BAKTAGenome Explorer: Neisseria subflava (GCA_000175275.1)
Select a Genome:
|
BAKTA Annotations for GCA_000175275.1
|
Search & Sort all 4395 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2501 | ACQV01000022.1 | GCA000175275_01053 | CDS | open | 247595-248695 | _na 366_aa | Conjugal transfer protein | |
| 2502 | ACQV01000022.1 | GCA000175275_01054 | CDS | open | 248901-249314 | _na 137_aa | gloA | lactoylglutathione lyase |
| 2503 | ACQV01000022.1 | GCA000175275_01055 | CDS | open | 249366-250115 | _na 249_aa | 1-acyl-sn-glycerol-3-phosphate acyltransferase | |
| 2504 | ACQV01000022.1 | GCA000175275_01056 | CDS | open | 250175-250930 | _na 251_aa | L-ornithine N(alpha)-acyltransferase | |
| 2505 | ACQV01000022.1 | GCA000175275_01057 | CDS | open | 251239-252570 | _na 443_aa | YadA-like family protein | |
| 2506 | ACQV01000022.1 | GCA000175275_01058 | CDS | open | 252664-253596 | _na 310_aa | Auxin efflux carrier | |
| 2507 | ACQV01000022.1 | GCA000175275_01059 | CDS | open | 253779-254252 | _na 157_aa | dnrN | iron-sulfur cluster repair protein DnrN |
| 2508 | ACQV01000022.1 | GCA000175275_01060 | CDS | open | 254410-255135 | _na 241_aa | Lipoprotein | |
| 2509 | ACQV01000022.1 | GCA000175275_01061 | CDS | open | 255177-256142 | _na 321_aa | tRNA-dihydrouridine(16) synthase | |
| 2510 | ACQV01000022.1 | GCA000175275_01062 | CDS | open | 256226-257800 | _na 524_aa | Glycosyltransferase%2C group 2 family protein | |
| 2511 | ACQV01000022.1 | GCA000175275_01063 | CDS | open | 258014-259351 | _na 445_aa | C4-dicarboxylate transporter | |
| 2512 | ACQV01000022.1 | GCA000175275_01064 | CDS | open | 259421-259846 | _na 141_aa | DUF4124 domain-containing protein | |
| 2513 | ACQV01000022.1 | GCA000175275_01065 | CDS | open | 260036-261499 | _na 487_aa | guaB | IMP dehydrogenase |
| 2514 | ACQV01000022.1 | GCA000175275_01066 | CDS | open | 261793-262812 | _na 339_aa | waaF | lipopolysaccharide heptosyltransferase II |
| 2515 | ACQV01000022.1 | GCA000175275_00805 | gene | open | 205-876 | |||
| 2516 | ACQV01000022.1 | GCA000175275_00806 | gene | open | 987-2180 | |||
| 2517 | ACQV01000022.1 | GCA000175275_00808 | gene | open | 2633-3490 | |||
| 2518 | ACQV01000022.1 | GCA000175275_00809 | gene | open | 3690-5027 | glmM | ||
| 2519 | ACQV01000022.1 | GCA000175275_00810 | gene | open | 5104-5724 | lolA | ||
| 2520 | ACQV01000022.1 | GCA000175275_00811 | gene | open | 6014-6844 | |||
| 2521 | ACQV01000022.1 | GCA000175275_00812 | gene | open | 6861-7805 | |||
| 2522 | ACQV01000022.1 | GCA000175275_00813 | gene | open | 7875-8525 | |||
| 2523 | ACQV01000022.1 | GCA000175275_00814 | gene | open | 8625-9818 | tyrB | ||
| 2524 | ACQV01000022.1 | GCA000175275_00815 | gene | open | 9883-10296 | yqaA | ||
| 2525 | ACQV01000022.1 | GCA000175275_00816 | gene | open | 10570-11793 | |||
| 2526 | ACQV01000022.1 | GCA000175275_00817 | gene | open | 11886-12509 | |||
| 2527 | ACQV01000022.1 | GCA000175275_00818 | gene | open | 12690-14069 | nhaC | ||
| 2528 | ACQV01000022.1 | GCA000175275_00819 | gene | open | 14207-14836 | nth | ||
| 2529 | ACQV01000022.1 | GCA000175275_00820 | gene | open | 14893-18501 | putA | ||
| 2530 | ACQV01000022.1 | GCA000175275_00821 | gene | open | 18726-20252 | putP | ||
| 2531 | ACQV01000022.1 | GCA000175275_00822 | gene | open | 20708-21502 | |||
| 2532 | ACQV01000022.1 | GCA000175275_00823 | gene | open | 21755-23968 | |||
| 2533 | ACQV01000022.1 | GCA000175275_00824 | gene | open | 24132-24767 | grxB | ||
| 2534 | ACQV01000022.1 | GCA000175275_00825 | gene | open | 24824-25342 | |||
| 2535 | ACQV01000022.1 | GCA000175275_00826 | gene | open | 25342-27003 | pqiB | ||
| 2536 | ACQV01000022.1 | GCA000175275_00827 | gene | open | 27000-28310 | |||
| 2537 | ACQV01000022.1 | GCA000175275_00828 | gene | open | 28714-29337 | hemO | ||
| 2538 | ACQV01000022.1 | GCA000175275_00829 | gene | open | 29458-31002 | |||
| 2539 | ACQV01000022.1 | GCA000175275_00830 | gene | open | 31372-32367 | |||
| 2540 | ACQV01000022.1 | GCA000175275_00831 | gene | open | 32422-34839 | cirA | ||
| 2541 | ACQV01000022.1 | GCA000175275_00832 | gene | open | 35049-36659 | |||
| 2542 | ACQV01000022.1 | GCA000175275_00833 | gene | open | 36785-37375 | |||
| 2543 | ACQV01000022.1 | GCA000175275_00834 | gene | open | 37449-38267 | cysE | ||
| 2544 | ACQV01000022.1 | GCA000175275_00835 | gene | open | 38427-38990 | grpE | ||
| 2545 | ACQV01000022.1 | GCA000175275_00836 | gene | open | 39295-41223 | dnaK | ||
| 2546 | ACQV01000022.1 | GCA000175275_00837 | gene | open | 41490-41708 | |||
| 2547 | ACQV01000022.1 | GCA000175275_00838 | gene | open | 41782-43122 | |||
| 2548 | ACQV01000022.1 | GCA000175275_00840 | gene | open | 43532-44197 | |||
| 2549 | ACQV01000022.1 | GCA000175275_00841 | gene | open | 44190-44783 | |||
| 2550 | ACQV01000022.1 | GCA000175275_00844 | gene | open | 45289-47274 | parE | ||
| 2551 | ACQV01000022.1 | GCA000175275_00845 | gene | open | 47343-47879 | |||
| 2552 | ACQV01000022.1 | GCA000175275_00846 | gene | open | 48208-49353 | |||
| 2553 | ACQV01000022.1 | GCA000175275_00847 | gene | open | 49461-49733 | aCT | ||
| 2554 | ACQV01000022.1 | GCA000175275_00848 | gene | open | 49749-51104 | |||
| 2555 | ACQV01000022.1 | GCA000175275_00849 | gene | open | 51154-51642 | |||
| 2556 | ACQV01000022.1 | GCA000175275_00850 | gene | open | 51773-53302 | cedB | ||
| 2557 | ACQV01000022.1 | GCA000175275_00851 | gene | open | 53543-54772 | |||
| 2558 | ACQV01000022.1 | GCA000175275_00852 | gene | open | 54834-55643 | murI | ||
| 2559 | ACQV01000022.1 | GCA000175275_00853 | gene | open | 56033-56551 | |||
| 2560 | ACQV01000022.1 | GCA000175275_00854 | gene | open | 56957-57622 | pgmB | ||
| 2561 | ACQV01000022.1 | GCA000175275_00855 | gene | open | 57635-59893 | aTH1 | ||
| 2562 | ACQV01000022.1 | GCA000175275_00856 | gene | open | 59968-61320 | melB | ||
| 2563 | ACQV01000022.1 | GCA000175275_00857 | gene | open | 61661-63337 | ettA | ||
| 2564 | ACQV01000022.1 | GCA000175275_00858 | gene | open | 63403-64038 | mtrR | ||
| 2565 | ACQV01000022.1 | GCA000175275_00859 | gene | open | 64265-65533 | acrE | ||
| 2566 | ACQV01000022.1 | GCA000175275_00860 | gene | open | 65545-68757 | |||
| 2567 | ACQV01000022.1 | GCA000175275_00861 | gene | open | 68814-70220 | oprM | ||
| 2568 | ACQV01000022.1 | GCA000175275_00862 | gene | open | 70295-71632 | |||
| 2569 | ACQV01000022.1 | GCA000175275_00865 | gene | open | 72207-72668 | |||
