BAKTAGenome Explorer: Caldilinea aerophila (GCA_000281175.1)
Select a Genome:
|
BAKTA Annotations for GCA_000281175.1
|
Search & Sort all 8398 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | AP012337.1 | GCA000281175_02570 | gene | open | 3135687-3136095 | ssrA | ||
| 2 | AP012337.1 | GCA000281175_02570 | tmRNA | open | 3135687-3136095 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | AP012337.1 | GCA000281175_00235 | gene | open | 317352-317529 | 6S | ||
| 4 | AP012337.1 | GCA000281175_00325 | gene | open | 419703-419997 | 5_ureB_sRNA | ||
| 5 | AP012337.1 | GCA000281175_01044 | gene | open | 1275737-1277241 | rrs | ||
| 6 | AP012337.1 | GCA000281175_01046 | gene | open | 1278015-1280952 | rrl | ||
| 7 | AP012337.1 | GCA000281175_01047 | gene | open | 1281156-1281272 | rrf | ||
| 8 | AP012337.1 | GCA000281175_01354 | gene | open | 1657602-1657718 | rrf | ||
| 9 | AP012337.1 | GCA000281175_01355 | gene | open | 1657906-1660843 | rrl | ||
| 10 | AP012337.1 | GCA000281175_01357 | gene | open | 1661657-1663161 | rrs | ||
| 11 | AP012337.1 | GCA000281175_02561 | gene | open | 3129704-3129911 | Bacteria_large_SRP | ||
| 12 | AP012337.1 | GCA000281175_02562 | gene | open | 3129737-3129836 | Bacteria_small_SRP | ||
| 13 | AP012337.1 | GCA000281175_00235 | ncRNA | open | 317352-317529 | 6S / SsrS RNA | ||
| 14 | AP012337.1 | GCA000281175_00325 | ncRNA | open | 419703-419997 | 5' ureB small RNA | ||
| 15 | AP012337.1 | GCA000281175_02561 | ncRNA | open | 3129704-3129911 | Bacterial large signal recognition particle RNA | ||
| 16 | AP012337.1 | GCA000281175_02562 | ncRNA | open | 3129737-3129836 | Bacterial small signal recognition particle RNA | ||
| 17 | AP012337.1 | regulatory_region | open | 1273386-1273502 | SAM riboswitch aptamer (S box leader) | |||
| 18 | AP012337.1 | regulatory_region | open | 1408209-1408305 | ZMP/ZTP riboswitch aptamer (pfl RNA motif) | |||
| 19 | AP012337.1 | regulatory_region | open | 2091847-2092021 | Cobalamin riboswitch aptamer | |||
| 20 | AP012337.1 | regulatory_region | open | 2162283-2162406 | SAM riboswitch aptamer (S box leader) | |||
| 21 | AP012337.1 | regulatory_region | open | 2643086-2643146 | Fluoride riboswitch aptamer (crcB RNA motif) | |||
| 22 | AP012337.1 | regulatory_region | open | 2878614-2878721 | TPP riboswitch aptamer (THI element) | |||
| 23 | AP012337.1 | regulatory_region | open | 2992554-2992791 | Cobalamin riboswitch aptamer | |||
| 24 | AP012337.1 | regulatory_region | open | 3836858-3837158 | T-box leader | |||
| 25 | AP012337.1 | regulatory_region | open | 4178089-4178272 | Cobalamin riboswitch aptamer | |||
| 26 | AP012337.1 | regulatory_region | open | 4606750-4606862 | TPP riboswitch aptamer (THI element) | |||
| 27 | AP012337.1 | regulatory_region | open | 4641111-4641400 | T-box leader | |||
| 28 | AP012337.1 | regulatory_region | open | 4907491-4907590 | Glycine riboswitch aptamer | |||
| 29 | AP012337.1 | regulatory_region | open | 4907592-4907701 | Glycine riboswitch aptamer | |||
| 30 | AP012337.1 | GCA000281175_01044 | rRNA | open | 1275737-1277241 | rrs | 16S ribosomal RNA | |
| 31 | AP012337.1 | GCA000281175_01046 | rRNA | open | 1278015-1280952 | rrl | 23S ribosomal RNA | |
