1 GCA000173875_01436 CDS open 34460-34762 _na     100_aa yfaE class I ribonucleotide reductase maintenance protein YfaE
1845 ACDX02000006.1 GCA000173875_01437 CDS open 34874-35701 _na     275_aa NMB0938 family lipoprotein
1846 ACDX02000006.1 GCA000173875_01438 CDS open 35878-37173 _na     431_aa dadA FAD-binding oxidoreductase
1847 ACDX02000006.1 GCA000173875_01439 CDS open 37304-38191 _na     295_aa potC Spermidine/putrescine ABC transporter%2C permease protein
1848 ACDX02000006.1 GCA000173875_01440 CDS open 38191-39093 _na     300_aa potB ABC transporter permease%2C polyamine
1849 ACDX02000006.1 GCA000173875_01441 CDS open 39171-40295 _na     374_aa potA Spermidine/putrescine import ATP-binding protein PotA
1850 ACDX02000006.1 GCA000173875_01442 CDS open 40844-41524 _na     226_aa radC DNA repair protein RadC
1851 ACDX02000006.1 GCA000173875_01443 CDS open 41725-42228 _na     167_aa DUF1841 domain-containing protein
1852 ACDX02000006.1 GCA000173875_01444 CDS open 42356-42955 _na     199_aa mlaC Toluene tolerance family protein
1853 ACDX02000006.1 GCA000173875_01445 CDS open 43016-43675 _na     219_aa cytB Nickel-dependent hydrogenases B-type cytochrome subunit
1854 ACDX02000006.1 GCA000173875_01446 CDS open 43809-44708 _na     299_aa nnr2 ADP-dependent (S)-NAD(P)H-hydrate dehydratase
1855 ACDX02000006.1 GCA000173875_01447 CDS open 45041-46567 _na     508_aa fbpB ABC transporter%2C permease protein
1856 ACDX02000006.1 GCA000173875_01448 CDS open 46620-47333 _na     237_aa trmR Class I SAM-dependent methyltransferase
1857 ACDX02000006.1 GCA000173875_01449 CDS open 47468-48844 _na     458_aa mpl UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase
1858 ACDX02000006.1 GCA000173875_01450 CDS open 48999-50633 _na     544_aa class I SAM-dependent DNA methyltransferase
1859 ACDX02000006.1 GCA000173875_01451 CDS open 50767-51930 _na     387_aa site-specific DNA-methyltransferase (adenine-specific)
1860 ACDX02000006.1 GCA000173875_01452 CDS open 52048-52176 _na     42_aa FeoB-associated Cys-rich membrane protein
1861 ACDX02000006.1 GCA000173875_01453 CDS open 52176-54038 _na     620_aa Ferrous iron transport protein B
1862 ACDX02000006.1 GCA000173875_01454 CDS open 54211-54477 _na     88_aa feoA FeoA domain protein
1863 ACDX02000006.1 GCA000173875_01455 CDS open 54796-55422 _na     208_aa nnr1 NAD(P)H-hydrate epimerase
1864 ACDX02000006.1 GCA000173875_01456 CDS open 55628-57004 _na     458_aa Choline/Carnitine O-acyltransferase
1865 ACDX02000006.1 GCA000173875_01457 CDS open 57532-58575 _na     347_aa sbp Sulfate ABC transporter%2C sulfate-binding protein
1866 ACDX02000006.1 GCA000173875_01458 CDS open 58737-59645 _na     302_aa yddG aromatic amino acid DMT transporter YddG
1867 ACDX02000006.1 GCA000173875_01459 CDS open 60119-61180 _na     353_aa bioB biotin synthase BioB
1868 ACDX02000006.1 GCA000173875_01460 CDS open 61707-62681 _na     324_aa fbp class 1 fructose-bisphosphatase
1869 ACDX02000006.1 GCA000173875_01461 CDS open 62759-63127 _na     122_aa Lipoprotein