| 2570 | ACQV01000022.1 | GCA000175275_00866 | gene | open | 72885-73943 | alr | ||
| 2571 | ACQV01000022.1 | GCA000175275_00867 | gene | open | 74003-74746 | rsuA | ||
| 2572 | ACQV01000022.1 | GCA000175275_00868 | gene | open | 75077-77158 | cstA | ||
| 2573 | ACQV01000022.1 | GCA000175275_00869 | gene | open | 77148-77342 | ybdD | ||
| 2574 | ACQV01000022.1 | GCA000175275_00870 | gene | open | 77460-77750 | merR | ||
| 2575 | ACQV01000022.1 | GCA000175275_00871 | gene | open | 77766-78725 | dnaJ | ||
| 2576 | ACQV01000022.1 | GCA000175275_00872 | gene | open | 78931-79413 | |||
| 2577 | ACQV01000022.1 | GCA000175275_00873 | gene | open | 79586-80290 | lysM | ||
| 2578 | ACQV01000022.1 | GCA000175275_00874 | gene | open | 80561-82945 | ppsA | ||
| 2579 | ACQV01000022.1 | GCA000175275_00875 | gene | open | 83363-84184 | ppsR | ||
| 2580 | ACQV01000022.1 | GCA000175275_00876 | gene | open | 84241-84807 | dcd | ||
| 2581 | ACQV01000022.1 | GCA000175275_00877 | gene | open | 84934-85362 | |||
| 2582 | ACQV01000022.1 | GCA000175275_00878 | gene | open | 85388-86170 | |||
| 2583 | ACQV01000022.1 | GCA000175275_00879 | gene | open | 86249-87148 | rdgC | ||
| 2584 | ACQV01000022.1 | GCA000175275_00881 | gene | open | 87483-88778 | serS | ||
| 2585 | ACQV01000022.1 | GCA000175275_00882 | gene | open | 88865-89872 | tnp | ||
| 2586 | ACQV01000022.1 | GCA000175275_00883 | gene | open | 90072-90875 | |||
| 2587 | ACQV01000022.1 | GCA000175275_00884 | gene | open | 90952-91203 | |||
| 2588 | ACQV01000022.1 | GCA000175275_00885 | gene | open | 91366-92166 | |||
| 2589 | ACQV01000022.1 | GCA000175275_00886 | gene | open | 92288-92848 | |||
| 2590 | ACQV01000022.1 | GCA000175275_00887 | gene | open | 92962-94131 | metZ | ||
| 2591 | ACQV01000022.1 | GCA000175275_00888 | gene | open | 94218-94424 | |||
| 2592 | ACQV01000022.1 | GCA000175275_00889 | gene | open | 94497-95288 | |||
| 2593 | ACQV01000022.1 | GCA000175275_00890 | gene | open | 95485-96876 | |||
| 2594 | ACQV01000022.1 | GCA000175275_00893 | gene | open | 97325-99550 | |||
| 2595 | ACQV01000022.1 | GCA000175275_00894 | gene | open | 99955-100575 | |||
| 2596 | ACQV01000022.1 | GCA000175275_00895 | gene | open | 100612-101214 | |||
| 2597 | ACQV01000022.1 | GCA000175275_00896 | gene | open | 101219-101629 | |||
| 2598 | ACQV01000022.1 | GCA000175275_00897 | gene | open | 101741-102943 | trpB | ||
| 2599 | ACQV01000022.1 | GCA000175275_00898 | gene | open | 103138-104043 | eamA | ||
| 2600 | ACQV01000022.1 | GCA000175275_00899 | gene | open | 104096-105385 | bioA | ||
| 2601 | ACQV01000022.1 | GCA000175275_00900 | gene | open | 105382-105591 | |||
| 2602 | ACQV01000022.1 | GCA000175275_00901 | gene | open | 105594-106037 | |||
| 2603 | ACQV01000022.1 | GCA000175275_00902 | gene | open | 106027-106521 | |||
| 2604 | ACQV01000022.1 | GCA000175275_00903 | gene | open | 106696-107616 | ubiA | ||
| 2605 | ACQV01000022.1 | GCA000175275_00904 | gene | open | 107781-108335 | ptsN | ||
| 2606 | ACQV01000022.1 | GCA000175275_00905 | gene | open | 108339-109301 | hprK | ||
| 2607 | ACQV01000022.1 | GCA000175275_00906 | gene | open | 109282-110136 | rapZ | ||
| 2608 | ACQV01000022.1 | GCA000175275_00907 | gene | open | 110138-110407 | |||
| 2609 | ACQV01000022.1 | GCA000175275_00908 | gene | open | 110500-111441 | ylqF | ||
| 2610 | ACQV01000022.1 | GCA000175275_00909 | gene | open | 111497-112090 | |||
| 2611 | ACQV01000022.1 | GCA000175275_00910 | gene | open | 112149-114371 | icdM | ||
| 2612 | ACQV01000022.1 | GCA000175275_00911 | gene | open | 114545-115747 | |||
| 2613 | ACQV01000022.1 | GCA000175275_00912 | gene | open | 115751-116269 | |||
| 2614 | ACQV01000022.1 | GCA000175275_00913 | gene | open | 116361-117599 | |||
| 2615 | ACQV01000022.1 | GCA000175275_00914 | gene | open | 117734-120052 | |||
| 2616 | ACQV01000022.1 | GCA000175275_00915 | gene | open | 120146-120763 | |||
| 2617 | ACQV01000022.1 | GCA000175275_00916 | gene | open | 120816-121328 | |||
| 2618 | ACQV01000022.1 | GCA000175275_00918 | gene | open | 121701-122261 | |||
| 2619 | ACQV01000022.1 | GCA000175275_00919 | gene | open | 122316-123122 | |||
| 2620 | ACQV01000022.1 | GCA000175275_00920 | gene | open | 123273-124649 | radA | ||
| 2621 | ACQV01000022.1 | GCA000175275_00921 | gene | open | 124745-126217 | |||
| 2622 | ACQV01000022.1 | GCA000175275_00922 | gene | open | 126433-128307 | |||
| 2623 | ACQV01000022.1 | GCA000175275_00923 | gene | open | 128482-129027 | creA | ||
| 2624 | ACQV01000022.1 | GCA000175275_00924 | gene | open | 129055-129603 | |||
| 2625 | ACQV01000022.1 | GCA000175275_00925 | gene | open | 129596-130051 | |||
| 2626 | ACQV01000022.1 | GCA000175275_00926 | gene | open | 130216-130638 | |||
| 2627 | ACQV01000022.1 | GCA000175275_00927 | gene | open | 130788-131336 | yciW | ||
| 2628 | ACQV01000022.1 | GCA000175275_00928 | gene | open | 131462-132553 | |||
| 2629 | ACQV01000022.1 | GCA000175275_00929 | gene | open | 132638-132808 | norV | ||
| 2630 | ACQV01000022.1 | GCA000175275_00930 | gene | open | 132856-134046 | dapC | ||
| 2631 | ACQV01000022.1 | GCA000175275_00931 | gene | open | 134209-134454 | |||
| 2632 | ACQV01000022.1 | GCA000175275_00932 | gene | open | 134747-135343 | |||
| 2633 | ACQV01000022.1 | GCA000175275_00933 | gene | open | 135429-136601 | |||
| 2634 | ACQV01000022.1 | GCA000175275_00934 | gene | open | 136942-137622 | |||
| 2635 | ACQV01000022.1 | GCA000175275_00935 | gene | open | 137843-138715 | |||
| 2636 | ACQV01000022.1 | GCA000175275_00936 | gene | open | 138877-139266 | |||
| 2637 | ACQV01000022.1 | GCA000175275_00937 | gene | open | 139388-140314 | ribF | ||
| 2638 | ACQV01000022.1 | GCA000175275_00938 | gene | open | 140454-143243 | ileS | ||
| 2639 | ACQV01000022.1 | GCA000175275_00939 | gene | open | 143551-143925 | |||
| 2640 | ACQV01000022.1 | GCA000175275_00940 | gene | open | 144135-144542 | |||
| 2641 | ACQV01000022.1 | GCA000175275_00941 | gene | open | 144784-144909 | ykgO | ||
| 2642 | ACQV01000022.1 | GCA000175275_00942 | gene | open | 144909-145184 | |||
| 2643 | ACQV01000022.1 | GCA000175275_00943 | gene | open | 145359-146852 | |||
| 2644 | ACQV01000022.1 | GCA000175275_00944 | gene | open | 146907-147770 | galU | ||
| 2645 | ACQV01000022.1 | GCA000175275_00945 | gene | open | 147890-150469 | ligA | ||
| 2646 | ACQV01000022.1 | GCA000175275_00946 | gene | open | 150498-151766 | zipA | ||