| 32 | AP012337.1 | GCA000281175_01047 | rRNA | open | 1281156-1281272 | rrf | 5S ribosomal RNA | |
| 33 | AP012337.1 | GCA000281175_01354 | rRNA | open | 1657602-1657718 | rrf | 5S ribosomal RNA | |
| 34 | AP012337.1 | GCA000281175_01355 | rRNA | open | 1657906-1660843 | rrl | 23S ribosomal RNA | |
| 35 | AP012337.1 | GCA000281175_01357 | rRNA | open | 1661657-1663161 | rrs | 16S ribosomal RNA | |
| 36 | AP012337.1 | repeat_region | open | 1517528-1520207 | CRISPR array with 35 repeats of length 37%2C consensus sequence GTCTTAATCCCCTGGCGAGGATTCGCTGTCTTCTGAC and spacer length 40 | |||
| 37 | AP012337.1 | repeat_region | open | 1524823-1526963 | CRISPR array with 28 repeats of length 37%2C consensus sequence GTCTTAATCCCCTGGCGAGGATTCGCTGTCTTCTGAC and spacer length 40 | |||
| 38 | AP012337.1 | repeat_region | open | 1527071-1527356 | CRISPR array with 4 repeats of length 38%2C consensus sequence CGTCTTAATCCCCTGGCGAGGATTCGCTGTCTTCTGAC and spacer length 41 | |||
| 39 | AP012337.1 | repeat_region | open | 1527542-1530286 | CRISPR array with 36 repeats of length 37%2C consensus sequence GTCTTAATCCCCTGGCGAGGATTCGCTGTCTTCTGAC and spacer length 40 | |||
| 40 | AP012337.1 | repeat_region | open | 1976690-1977176 | CRISPR array with 7 repeats of length 37%2C consensus sequence GTCTGAAGAAACGATCCAACAGCGAGGATACTGAAAG and spacer length 36 | |||
| 41 | AP012337.1 | repeat_region | open | 1977274-1977545 | CRISPR array with 4 repeats of length 39%2C consensus sequence GCGTCTGAAGAAACGATCCAACAGCGAGGATACTGAAAG and spacer length 35 | |||
| 42 | AP012337.1 | repeat_region | open | 1977645-1981929 | CRISPR array with 59 repeats of length 37%2C consensus sequence GTCTGAAGAAACGATCCAACAGCGAGGATACTGAAAG and spacer length 36 | |||
| 43 | AP012337.1 | repeat_region | open | 1982029-2000584 | CRISPR array with 255 repeats of length 37%2C consensus sequence GTCTGAAGAAACGATCCAACAGCGAGGATACTGAAAG and spacer length 35 | |||
| 44 | AP012337.1 | repeat_region | open | 2000681-2011850 | CRISPR array with 153 repeats of length 37%2C consensus sequence GTCTGAAGAAACGATCCAACAGCGAGGATACTGAAAG and spacer length 36 | |||
| 45 | AP012337.1 | repeat_region | open | 2013095-2018944 | CRISPR array with 59 repeats of length 37%2C consensus sequence GTCTGAAGAAACGATCCAACAGCGAGGATACTGAAAG and spacer length 36 | |||
| 46 | AP012337.1 | repeat_region | open | 2017409-2018944 | CRISPR array with 21 repeats of length 37%2C consensus sequence GTCTGAAGAAACGATCCAACAGCGAGGATACTGAAAG and spacer length 36 | |||
| 47 | AP012337.1 | GCA000281175_00001 | CDS | open | 1-1380 | _na 459_aa | dnaA | chromosomal replication initiator protein DnaA |
| 48 | AP012337.1 | GCA000281175_00002 | CDS | open | 1563-2591 | _na 342_aa | recA | recombinase RecA |
| 49 | AP012337.1 | GCA000281175_00003 | CDS | open | 2893-4461 | _na 522_aa | rny | ribonuclease Y |
| 50 | AP012337.1 | GCA000281175_00004 | CDS | open | 4531-5973 | _na 480_aa | lutB | LutB/LldF family L-lactate oxidation iron-sulfur protein |
| 51 | AP012337.1 | GCA000281175_00005 | CDS | open | 6077-6823 | _na 248_aa | gpmA | 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase |
| 52 | AP012337.1 | GCA000281175_00006 | CDS | open | 6945-7838 | _na 297_aa | degQ | PDZ domain-containing protein |