1870 ACDX02000006.1 GCA000173875_01462 CDS open 63303-64646 _na     447_aa pcnB Poly(A) polymerase I
1871 ACDX02000006.1 GCA000173875_01463 CDS open 64981-65895 _na     304_aa truB tRNA pseudouridine(55) synthase TruB
1872 ACDX02000006.1 GCA000173875_01464 CDS open 66005-66376 _na     123_aa rbfA 30S ribosome-binding factor RbfA
1873 ACDX02000006.1 GCA000173875_01465 CDS open 66495-67535 _na     346_aa mviM Oxidoreductase%2C NAD-binding domain protein
1874 ACDX02000006.1 GCA000173875_01466 CDS open 67978-69024 _na     348_aa recA recombinase RecA
1875 ACDX02000006.1 GCA000173875_01467 CDS open 69288-69638 _na     116_aa Insertion element IS150 protein InsJ-like helix-turn-helix domain-containing protein
1876 ACDX02000006.1 GCA000173875_01468 CDS open 69947-70543 _na     198_aa IS3 family transposase
1877 ACDX02000006.1 GCA000173875_01469 CDS open 70613-71425 _na     270_aa pflA pyruvate formate lyase 1-activating protein
1878 ACDX02000006.1 GCA000173875_01470 CDS open 71717-74002 _na     761_aa pflB formate C-acetyltransferase
1879 ACDX02000006.1 GCA000173875_01471 CDS open 74421-74894 _na     157_aa bfr bacterioferritin
1880 ACDX02000006.1 GCA000173875_01472 CDS open 74919-75383 _na     154_aa bfr bacterioferritin
1881 ACDX02000006.1 GCA000173875_01473 CDS open 75862-77673 _na     603_aa typA translational GTPase TypA
1882 ACDX02000006.1 GCA000173875_01474 CDS open 77855-78097 _na     80_aa hypothetical protein
1883 ACDX02000006.1 GCA000173875_01475 CDS open 78204-78581 _na     125_aa hypothetical protein
1884 ACDX02000006.1 GCA000173875_01476 CDS open 78738-79724 _na     328_aa lipA lipoyl synthase
1885 ACDX02000006.1 GCA000173875_01477 CDS open 79724-80341 _na     205_aa lipB lipoyl(octanoyl) transferase LipB
1886 ACDX02000006.1 GCA000173875_01478 CDS open 80343-80609 _na     88_aa ybeD UPF0250 protein MCC93_17350
1887 ACDX02000006.1 GCA000173875_01479 CDS open 80810-83272 _na     820_aa lon endopeptidase La
1888 ACDX02000006.1 GCA000173875_01480 CDS open 83373-83753 _na     126_aa hypothetical protein
1889 ACDX02000006.1 GCA000173875_01481 CDS open 83815-84198 _na     127_aa vanZ VanZ family protein
1890 ACDX02000006.1 GCA000173875_01482 CDS open 84195-84401 _na     68_aa Dioxygenase
1891 ACDX02000006.1 GCA000173875_01483 CDS open 84429-85007 _na     192_aa pth aminoacyl-tRNA hydrolase
1892 ACDX02000006.1 GCA000173875_01484 CDS open 85074-85259 _na     61_aa hypothetical protein
1893 ACDX02000006.1 GCA000173875_01485 CDS open 85342-85773 _na     143_aa pasT Polyketide cyclase/dehydrase
1894 ACDX02000006.1 GCA000173875_01486 CDS open 86001-87410 _na     469_aa tPR Sel1 repeat protein
1895 ACDX02000006.1 GCA000173875_01487 CDS open 87750-88565 _na     271_aa hpnC squalene synthase HpnC
1896 ACDX02000006.1 GCA000173875_01488 CDS open 88670-89233 _na     187_aa ydeN Serine hydrolase
1897 ACDX02000006.1 GCA000173875_01489 CDS open 89448-89810 _na     120_aa crcB fluoride efflux transporter CrcB
1898 ACDX02000006.1 GCA000173875_01490 CDS open 89916-90605 _na     229_aa ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