| 2647 | ACQV01000022.1 | GCA000175275_00947 | gene | open | 151944-152510 | ampD | ||
| 2648 | ACQV01000022.1 | GCA000175275_00948 | gene | open | 152626-153621 | |||
| 2649 | ACQV01000022.1 | GCA000175275_00949 | gene | open | 153689-154315 | tmk | ||
| 2650 | ACQV01000022.1 | GCA000175275_00950 | gene | open | 154579-155859 | sfcA | ||
| 2651 | ACQV01000022.1 | GCA000175275_00951 | gene | open | 156160-157503 | |||
| 2652 | ACQV01000022.1 | GCA000175275_00952 | gene | open | 157583-158242 | |||
| 2653 | ACQV01000022.1 | GCA000175275_00953 | gene | open | 158244-159392 | rodA | ||
| 2654 | ACQV01000022.1 | GCA000175275_00954 | gene | open | 159385-161433 | mrdA | ||
| 2655 | ACQV01000022.1 | GCA000175275_00955 | gene | open | 161438-161938 | mreD | ||
| 2656 | ACQV01000022.1 | GCA000175275_00956 | gene | open | 161943-162785 | mreC | ||
| 2657 | ACQV01000022.1 | GCA000175275_00957 | gene | open | 162797-163834 | mreB | ||
| 2658 | ACQV01000022.1 | GCA000175275_00958 | gene | open | 164059-164349 | gatC | ||
| 2659 | ACQV01000022.1 | GCA000175275_00959 | gene | open | 164561-166009 | gatA | ||
| 2660 | ACQV01000022.1 | GCA000175275_00960 | gene | open | 166025-166900 | |||
| 2661 | ACQV01000022.1 | GCA000175275_00961 | gene | open | 166929-167549 | |||
| 2662 | ACQV01000022.1 | GCA000175275_00962 | gene | open | 167651-169081 | gatB | ||
| 2663 | ACQV01000022.1 | GCA000175275_00963 | gene | open | 169161-170165 | |||
| 2664 | ACQV01000022.1 | GCA000175275_00964 | gene | open | 170431-170676 | |||
| 2665 | ACQV01000022.1 | GCA000175275_00965 | gene | open | 170942-171565 | |||
| 2666 | ACQV01000022.1 | GCA000175275_00966 | gene | open | 171651-173759 | |||
| 2667 | ACQV01000022.1 | GCA000175275_00967 | gene | open | 173916-174575 | |||
| 2668 | ACQV01000022.1 | GCA000175275_00968 | gene | open | 174619-175446 | mutM | ||
| 2669 | ACQV01000022.1 | GCA000175275_00969 | gene | open | 175511-176296 | |||
| 2670 | ACQV01000022.1 | GCA000175275_00970 | gene | open | 176485-177222 | grxC | ||
| 2671 | ACQV01000022.1 | GCA000175275_00971 | gene | open | 177476-178882 | |||
| 2672 | ACQV01000022.1 | GCA000175275_00972 | gene | open | 179017-179247 | |||
| 2673 | ACQV01000022.1 | GCA000175275_00973 | gene | open | 179228-180589 | |||
| 2674 | ACQV01000022.1 | GCA000175275_00974 | gene | open | 180582-180893 | |||
| 2675 | ACQV01000022.1 | GCA000175275_00975 | gene | open | 180907-181110 | |||
| 2676 | ACQV01000022.1 | GCA000175275_00976 | gene | open | 181197-181415 | |||
| 2677 | ACQV01000022.1 | GCA000175275_00977 | gene | open | 181483-181761 | |||
| 2678 | ACQV01000022.1 | GCA000175275_00978 | gene | open | 181883-182188 | |||
| 2679 | ACQV01000022.1 | GCA000175275_00979 | gene | open | 182363-183685 | tspB | ||
| 2680 | ACQV01000022.1 | GCA000175275_00980 | gene | open | 183689-183985 | |||
| 2681 | ACQV01000022.1 | GCA000175275_00981 | gene | open | 183982-185145 | |||
| 2682 | ACQV01000022.1 | GCA000175275_00982 | gene | open | 185443-186399 | |||
| 2683 | ACQV01000022.1 | GCA000175275_00983 | gene | open | 186560-187690 | |||
| 2684 | ACQV01000022.1 | GCA000175275_00984 | gene | open | 187894-188595 | |||
| 2685 | ACQV01000022.1 | GCA000175275_00985 | gene | open | 188728-190521 | lepA | ||
| 2686 | ACQV01000022.1 | GCA000175275_00986 | gene | open | 190521-191540 | lepB | ||
| 2687 | ACQV01000022.1 | GCA000175275_00987 | gene | open | 191593-192471 | eamA | ||
| 2688 | ACQV01000022.1 | GCA000175275_00988 | gene | open | 192709-193248 | |||
| 2689 | ACQV01000022.1 | GCA000175275_00989 | gene | open | 193263-193862 | |||
| 2690 | ACQV01000022.1 | GCA000175275_00990 | gene | open | 193951-194730 | rsmA | ||
| 2691 | ACQV01000022.1 | GCA000175275_00991 | gene | open | 194746-195411 | |||
| 2692 | ACQV01000022.1 | GCA000175275_00992 | gene | open | 195414-196142 | glnQ | ||
| 2693 | ACQV01000022.1 | GCA000175275_00993 | gene | open | 196206-196565 | |||
| 2694 | ACQV01000022.1 | GCA000175275_00994 | gene | open | 196570-197022 | ygfX | ||
| 2695 | ACQV01000022.1 | GCA000175275_00995 | gene | open | 197061-198344 | folC | ||
| 2696 | ACQV01000022.1 | GCA000175275_00996 | gene | open | 198358-199506 | ftsN | ||
| 2697 | ACQV01000022.1 | GCA000175275_00997 | gene | open | 199499-200032 | cvpA | ||
| 2698 | ACQV01000022.1 | GCA000175275_00998 | gene | open | 200185-201735 | purF | ||
| 2699 | ACQV01000022.1 | GCA000175275_00999 | gene | open | 201810-202301 | greB | ||
| 2700 | ACQV01000022.1 | GCA000175275_01000 | gene | open | 202389-203000 | plsY | ||
| 2701 | ACQV01000022.1 | GCA000175275_01001 | gene | open | 203058-203408 | folB | ||
| 2702 | ACQV01000022.1 | GCA000175275_01002 | gene | open | 203455-204102 | |||
| 2703 | ACQV01000022.1 | GCA000175275_01003 | gene | open | 204188-204724 | |||
| 2704 | ACQV01000022.1 | GCA000175275_01004 | gene | open | 204854-205492 | |||
| 2705 | ACQV01000022.1 | GCA000175275_01005 | gene | open | 205534-206328 | speE | ||
| 2706 | ACQV01000022.1 | GCA000175275_01008 | gene | open | 206860-207651 | panB | ||
| 2707 | ACQV01000022.1 | GCA000175275_01009 | gene | open | 207771-208607 | panC | ||
| 2708 | ACQV01000022.1 | GCA000175275_01010 | gene | open | 208697-211297 | mutS | ||
| 2709 | ACQV01000022.1 | GCA000175275_01011 | gene | open | 211335-212186 | |||
| 2710 | ACQV01000022.1 | GCA000175275_01012 | gene | open | 212230-213060 | nikM | ||
| 2711 | ACQV01000022.1 | GCA000175275_01013 | gene | open | 213442-214497 | |||
| 2712 | ACQV01000022.1 | GCA000175275_01014 | gene | open | 214575-215633 | dinB | ||
| 2713 | ACQV01000022.1 | GCA000175275_01015 | gene | open | 215771-217723 | |||
| 2714 | ACQV01000022.1 | GCA000175275_01016 | gene | open | 217741-219426 | |||
| 2715 | ACQV01000022.1 | GCA000175275_01017 | gene | open | 219849-220340 | |||
| 2716 | ACQV01000022.1 | GCA000175275_01018 | gene | open | 220471-220671 | |||
| 2717 | ACQV01000022.1 | GCA000175275_01019 | gene | open | 220705-221043 | |||
| 2718 | ACQV01000022.1 | GCA000175275_01020 | gene | open | 221046-221372 | |||
| 2719 | ACQV01000022.1 | GCA000175275_01021 | gene | open | 221387-222739 | |||
| 2720 | ACQV01000022.1 | GCA000175275_01022 | gene | open | 222736-223395 | |||
| 2721 | ACQV01000022.1 | GCA000175275_01023 | gene | open | 223682-224488 | insO | ||
| 2722 | ACQV01000022.1 | GCA000175275_01024 | gene | open | 224814-225530 | |||
| 2723 | ACQV01000022.1 | GCA000175275_01025 | gene | open | 225608-225904 | hipA | ||