1899 ACDX02000006.1 GCA000173875_01491 CDS open 90602-91321 _na     239_aa dnaQ DNA polymerase III subunit epsilon
1900 ACDX02000006.1 GCA000173875_01492 CDS open 91719-92201 _na     160_aa Pyridoxamine 5'-phosphate oxidase family protein
1901 ACDX02000006.1 GCA000173875_01493 CDS open 92371-92817 _na     148_aa YSIRK family Signal peptide
1902 ACDX02000006.1 GCA000173875_01494 CDS open 92901-93935 _na     344_aa purM Phosphoribosylformylglycinamidine cyclo-ligase
1903 ACDX02000006.1 GCA000173875_01495 CDS open 94141-95211 _na     356_aa perM ATP synthase F0%2C A subunit
1904 ACDX02000006.1 GCA000173875_01496 CDS open 95477-96193 _na     238_aa xapA S-methyl-5'-thioinosine phosphorylase
1905 ACDX02000006.1 GCA000173875_01497 CDS open 96441-98717 _na     758_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
1906 ACDX02000006.1 GCA000173875_01498 CDS open 98856-99734 _na     292_aa metF methylenetetrahydrofolate reductase
1907 ACDX02000006.1 GCA000173875_01499 CDS open 100077-100274 _na     65_aa iscX Fe-S cluster assembly protein IscX
1908 ACDX02000006.1 GCA000173875_01500 CDS open 100607-101215 _na     202_aa Terminase
1909 ACDX02000006.1 GCA000173875_01501 CDS open 101351-101692 _na     113_aa fdx ISC system 2Fe-2S type ferredoxin
1910 ACDX02000006.1 GCA000173875_01502 CDS open 101778-102140 _na     120_aa Pyrimidine dimer DNA glycosylase
1911 ACDX02000006.1 GCA000173875_01503 CDS open 102223-104085 _na     620_aa hscA Fe-S protein assembly chaperone HscA
1912 ACDX02000006.1 GCA000173875_01504 CDS open 104282-105130 _na     282_aa hpnD presqualene diphosphate synthase HpnD
1913 ACDX02000006.1 GCA000173875_01505 CDS open 105127-106440 _na     437_aa hpnE hydroxysqualene dehydroxylase HpnE
1914 ACDX02000006.1 GCA000173875_01506 CDS open 106557-107276 _na     239_aa fabG SDR family oxidoreductase
1915 ACDX02000006.1 GCA000173875_01507 CDS open 107473-107967 _na     164_aa DUF1436 domain-containing protein
1916 ACDX02000006.1 GCA000173875_01508 CDS open 108126-108752 _na     208_aa hypothetical protein
1917 ACDX02000006.1 GCA000173875_01509 CDS open 108896-111070 _na     724_aa mfd transcription-repair coupling factor
1918 ACDX02000006.1 GCA000173875_01510 CDS open 111198-112787 _na     529_aa Transcription-repair coupling factor
1919 ACDX02000006.1 GCA000173875_01511 CDS open 112932-113663 _na     243_aa tadA tRNA adenosine(34) deaminase TadA
1920 ACDX02000006.1 GCA000173875_01512 CDS open 113670-114611 _na     313_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
1921 ACDX02000006.1 GCA000173875_01513 CDS open 114735-116069 _na     444_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
1922 ACDX02000006.1 GCA000173875_01514 CDS open 116263-117738 _na     491_aa trpE anthranilate synthase component I
1923 ACDX02000006.1 GCA000173875_01515 CDS open 117964-118251 _na     95_aa Putative endonuclease
1924 ACDX02000006.1 GCA000173875_01516 CDS open 118461-119597 _na     378_aa purK 5-(carboxyamino)imidazole ribonucleotide synthase
1925 ACDX02000006.1 GCA000173875_01517 CDS open 119677-120159 _na     160_aa phnO Acetyltransferase%2C GNAT family