| 2724 | ACQV01000022.1 | GCA000175275_01026 | gene | open | 225897-226166 | hipA | ||
| 2725 | ACQV01000022.1 | GCA000175275_01027 | gene | open | 226325-227140 | |||
| 2726 | ACQV01000022.1 | GCA000175275_01028 | gene | open | 227572-228051 | |||
| 2727 | ACQV01000022.1 | GCA000175275_01029 | gene | open | 228106-229014 | |||
| 2728 | ACQV01000022.1 | GCA000175275_01030 | gene | open | 229118-230206 | cpdA | ||
| 2729 | ACQV01000022.1 | GCA000175275_01031 | gene | open | 230275-230937 | lemA | ||
| 2730 | ACQV01000022.1 | GCA000175275_01032 | gene | open | 231046-232158 | |||
| 2731 | ACQV01000022.1 | GCA000175275_01033 | gene | open | 232155-233183 | patB | ||
| 2732 | ACQV01000022.1 | GCA000175275_01034 | gene | open | 233194-234618 | algI | ||
| 2733 | ACQV01000022.1 | GCA000175275_01035 | gene | open | 234665-235303 | dedA | ||
| 2734 | ACQV01000022.1 | GCA000175275_01036 | gene | open | 235534-236202 | hda | ||
| 2735 | ACQV01000022.1 | GCA000175275_01037 | gene | open | 236199-236867 | serB | ||
| 2736 | ACQV01000022.1 | GCA000175275_01038 | gene | open | 237054-237242 | tonB | ||
| 2737 | ACQV01000022.1 | GCA000175275_01039 | gene | open | 237318-237863 | |||
| 2738 | ACQV01000022.1 | GCA000175275_01040 | gene | open | 238120-238905 | |||
| 2739 | ACQV01000022.1 | GCA000175275_01042 | gene | open | 239544-240758 | aspB | ||
| 2740 | ACQV01000022.1 | GCA000175275_01043 | gene | open | 240844-241059 | |||
| 2741 | ACQV01000022.1 | GCA000175275_01044 | gene | open | 241225-241824 | |||
| 2742 | ACQV01000022.1 | GCA000175275_01045 | gene | open | 241884-242444 | efp | ||
| 2743 | ACQV01000022.1 | GCA000175275_01046 | gene | open | 242487-243644 | earP | ||
| 2744 | ACQV01000022.1 | GCA000175275_01047 | gene | open | 243676-243954 | |||
| 2745 | ACQV01000022.1 | GCA000175275_01048 | gene | open | 244057-244845 | |||
| 2746 | ACQV01000022.1 | GCA000175275_01049 | gene | open | 244914-245114 | |||
| 2747 | ACQV01000022.1 | GCA000175275_01050 | gene | open | 245231-246370 | |||
| 2748 | ACQV01000022.1 | GCA000175275_01051 | gene | open | 246367-246948 | metW | ||
| 2749 | ACQV01000022.1 | GCA000175275_01052 | gene | open | 247044-247508 | |||
| 2750 | ACQV01000022.1 | GCA000175275_01053 | gene | open | 247595-248695 | |||
| 2751 | ACQV01000022.1 | GCA000175275_01054 | gene | open | 248901-249314 | gloA | ||
| 2752 | ACQV01000022.1 | GCA000175275_01055 | gene | open | 249366-250115 | |||
| 2753 | ACQV01000022.1 | GCA000175275_01056 | gene | open | 250175-250930 | |||
| 2754 | ACQV01000022.1 | GCA000175275_01057 | gene | open | 251239-252570 | |||
| 2755 | ACQV01000022.1 | GCA000175275_01058 | gene | open | 252664-253596 | |||
| 2756 | ACQV01000022.1 | GCA000175275_01059 | gene | open | 253779-254252 | dnrN | ||
| 2757 | ACQV01000022.1 | GCA000175275_01060 | gene | open | 254410-255135 | |||
| 2758 | ACQV01000022.1 | GCA000175275_01061 | gene | open | 255177-256142 | |||
| 2759 | ACQV01000022.1 | GCA000175275_01062 | gene | open | 256226-257800 | |||
| 2760 | ACQV01000022.1 | GCA000175275_01063 | gene | open | 258014-259351 | |||
| 2761 | ACQV01000022.1 | GCA000175275_01064 | gene | open | 259421-259846 | |||
| 2762 | ACQV01000022.1 | GCA000175275_01065 | gene | open | 260036-261499 | guaB | ||
| 2763 | ACQV01000022.1 | GCA000175275_01066 | gene | open | 261793-262812 | waaF | ||
| 2764 | ACQV01000022.1 | GCA000175275_00807 | gene | open | 2272-2347 | trnR | ||
| 2765 | ACQV01000022.1 | GCA000175275_00839 | gene | open | 43286-43370 | trnL | ||
| 2766 | ACQV01000022.1 | GCA000175275_00842 | gene | open | 44908-44983 | trnV | ||
| 2767 | ACQV01000022.1 | GCA000175275_00843 | gene | open | 45016-45092 | trnD | ||
| 2768 | ACQV01000022.1 | GCA000175275_00880 | gene | open | 87282-87357 | trnE | ||
| 2769 | ACQV01000022.1 | GCA000175275_00891 | gene | open | 96992-97068 | trnR | ||
| 2770 | ACQV01000022.1 | GCA000175275_00892 | gene | open | 97081-97155 | trnE | ||
| 2771 | ACQV01000022.1 | GCA000175275_00917 | gene | open | 121528-121620 | trnS | ||
| 2772 | ACQV01000022.1 | GCA000175275_01006 | gene | open | 206544-206619 | trnT | ||
| 2773 | ACQV01000022.1 | GCA000175275_01007 | gene | open | 206656-206731 | trnT | ||
| 2774 | ACQV01000022.1 | GCA000175275_00807 | tRNA | open | 2272-2347 | trnR | tRNA-Arg(ccg) | |
| 2775 | ACQV01000022.1 | GCA000175275_00839 | tRNA | open | 43286-43370 | trnL | tRNA-Leu(tag) | |
| 2776 | ACQV01000022.1 | GCA000175275_00842 | tRNA | open | 44908-44983 | trnV | tRNA-Val(tac) | |
| 2777 | ACQV01000022.1 | GCA000175275_00843 | tRNA | open | 45016-45092 | trnD | tRNA-Asp(gtc) | |
| 2778 | ACQV01000022.1 | GCA000175275_00880 | tRNA | open | 87282-87357 | trnE | tRNA-Glu(ttc) | |
| 2779 | ACQV01000022.1 | GCA000175275_00891 | tRNA | open | 96992-97068 | trnR | tRNA-Arg(acg) | |
| 2780 | ACQV01000022.1 | GCA000175275_00892 | tRNA | open | 97081-97155 | trnE | tRNA-Glu(ttc) | |
| 2781 | ACQV01000022.1 | GCA000175275_00917 | tRNA | open | 121528-121620 | trnS | tRNA-Ser(gct) | |
| 2782 | ACQV01000022.1 | GCA000175275_01006 | tRNA | open | 206544-206619 | trnT | tRNA-Thr(tgt) | |
| 2783 | ACQV01000022.1 | GCA000175275_01007 | tRNA | open | 206656-206731 | trnT | tRNA-Thr(tgt) | |
| 2784 | ACQV01000023.1 | GCA000175275_00785 | gene | open | 258-1798 | rrs | ||
| 2785 | ACQV01000023.1 | GCA000175275_00788 | gene | open | 2410-5298 | rrl | ||
| 2786 | ACQV01000023.1 | GCA000175275_00789 | gene | open | 5393-5506 | rrf | ||
| 2787 | ACQV01000023.1 | GCA000175275_00785 | rRNA | open | 258-1798 | rrs | 16S ribosomal RNA | |
| 2788 | ACQV01000023.1 | GCA000175275_00788 | rRNA | open | 2410-5298 | rrl | 23S ribosomal RNA | |
| 2789 | ACQV01000023.1 | GCA000175275_00789 | rRNA | open | 5393-5506 | rrf | 5S ribosomal RNA | |
| 2790 | ACQV01000023.1 | GCA000175275_00790 | CDS | open | 5674-5829 | _na 51_aa | TonB-dependent receptor | |
| 2791 | ACQV01000023.1 | GCA000175275_00791 | CDS | open | 5881-6168 | _na 95_aa | comE | ComE operon protein 1 |
| 2792 | ACQV01000023.1 | GCA000175275_00792 | CDS | open | 6301-6462 | _na 53_aa | Prepilin-type cleavage/methylation N-terminal domain protein | |
| 2793 | ACQV01000023.1 | GCA000175275_00793 | CDS | open | 6603-7451 | _na 282_aa | hpnD | presqualene diphosphate synthase HpnD |
| 2794 | ACQV01000023.1 | GCA000175275_00794 | CDS | open | 7448-8755 | _na 435_aa | hpnE | hydroxysqualene dehydroxylase HpnE |