1926 ACDX02000006.1 GCA000173875_01518 CDS open 120254-120871 _na     205_aa smrB Smr domain protein
1927 ACDX02000006.1 GCA000173875_01519 CDS open 121253-123916 _na     887_aa aceE pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type
1928 ACDX02000006.1 GCA000173875_01520 CDS open 124157-125776 _na     539_aa aceF dihydrolipoyllysine-residue acetyltransferase
1929 ACDX02000006.1 GCA000173875_01521 CDS open 125864-127681 _na     605_aa lpdA dihydrolipoyl dehydrogenase
1930 ACDX02000006.1 GCA000173875_01522 CDS open 128119-128826 _na     235_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
1931 ACDX02000006.1 GCA000173875_01523 CDS open 128846-129475 _na     209_aa ribC riboflavin synthase subunit alpha
1932 ACDX02000006.1 GCA000173875_01524 CDS open 129484-130350 _na     288_aa atu1564 Type I restriction-modification system
1933 ACDX02000006.1 GCA000173875_01525 CDS open 130528-130956 _na     142_aa cpxP Periplasmic protein
1934 ACDX02000006.1 GCA000173875_01526 CDS open 131212-131895 _na     227_aa rpe ribulose-phosphate 3-epimerase
1935 ACDX02000006.1 GCA000173875_01527 CDS open 131983-132303 _na     106_aa Phage associated membrane protein
1936 ACDX02000006.1 GCA000173875_01528 CDS open 132557-133708 _na     383_aa hisZ ATP phosphoribosyltransferase regulatory subunit
1937 ACDX02000006.1 GCA000173875_01529 CDS open 133814-135112 _na     432_aa purA adenylosuccinate synthase
1938 ACDX02000006.1 GCA000173875_01530 CDS open 135283-135633 _na     116_aa ridA Aminoacrylate peracid reductase
1939 ACDX02000006.1 GCA000173875_01531 CDS open 135863-136345 _na     160_aa ybaK Cys-tRNA(Pro) deacylase
1940 ACDX02000006.1 GCA000173875_01532 CDS open 136520-137140 _na     206_aa dnaJ DnaJ domain protein
1941 ACDX02000006.1 GCA000173875_01533 CDS open 137301-138176 _na     291_aa eamA EamA domain-containing protein
1942 ACDX02000006.1 GCA000173875_01534 CDS open 138506-139903 _na     465_aa aspA aspartate ammonia-lyase
1943 ACDX02000006.1 GCA000173875_01535 CDS open 140161-141201 _na     346_aa FRG domain protein
1944 ACDX02000006.1 GCA000173875_01536 CDS open 141293-144334 _na     1013_aa rbbA ribosome-associated ATPase/putative transporter RbbA
1945 ACDX02000006.1 GCA000173875_01537 CDS open 144414-144764 _na     116_aa mmcQ MmcQ protein
1946 ACDX02000006.1 GCA000173875_01538 CDS open 144803-145495 _na     230_aa racX Aspartate racemase
1947 ACDX02000006.1 GCA000173875_01539 CDS open 145767-146627 _na     286_aa rhaT Carboxylate/Amino Acid/Amine Transporter
1948 ACDX02000006.1 GCA000173875_01540 CDS open 146673-147260 _na     195_aa IS3 family transposase
1949 ACDX02000006.1 GCA000173875_01541 CDS open 147473-147823 _na     116_aa helix-turn-helix domain-containing protein
1950 ACDX02000006.1 GCA000173875_01542 CDS open 147975-149318 _na     447_aa DNA 3'-5' helicase II
1951 ACDX02000006.1 GCA000173875_01543 CDS open 149333-149794 _na     153_aa IS3 family transposase
1952 ACDX02000006.1 GCA000173875_01408 gene open 6930-7148 ydcH
1953 ACDX02000006.1 GCA000173875_01409 gene open 7232-8647 cysG
1954 ACDX02000006.1 GCA000173875_01410 gene open 8919-9833 cysD
1955 ACDX02000006.1 GCA000173875_01411 gene open 10163-10921 cah
1956 ACDX02000006.1 GCA000173875_01412 gene open 11397-12128 cysH
1957 ACDX02000006.1 GCA000173875_01413 gene open 12254-13312 dinB
1958 ACDX02000006.1 GCA000173875_01414 gene open 13407-14252 rlmJ
1959 ACDX02000006.1 GCA000173875_01415 gene open 14467-16224 recD
1960 ACDX02000006.1 GCA000173875_01416 gene open 16472-17590
1961 ACDX02000006.1 GCA000173875_01417 gene open 17741-18142 hslR
1962 ACDX02000006.1 GCA000173875_01418 gene open 18361-19320 accA
1963 ACDX02000006.1 GCA000173875_01419 gene open 19505-20755 ttcA
1964 ACDX02000006.1 GCA000173875_01420 gene open 20839-21438 rpoE
1965 ACDX02000006.1 GCA000173875_01421 gene open 21443-22030 rseA
1966 ACDX02000006.1 GCA000173875_01422 gene open 22209-23000 spoU
1967 ACDX02000006.1 GCA000173875_01423 gene open 23126-24298 lldD
1968 ACDX02000006.1 GCA000173875_01424 gene open 24656-25102 iscR
1969 ACDX02000006.1 GCA000173875_01425 gene open 25132-26346 iscS
1970 ACDX02000006.1 GCA000173875_01426 gene open 26505-26738
1971 ACDX02000006.1 GCA000173875_01427 gene open 26900-27028
1972 ACDX02000006.1 GCA000173875_01428 gene open 27097-27483 iscU
1973 ACDX02000006.1 GCA000173875_01429 gene open 27930-28175 recA
1974 ACDX02000006.1 GCA000173875_01430 gene open 28244-28564 iscA
1975 ACDX02000006.1 GCA000173875_01431 gene open 28524-28745 arfA
1976 ACDX02000006.1 GCA000173875_01432 gene open 28828-29334 hscB
1977 ACDX02000006.1 GCA000173875_01433 gene open 29692-31971 nrdA
1978 ACDX02000006.1 GCA000173875_01434 gene open 32010-32933
1979 ACDX02000006.1 GCA000173875_01435 gene open 33186-34340 nrdB
1980 ACDX02000006.1 GCA000173875_01436 gene open 34460-34762 yfaE
1981 ACDX02000006.1 GCA000173875_01437 gene open 34874-35701
1982 ACDX02000006.1 GCA000173875_01438 gene open 35878-37173 dadA
1983 ACDX02000006.1 GCA000173875_01439 gene open 37304-38191 potC
1984 ACDX02000006.1 GCA000173875_01440 gene open 38191-39093 potB
1985 ACDX02000006.1 GCA000173875_01441 gene open 39171-40295 potA
1986 ACDX02000006.1 GCA000173875_01442 gene open 40844-41524 radC
1987 ACDX02000006.1 GCA000173875_01443 gene open 41725-42228
1988 ACDX02000006.1 GCA000173875_01444 gene open 42356-42955 mlaC
1989 ACDX02000006.1 GCA000173875_01445 gene open 43016-43675 cytB
1990 ACDX02000006.1 GCA000173875_01446 gene open 43809-44708 nnr2
1991 ACDX02000006.1 GCA000173875_01447 gene open 45041-46567 fbpB
1992 ACDX02000006.1 GCA000173875_01448 gene open 46620-47333 trmR
1993 ACDX02000006.1 GCA000173875_01449 gene open 47468-48844 mpl
1994 ACDX02000006.1 GCA000173875_01450 gene open 48999-50633
1995 ACDX02000006.1 GCA000173875_01451 gene open 50767-51930
1996 ACDX02000006.1 GCA000173875_01452 gene open 52048-52176
1997 ACDX02000006.1 GCA000173875_01453 gene open 52176-54038
1998 ACDX02000006.1 GCA000173875_01454 gene open 54211-54477 feoA
1999 ACDX02000006.1 GCA000173875_01455 gene open 54796-55422 nnr1
2000 ACDX02000006.1 GCA000173875_01456 gene open 55628-57004