| 2795 | ACQV01000023.1 | GCA000175275_00795 | CDS | open | 8851-9570 | _na 239_aa | SDR family oxidoreductase | |
| 2796 | ACQV01000023.1 | GCA000175275_00796 | CDS | open | 9758-10714 | _na 318_aa | thiL | thiamine-phosphate kinase |
| 2797 | ACQV01000023.1 | GCA000175275_00797 | CDS | open | 10707-11195 | _na 162_aa | Phosphatidylglycerophosphatase A | |
| 2798 | ACQV01000023.1 | GCA000175275_00798 | CDS | open | 11292-11660 | _na 122_aa | apaG | Co2+/Mg2+ efflux protein ApaG |
| 2799 | ACQV01000023.1 | GCA000175275_00799 | CDS | open | 11727-12023 | _na 98_aa | DUF2288 domain-containing protein | |
| 2800 | ACQV01000023.1 | GCA000175275_00800 | CDS | open | 12294-13019 | _na 241_aa | ABC transporter%2C ATP-binding protein | |
| 2801 | ACQV01000023.1 | GCA000175275_00801 | CDS | open | 13096-13971 | _na 291_aa | mntB | Manganese transport system membrane protein MntB |
| 2802 | ACQV01000023.1 | GCA000175275_00802 | CDS | open | 14012-14956 | _na 314_aa | znuA | ABC transporter substrate-binding protein |
| 2803 | ACQV01000023.1 | GCA000175275_00803 | CDS | open | 15224-16561 | _na 445_aa | Transporter | |
| 2804 | ACQV01000023.1 | GCA000175275_00804 | CDS | open | 16690-18666 | _na 658_aa | fepA | TonB-dependent copper receptor |
| 2805 | ACQV01000023.1 | GCA000175275_00790 | gene | open | 5674-5829 | |||
| 2806 | ACQV01000023.1 | GCA000175275_00791 | gene | open | 5881-6168 | comE | ||
| 2807 | ACQV01000023.1 | GCA000175275_00792 | gene | open | 6301-6462 | |||
| 2808 | ACQV01000023.1 | GCA000175275_00793 | gene | open | 6603-7451 | hpnD | ||
| 2809 | ACQV01000023.1 | GCA000175275_00794 | gene | open | 7448-8755 | hpnE | ||
| 2810 | ACQV01000023.1 | GCA000175275_00795 | gene | open | 8851-9570 | |||
| 2811 | ACQV01000023.1 | GCA000175275_00796 | gene | open | 9758-10714 | thiL | ||
| 2812 | ACQV01000023.1 | GCA000175275_00797 | gene | open | 10707-11195 | |||
| 2813 | ACQV01000023.1 | GCA000175275_00798 | gene | open | 11292-11660 | apaG | ||
| 2814 | ACQV01000023.1 | GCA000175275_00799 | gene | open | 11727-12023 | |||
| 2815 | ACQV01000023.1 | GCA000175275_00800 | gene | open | 12294-13019 | |||
| 2816 | ACQV01000023.1 | GCA000175275_00801 | gene | open | 13096-13971 | mntB | ||
| 2817 | ACQV01000023.1 | GCA000175275_00802 | gene | open | 14012-14956 | znuA | ||
| 2818 | ACQV01000023.1 | GCA000175275_00803 | gene | open | 15224-16561 | |||
| 2819 | ACQV01000023.1 | GCA000175275_00804 | gene | open | 16690-18666 | fepA | ||
| 2820 | ACQV01000023.1 | GCA000175275_00786 | gene | open | 1904-1980 | trnI | ||
| 2821 | ACQV01000023.1 | GCA000175275_00787 | gene | open | 1986-2061 | trnA | ||
| 2822 | ACQV01000023.1 | GCA000175275_00786 | tRNA | open | 1904-1980 | trnI | tRNA-Ile(gat) | |
| 2823 | ACQV01000023.1 | GCA000175275_00787 | tRNA | open | 1986-2061 | trnA | tRNA-Ala(tgc) | |
| 2824 | ACQV01000024.1 | repeat_region | open | 130451-132750 | CRISPR array with 35 repeats of length 32%2C consensus sequence GTTTCAACACACAGCCGCCCGAAGACGGCTGG and spacer length 34 | |||
| 2825 | ACQV01000024.1 | GCA000175275_00593 | CDS | open | 12-545 | _na 177_aa | NlpC/P60 domain-containing protein | |
| 2826 | ACQV01000024.1 | GCA000175275_00594 | CDS | open | 742-1650 | _na 302_aa | hemF | oxygen-dependent coproporphyrinogen oxidase |
| 2827 | ACQV01000024.1 | GCA000175275_00595 | CDS | open | 1843-2682 | _na 279_aa | htpX | protease HtpX |
| 2828 | ACQV01000024.1 | GCA000175275_00596 | CDS | open | 2732-3547 | _na 271_aa | hpnC | squalene synthase HpnC |
| 2829 | ACQV01000024.1 | GCA000175275_00597 | CDS | open | 3601-4323 | _na 240_aa | tadA | tRNA adenosine(34) deaminase TadA |
| 2830 | ACQV01000024.1 | GCA000175275_00598 | CDS | open | 4327-5268 | _na 313_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 2831 | ACQV01000024.1 | GCA000175275_00599 | CDS | open | 5485-6537 | _na 350_aa | bioB | biotin synthase BioB |
| 2832 | ACQV01000024.1 | GCA000175275_00600 | CDS | open | 6584-7594 | _na 336_aa | adenosine deaminase | |
| 2833 | ACQV01000024.1 | GCA000175275_00601 | CDS | open | 7672-8451 | _na 259_aa | fpr | ferredoxin--NADP(+) reductase |
| 2834 | ACQV01000024.1 | GCA000175275_00602 | CDS | open | 8550-8993 | _na 147_aa | DUF306 domain-containing protein | |
| 2835 | ACQV01000024.1 | GCA000175275_00603 | CDS | open | 9064-10221 | _na 385_aa | metC | Putative 8-amino-7-oxononanoate synthase |
| 2836 | ACQV01000024.1 | GCA000175275_00604 | CDS | open | 10400-11173 | _na 257_aa | folE2 | GTP cyclohydrolase FolE2 |
| 2837 | ACQV01000024.1 | GCA000175275_00605 | CDS | open | 11391-13196 | _na 601_aa | dsbD | Thiol:disulfide interchange protein DsbD |
| 2838 | ACQV01000024.1 | GCA000175275_00606 | CDS | open | 13258-14430 | _na 390_aa | lldD | L-lactate dehydrogenase |
| 2839 | ACQV01000024.1 | GCA000175275_00607 | CDS | open | 14789-15235 | _na 148_aa | iscR | Fe-S cluster assembly transcriptional regulator IscR |
| 2840 | ACQV01000024.1 | GCA000175275_00608 | CDS | open | 15287-16501 | _na 404_aa | iscS | IscS subfamily cysteine desulfurase |
| 2841 | ACQV01000024.1 | GCA000175275_00609 | CDS | open | 16755-16865 | _na 36_aa | hypothetical protein | |
| 2842 | ACQV01000024.1 | GCA000175275_00610 | CDS | open | 16979-17107 | _na 42_aa | FxLD family lantipeptide | |
| 2843 | ACQV01000024.1 | GCA000175275_00611 | CDS | open | 17176-17562 | _na 128_aa | iscU | Iron-sulfur cluster assembly scaffold protein IscU |
| 2844 | ACQV01000024.1 | GCA000175275_00612 | CDS | open | 17825-18070 | _na 81_aa | recA | Recombinase RecA |
| 2845 | ACQV01000024.1 | GCA000175275_00613 | CDS | open | 18140-18460 | _na 106_aa | iscA | iron-sulfur cluster assembly protein IscA |
| 2846 | ACQV01000024.1 | GCA000175275_00614 | CDS | open | 18457-18642 | _na 61_aa | Alternative ribosome-rescue factor A | |
| 2847 | ACQV01000024.1 | GCA000175275_00615 | CDS | open | 18722-19222 | _na 166_aa | hscB | Fe-S protein assembly co-chaperone HscB |
| 2848 | ACQV01000024.1 | GCA000175275_00616 | CDS | open | 19331-19903 | _na 190_aa | rplY | 50S ribosomal protein L25/general stress protein Ctc |
| 2849 | ACQV01000024.1 | GCA000175275_00617 | CDS | open | 19969-20952 | _na 327_aa | prs | Ribose-phosphate pyrophosphokinase |
| 2850 | ACQV01000024.1 | GCA000175275_00621 | CDS | open | 21383-22258 | _na 291_aa | ispE | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase |
| 2851 | ACQV01000024.1 | GCA000175275_00622 | CDS | open | 22240-22824 | _na 194_aa | lolB | lipoprotein insertase outer membrane protein LolB |
| 2852 | ACQV01000024.1 | GCA000175275_00623 | CDS | open | 22881-24743 | _na 620_aa | Tetratricopeptide repeat protein | |
| 2853 | ACQV01000024.1 | GCA000175275_00624 | CDS | open | 24919-25524 | _na 201_aa | CoA pyrophosphatase | |
| 2854 | ACQV01000024.1 | GCA000175275_00625 | CDS | open | 25787-27079 | _na 430_aa | aroA | 3-phosphoshikimate 1-carboxyvinyltransferase |
| 2855 | ACQV01000024.1 | GCA000175275_00626 | CDS | open | 27227-28273 | _na 348_aa | recA | recombinase RecA |
| 2856 | ACQV01000024.1 | GCA000175275_00627 | CDS | open | 28369-29349 | _na 326_aa | fghA | S-formylglutathione hydrolase |
| 2857 | ACQV01000024.1 | GCA000175275_00628 | CDS | open | 29718-31430 | _na 570_aa | proS | proline--tRNA ligase |
| 2858 | ACQV01000024.1 | GCA000175275_00629 | CDS | open | 31497-32366 | _na 289_aa | pflA | pyruvate formate lyase 1-activating protein |
| 2859 | ACQV01000024.1 | GCA000175275_00630 | CDS | open | 32442-34727 | _na 761_aa | pflB | formate C-acetyltransferase |
| 2860 | ACQV01000024.1 | GCA000175275_00631 | CDS | open | 35209-36507 | _na 432_aa | purA | adenylosuccinate synthase |
| 2861 | ACQV01000024.1 | GCA000175275_00632 | CDS | open | 36551-37708 | _na 385_aa | ATP phosphoribosyltransferase regulatory subunit | |
| 2862 | ACQV01000024.1 | GCA000175275_00633 | CDS | open | 38030-38833 | _na 267_aa | bamD | Outer membrane protein assembly factor BamD |
| 2863 | ACQV01000024.1 | GCA000175275_00634 | CDS | open | 38937-39956 | _na 339_aa | rluD | 23S rRNA pseudouridine(1911/1915/1917) synthase RluD |
| 2864 | ACQV01000024.1 | GCA000175275_00635 | CDS | open | 40047-40631 | _na 194_aa | DUF4145 domain-containing protein | |
| 2865 | ACQV01000024.1 | GCA000175275_00636 | CDS | open | 40628-41398 | _na 256_aa | pgeF | peptidoglycan editing factor PgeF |
| 2866 | ACQV01000024.1 | GCA000175275_00637 | CDS | open | 41519-41998 | _na 159_aa | lptE | LPS-assembly lipoprotein LptE |
| 2867 | ACQV01000024.1 | GCA000175275_00638 | CDS | open | 41998-42999 | _na 333_aa | holA | DNA polymerase III subunit delta |
| 2868 | ACQV01000024.1 | GCA000175275_00639 | CDS | open | 43146-43565 | _na 139_aa | Magnesium transporter | |
| 2869 | ACQV01000024.1 | GCA000175275_00640 | CDS | open | 43657-44181 | _na 174_aa | RDD family protein | |
| 2870 | ACQV01000024.1 | GCA000175275_00641 | CDS | open | 44276-45508 | _na 410_aa | beta-ketoacyl-ACP synthase | |
| 2871 | ACQV01000024.1 | GCA000175275_00642 | CDS | open | 45505-46233 | _na 242_aa | fabG | 3-oxoacyl-ACP reductase FabG |
| 2872 | ACQV01000024.1 | GCA000175275_00643 | CDS | open | 46299-46787 | _na 162_aa | FabA-like domain protein | |
| 2873 | ACQV01000024.1 | GCA000175275_00644 | CDS | open | 46898-47659 | _na 253_aa | Beta-ketoacyl synthase-like N-terminal domain-containing protein | |
| 2874 | ACQV01000024.1 | GCA000175275_00645 | CDS | open | 47656-48414 | _na 252_aa | Acyltransferase | |
| 2875 | ACQV01000024.1 | GCA000175275_00646 | CDS | open | 48411-48671 | _na 86_aa | Putative acyl carrier protein | |
| 2876 | ACQV01000024.1 | GCA000175275_00647 | CDS | open | 48684-48935 | _na 83_aa | acyl carrier protein | |
| 2877 | ACQV01000024.1 | GCA000175275_00648 | CDS | open | 49008-49547 | _na 179_aa | Integral membrane protein | |
| 2878 | ACQV01000024.1 | GCA000175275_00649 | CDS | open | 49587-50342 | _na 251_aa | Lipoprotein | |
| 2879 | ACQV01000024.1 | GCA000175275_00650 | CDS | open | 50358-52061 | _na 567_aa | 2-succinylbenzoate--CoA ligase | |
| 2880 | ACQV01000024.1 | GCA000175275_00651 | CDS | open | 52098-53186 | _na 362_aa | L-tyrosine C(3)-methyltransferase | |
| 2881 | ACQV01000024.1 | GCA000175275_00652 | CDS | open | 53278-53934 | _na 218_aa | Cytochrome b561 bacterial/Ni-hydrogenase domain-containing protein | |
| 2882 | ACQV01000024.1 | GCA000175275_00653 | CDS | open | 53988-54869 | _na 293_aa | ADP-dependent (S)-NAD(P)H-hydrate dehydratase | |
| 2883 | ACQV01000024.1 | GCA000175275_00654 | CDS | open | 54974-55966 | _na 330_aa | yfeH | Transporter |
| 2884 | ACQV01000024.1 | GCA000175275_00655 | CDS | open | 56036-56599 | _na 187_aa | Lipid/polyisoprenoid-binding YceI-like domain-containing protein | |
| 2885 | ACQV01000024.1 | GCA000175275_00656 | CDS | open | 56878-58737 | _na 619_aa | ilvD | dihydroxy-acid dehydratase |
| 2886 | ACQV01000024.1 | GCA000175275_00657 | CDS | open | 58806-58937 | _na 43_aa | Phage associated protein | |
| 2887 | ACQV01000024.1 | GCA000175275_00658 | CDS | open | 59006-60295 | _na 429_aa | Serine protease | |
| 2888 | ACQV01000024.1 | GCA000175275_00659 | CDS | open | 60372-60605 | _na 77_aa | Cytochrome b6 | |
| 2889 | ACQV01000024.1 | GCA000175275_00660 | CDS | open | 60607-61038 | _na 143_aa | Gamma-butyrobetaine hydroxylase-like N-terminal domain-containing protein | |
| 2890 | ACQV01000024.1 | GCA000175275_00661 | CDS | open | 61121-61423 | _na 100_aa | MBL fold metallo-hydrolase | |
| 2891 | ACQV01000024.1 | GCA000175275_00662 | CDS | open | 61453-62190 | _na 245_aa | ubiE | bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1%2C4-benzoquinol methylase UbiE |
| 2892 | ACQV01000024.1 | GCA000175275_00663 | CDS | open | 62357-63487 | _na 376_aa | Putrescine-binding periplasmic protein | |
| 2893 | ACQV01000024.1 | GCA000175275_00664 | CDS | open | 63738-66362 | _na 874_aa | Alanine--tRNA ligase | |
| 2894 | ACQV01000024.1 | GCA000175275_00665 | CDS | open | 66446-68047 | _na 533_aa | DUF262 domain-containing protein | |
| 2895 | ACQV01000024.1 | GCA000175275_00666 | CDS | open | 68386-69243 | _na 285_aa | Aminomethyltransferase folate-binding domain-containing protein | |
| 2896 | ACQV01000024.1 | GCA000175275_00667 | CDS | open | 69366-69929 | _na 187_aa | Peptidyl-prolyl cis-trans isomerase | |
| 2897 | ACQV01000024.1 | GCA000175275_00668 | CDS | open | 70127-72385 | _na 752_aa | TonB-dependent siderophore receptor | |
| 2898 | ACQV01000024.1 | GCA000175275_00669 | CDS | open | 72636-74402 | _na 588_aa | yddA | ABC superfamily ATP binding cassette transporter%2C membrane protein |
| 2899 | ACQV01000024.1 | GCA000175275_00670 | CDS | open | 74549-75274 | _na 241_aa | glycosyltransferase family 2 protein | |
| 2900 | ACQV01000024.1 | GCA000175275_00671 | CDS | open | 75279-76208 | _na 309_aa | Lipid A biosynthesis (KDO)2-(Lauroyl)-lipid IVA acyltransferase | |
| 2901 | ACQV01000024.1 | GCA000175275_00672 | CDS | open | 76235-76672 | _na 145_aa | Esterase | |
| 2902 | ACQV01000024.1 | GCA000175275_00673 | CDS | open | 76776-78155 | _na 459_aa | Multidrug-efflux transporter | |
| 2903 | ACQV01000024.1 | GCA000175275_00674 | CDS | open | 78199-79266 | _na 355_aa | murB | UDP-N-acetylmuramate dehydrogenase |
| 2904 | ACQV01000024.1 | GCA000175275_00675 | CDS | open | 79285-79926 | _na 213_aa | acrR | TetR family transcriptional regulator |
| 2905 | ACQV01000024.1 | GCA000175275_00676 | CDS | open | 80016-80789 | _na 257_aa | NAD dependent epimerase/dehydratase family protein | |
| 2906 | ACQV01000024.1 | GCA000175275_00677 | CDS | open | 80840-81412 | _na 190_aa | SCP2 domain-containing protein | |
| 2907 | ACQV01000024.1 | GCA000175275_00678 | CDS | open | 81440-82330 | _na 296_aa | NAD(+) kinase | |
| 2908 | ACQV01000024.1 | GCA000175275_00679 | CDS | open | 82355-82660 | _na 101_aa | Phage associated membrane protein | |
| 2909 | ACQV01000024.1 | GCA000175275_00680 | CDS | open | 82913-85390 | _na 825_aa | TonB-dependent receptor | |
| 2910 | ACQV01000024.1 | GCA000175275_00681 | CDS | open | 85563-86864 | _na 433_aa | mpfA | Polyamine export protein |
| 2911 | ACQV01000024.1 | GCA000175275_00682 | CDS | open | 86966-88273 | _na 435_aa | replication-associated recombination protein A | |
| 2912 | ACQV01000024.1 | GCA000175275_00683 | CDS | open | 88425-88799 | _na 124_aa | Lipoprotein | |
| 2913 | ACQV01000024.1 | GCA000175275_00684 | CDS | open | 88886-90295 | _na 469_aa | thrC | threonine synthase |
| 2914 | ACQV01000024.1 | GCA000175275_00685 | CDS | open | 90524-92290 | _na 588_aa | msbA | lipid A export permease/ATP-binding protein MsbA |
| 2915 | ACQV01000024.1 | GCA000175275_00686 | CDS | open | 92376-93152 | _na 258_aa | fpr | ferredoxin--NADP(+) reductase |
| 2916 | ACQV01000024.1 | GCA000175275_00687 | CDS | open | 93224-95347 | _na 707_aa | uroporphyrinogen-III synthase | |
| 2917 | ACQV01000024.1 | GCA000175275_00688 | CDS | open | 95344-96567 | _na 407_aa | hemY | HemY N-terminal domain-containing protein |
| 2918 | ACQV01000024.1 | GCA000175275_00689 | CDS | open | 96703-97764 | _na 353_aa | hemE | uroporphyrinogen decarboxylase |
| 2919 | ACQV01000024.1 | GCA000175275_00690 | CDS | open | 97910-99403 | _na 497_aa | cls | cardiolipin synthase |
| 2920 | ACQV01000024.1 | GCA000175275_00691 | CDS | open | 99667-99861 | _na 64_aa | Inner membrane protein YgaP-like transmembrane domain-containing protein | |
| 2921 | ACQV01000024.1 | GCA000175275_00692 | CDS | open | 99874-100395 | _na 173_aa | Rhodanese domain-containing protein | |
| 2922 | ACQV01000024.1 | GCA000175275_00693 | CDS | open | 100475-100777 | _na 100_aa | arsR | Transcriptional regulator%2C ArsR family |
| 2923 | ACQV01000024.1 | GCA000175275_00694 | CDS | open | 100868-101206 | _na 112_aa | Lipoprotein | |
| 2924 | ACQV01000024.1 | GCA000175275_00695 | CDS | open | 101282-104725 | _na 1147_aa | mfd | transcription-repair coupling factor |
| 2925 | ACQV01000024.1 | GCA000175275_00696 | CDS | open | 104819-105511 | _na 230_aa | VIT family protein | |
| 2926 | ACQV01000024.1 | GCA000175275_00697 | CDS | open | 105810-105956 | _na 48_aa | CCGSCS motif protein | |
| 2927 | ACQV01000024.1 | GCA000175275_00698 | CDS | open | 106147-106347 | _na 66_aa | Cytochrome C oxidase Cbb3 | |
| 2928 | ACQV01000024.1 | GCA000175275_00699 | CDS | open | 106437-107834 | _na 465_aa | aspA | aspartate ammonia-lyase |
| 2929 | ACQV01000024.1 | GCA000175275_00700 | CDS | open | 108089-108751 | _na 220_aa | Nitroreductase family protein | |
| 2930 | ACQV01000024.1 | GCA000175275_00701 | CDS | open | 108932-111133 | _na 733_aa | Ferrienterobactin receptor | |
| 2931 | ACQV01000024.1 | GCA000175275_00702 | CDS | open | 111365-111583 | _na 72_aa | DUF465 domain-containing protein | |
| 2932 | ACQV01000024.1 | GCA000175275_00703 | CDS | open | 111807-112178 | _na 123_aa | DUF4376 domain-containing protein | |
| 2933 | ACQV01000024.1 | GCA000175275_00704 | CDS | open | 112312-113562 | _na 416_aa | glyA | Serine hydroxymethyltransferase |
| 2934 | ACQV01000024.1 | GCA000175275_00705 | CDS | open | 113599-113769 | _na 56_aa | hypothetical protein | |
| 2935 | ACQV01000024.1 | GCA000175275_00706 | CDS | open | 113956-114996 | _na 346_aa | yddG | aromatic amino acid DMT transporter YddG |
| 2936 | ACQV01000024.1 | GCA000175275_00707 | CDS | open | 115053-115478 | _na 141_aa | sarZ | HTH-type transcriptional regulator SarZ |
| 2937 | ACQV01000024.1 | GCA000175275_00708 | CDS | open | 115490-116359 | _na 289_aa | ABC transmembrane type-1 domain-containing protein | |
| 2938 | ACQV01000024.1 | GCA000175275_00709 | CDS | open | 116387-116710 | _na 107_aa | Guanidinium exporter | |
| 2939 | ACQV01000024.1 | GCA000175275_00710 | CDS | open | 117236-117742 | _na 168_aa | hypothetical protein | |
| 2940 | ACQV01000024.1 | GCA000175275_00711 | CDS | open | 117833-118420 | _na 195_aa | Membrane lipoprotein | |
| 2941 | ACQV01000024.1 | GCA000175275_00712 | CDS | open | 118548-118784 | _na 78_aa | Sulfite reductase subunit beta | |
| 2942 | ACQV01000024.1 | GCA000175275_00713 | CDS | open | 118943-119476 | _na 177_aa | ppa | Inorganic pyrophosphatase |
| 2943 | ACQV01000024.1 | GCA000175275_00714 | CDS | open | 119561-120025 | _na 154_aa | nudB | dihydroneopterin triphosphate diphosphatase |
| 2944 | ACQV01000024.1 | GCA000175275_00715 | CDS | open | 120163-120816 | _na 217_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 2945 | ACQV01000024.1 | GCA000175275_00716 | CDS | open | 120936-121376 | _na 146_aa | Ribose 5-phosphate isomerase B | |
| 2946 | ACQV01000024.1 | GCA000175275_00717 | CDS | open | 121453-122013 | _na 186_aa | Ig-like domain-containing protein | |
| 2947 | ACQV01000024.1 | GCA000175275_00718 | CDS | open | 122097-123575 | _na 492_aa | T4 RNA ligase 1-like N-terminal domain-containing protein | |
| 2948 | ACQV01000024.1 | GCA000175275_00719 | CDS | open | 123664-125226 | _na 520_aa | 60 kDa SS-A/Ro ribonucleoprotein | |
| 2949 | ACQV01000024.1 | GCA000175275_00721 | CDS | open | 126345-127973 | _na 542_aa | rtcR | RNA repair transcriptional activator RtcR |
| 2950 | ACQV01000024.1 | GCA000175275_00722 | CDS | open | 128164-128991 | _na 275_aa | fghA | S-formylglutathione hydrolase |
| 2951 | ACQV01000024.1 | GCA000175275_00723 | CDS | open | 129000-130136 | _na 378_aa | frmA | S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase |
| 2952 | ACQV01000024.1 | GCA000175275_00724 | CDS | open | 132930-133223 | _na 97_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 2953 | ACQV01000024.1 | GCA000175275_00725 | CDS | open | 133298-134311 | _na 337_aa | cas1c | type I-C CRISPR-associated endonuclease Cas1c |
| 2954 | ACQV01000024.1 | GCA000175275_00726 | CDS | open | 134655-135212 | _na 185_aa | hypothetical protein | |
| 2955 | ACQV01000024.1 | GCA000175275_00727 | CDS | open | 135217-135873 | _na 218_aa | cas4 | CRISPR-associated protein Cas4 |
| 2956 | ACQV01000024.1 | GCA000175275_00728 | CDS | open | 135888-136754 | _na 288_aa | cas7c | type I-C CRISPR-associated protein Cas7/Csd2 |
| 2957 | ACQV01000024.1 | GCA000175275_00729 | CDS | open | 136766-138544 | _na 592_aa | cas8c | type I-C CRISPR-associated protein Cas8c/Csd1 |
| 2958 | ACQV01000024.1 | GCA000175275_00730 | CDS | open | 138541-139215 | _na 224_aa | cas5c | type I-C CRISPR-associated protein Cas5c |
| 2959 | ACQV01000024.1 | GCA000175275_00731 | CDS | open | 139301-140746 | _na 481_aa | AAA family ATPase | |
| 2960 | ACQV01000024.1 | GCA000175275_00732 | CDS | open | 140785-143073 | _na 762_aa | CRISPR-associated helicase/endonuclease Cas3 | |
| 2961 | ACQV01000024.1 | GCA000175275_00733 | CDS | open | 143195-144124 | _na 309_aa | pip | prolyl aminopeptidase |
| 2962 | ACQV01000024.1 | GCA000175275_00734 | CDS | open | 144249-144683 | _na 144_aa | yciA | acyl-CoA thioester hydrolase YciA |
| 2963 | ACQV01000024.1 | GCA000175275_00735 | CDS | open | 144930-145262 | _na 110_aa | formate/nitrite transporter family protein | |
| 2964 | ACQV01000024.1 | GCA000175275_00736 | CDS | open | 145275-145721 | _na 148_aa | Formate/nitrate transporter formate/nitrate transporter | |
| 2965 | ACQV01000024.1 | GCA000175275_00738 | CDS | open | 146110-147633 | _na 507_aa | Fumarate hydratase class I | |
| 2966 | ACQV01000024.1 | GCA000175275_00739 | CDS | open | 148488-149126 | _na 212_aa | forC | 2Fe-2S iron-sulfur cluster binding domain protein |
| 2967 | ACQV01000024.1 | GCA000175275_00740 | CDS | open | 149126-149314 | _na 62_aa | hypothetical protein | |
| 2968 | ACQV01000024.1 | GCA000175275_00741 | CDS | open | 149316-150755 | _na 479_aa | nadB | FAD-dependent oxidoreductase 2 FAD binding domain-containing protein |
| 2969 | ACQV01000024.1 | GCA000175275_00742 | CDS | open | 150752-151993 | _na 413_aa | nuoF | NADH dehydrogenase |
| 2970 | ACQV01000024.1 | GCA000175275_00743 | CDS | open | 152453-153880 | _na 475_aa | citT | Integral membrane transport protein |
| 2971 | ACQV01000024.1 | GCA000175275_00744 | CDS | open | 154000-155412 | _na 470_aa | trkA | Trk system potassium transporter TrkA |
| 2972 | ACQV01000024.1 | GCA000175275_00745 | CDS | open | 155490-156350 | _na 286_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 2973 | ACQV01000024.1 | GCA000175275_00746 | CDS | open | 156425-157555 | _na 376_aa | mpaA | Peptidase M14 carboxypeptidase A domain-containing protein |
| 2974 | ACQV01000024.1 | GCA000175275_00747 | CDS | open | 157730-158617 | _na 295_aa | Acetylglutamate kinase | |
| 2975 | ACQV01000024.1 | GCA000175275_00748 | CDS | open | 158680-158838 | _na 52_aa | hypothetical protein | |
| 2976 | ACQV01000024.1 | GCA000175275_00749 | CDS | open | 158879-160165 | _na 428_aa | eno | phosphopyruvate hydratase |
| 2977 | ACQV01000024.1 | GCA000175275_00750 | CDS | open | 160189-160464 | _na 91_aa | ftsB | cell division protein FtsB |
| 2978 | ACQV01000024.1 | GCA000175275_00751 | CDS | open | 160566-161057 | _na 163_aa | DUF1841 domain-containing protein | |
| 2979 | ACQV01000024.1 | GCA000175275_00752 | CDS | open | 161170-161877 | _na 235_aa | DUF541 domain-containing protein | |
| 2980 | ACQV01000024.1 | GCA000175275_00753 | CDS | open | 162437-164203 | _na 588_aa | putative P-loop ATPase | |
| 2981 | ACQV01000024.1 | GCA000175275_00754 | CDS | open | 164207-164947 | _na 246_aa | hypothetical protein | |
| 2982 | ACQV01000024.1 | GCA000175275_00755 | CDS | open | 164947-166263 | _na 438_aa | qatC | Qat anti-phage system QueC-like protein QatC |
| 2983 | ACQV01000024.1 | GCA000175275_00756 | CDS | open | 166260-166991 | _na 243_aa | qatD | Qat anti-phage system TatD family nuclease QatD |
| 2984 | ACQV01000024.1 | GCA000175275_00757 | CDS | open | 167004-167834 | _na 276_aa | insO | Integrase core domain protein |
| 2985 | ACQV01000024.1 | GCA000175275_00758 | CDS | open | 168106-168633 | _na 175_aa | ssb | Single-stranded DNA-binding protein |
| 2986 | ACQV01000024.1 | GCA000175275_00759 | CDS | open | 168635-170017 | _na 460_aa | MFS transporter | |
| 2987 | ACQV01000024.1 | GCA000175275_00760 | CDS | open | 170218-170841 | _na 207_aa | Lytic transglycosylase domain-containing protein | |
| 2988 | ACQV01000024.1 | GCA000175275_00761 | CDS | open | 171015-172523 | _na 502_aa | ppx | exopolyphosphatase |
| 2989 | ACQV01000024.1 | GCA000175275_00762 | CDS | open | 172611-172982 | _na 123_aa | rbfA | 30S ribosome-binding factor RbfA |
| 2990 | ACQV01000024.1 | GCA000175275_00763 | CDS | open | 173050-173964 | _na 304_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 2991 | ACQV01000024.1 | GCA000175275_00764 | CDS | open | 173987-174613 | _na 208_aa | NAD(P)H-hydrate epimerase | |
| 2992 | ACQV01000024.1 | GCA000175275_00765 | CDS | open | 174663-175022 | _na 119_aa | fluC | Fluoride-specific ion channel FluC |
| 2993 | ACQV01000024.1 | GCA000175275_00766 | CDS | open | 175106-175783 | _na 225_aa | Integral membrane protein | |
| 2994 | ACQV01000024.1 | GCA000175275_00767 | CDS | open | 175948-179001 | _na 1017_aa | ftsK | Cell division protein FtsK |
| 2995 | ACQV01000024.1 | GCA000175275_00768 | CDS | open | 179116-179850 | _na 244_aa | aqpZ | aquaporin Z |
| 2996 | ACQV01000024.1 | GCA000175275_00769 | CDS | open | 179998-180330 | _na 110_aa | gspG | General secretion pathway protein GspG |
| 2997 | ACQV01000024.1 | GCA000175275_00770 | CDS | open | 180318-180596 | _na 92_aa | Stress responsive alpha-beta barrel | |
| 2998 | ACQV01000024.1 | GCA000175275_00771 | CDS | open | 180656-181330 | _na 224_aa | radC | DNA repair protein RadC |
| 2999 | ACQV01000024.1 | GCA000175275_00772 | CDS | open | 181368-182021 | _na 217_aa | tnp | IS1595 family ISEco2 transposase |
| 3000 | ACQV01000024.1 | GCA000175275_00773 | CDS | open | 182552-183676 | _na 374_aa | potA | Spermidine/putrescine import ATP-binding protein PotA |