| 53 | AP012337.1 | GCA000281175_00007 | CDS | open | 8068-8613 | _na 181_aa | yceI | Lipid/polyisoprenoid-binding YceI-like domain-containing protein |
| 54 | AP012337.1 | GCA000281175_00008 | CDS | open | 8717-9958 | _na 413_aa | csdA | Cysteine desulphurase family protein |
| 55 | AP012337.1 | GCA000281175_00009 | CDS | open | 9972-11210 | _na 412_aa | hypothetical protein | |
| 56 | AP012337.1 | GCA000281175_00010 | CDS | open | 11233-13137 | _na 634_aa | sppA | Putative signal peptide peptidase |
| 57 | AP012337.1 | GCA000281175_00011 | CDS | open | 13272-14381 | _na 369_aa | ald | alanine dehydrogenase |
| 58 | AP012337.1 | GCA000281175_00012 | CDS | open | 14557-15927 | _na 456_aa | hisS | histidine--tRNA ligase |
| 59 | AP012337.1 | GCA000281175_00013 | CDS | open | 16092-16382 | _na 96_aa | NIPSNAP domain-containing protein | |
| 60 | AP012337.1 | GCA000281175_00014 | CDS | open | 16389-17105 | _na 238_aa | DUF4347 domain-containing protein | |
| 61 | AP012337.1 | GCA000281175_00015 | CDS | open | 17290-19932 | _na 880_aa | crp | Cyclic nucleotide-binding domain-containing protein |
| 62 | AP012337.1 | GCA000281175_00016 | CDS | open | 20046-21446 | _na 466_aa | ygiM | Peptidase M23 family protein |
| 63 | AP012337.1 | GCA000281175_00018 | CDS | open | 21949-22572 | _na 207_aa | rpoE | Putative RNA polymerase ECF-type sigma factor |
| 64 | AP012337.1 | GCA000281175_00019 | CDS | open | 22626-23996 | _na 456_aa | Zinc-finger domain-containing protein | |
| 65 | AP012337.1 | GCA000281175_00020 | CDS | open | 24023-24853 | _na 276_aa | mutM | bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase |
| 66 | AP012337.1 | GCA000281175_00021 | CDS | open | 25025-25240 | _na 71_aa | ytxH | YtxH domain-containing protein |
| 67 | AP012337.1 | GCA000281175_00022 | CDS | open | 25507-26280 | _na 257_aa | pspC | Phage shock protein PspC N-terminal domain-containing protein |
| 68 | AP012337.1 | GCA000281175_00023 | CDS | open | 26531-27568 | _na 345_aa | uve | UV DNA damage endonuclease |
| 69 | AP012337.1 | GCA000281175_00024 | CDS | open | 27686-28996 | _na 436_aa | argD | alanine--glyoxylate transaminase |
| 70 | AP012337.1 | GCA000281175_00025 | CDS | open | 29046-29789 | _na 247_aa | xdhC | Xanthine dehydrogenase |
| 71 | AP012337.1 | GCA000281175_00026 | CDS | open | 29900-30214 | _na 104_aa | xdhC | XdhC- CoxI domain-containing protein |
| 72 | AP012337.1 | GCA000281175_00027 | CDS | open | 30229-31773 | _na 514_aa | hMG1 | hydroxymethylglutaryl-CoA reductase (NADPH) |
| 73 | AP012337.1 | GCA000281175_00028 | CDS | open | 32047-33540 | _na 497_aa | xylB | xylulokinase |
| 74 | AP012337.1 | GCA000281175_00029 | CDS | open | 34170-34994 | _na 274_aa | tauC | Putative ABC transporter permease protein |
| 75 | AP012337.1 | GCA000281175_00030 | CDS | open | 35037-36077 | _na 346_aa | tauA | SsuA/THI5-like domain-containing protein |
| 76 | AP012337.1 | GCA000281175_00031 | CDS | open | 36154-36945 | _na 263_aa | tauB | Putative ABC transporter ATP-binding protein |
| 77 | AP012337.1 | GCA000281175_00032 | CDS | open | 36954-38315 | _na 453_aa | bglB | GH1 family beta-glucosidase |
| 78 | AP012337.1 | GCA000281175_00033 | CDS | open | 38725-38943 | _na 72_aa | tatA | Sec-independent protein translocase protein TatA |
| 79 | AP012337.1 | GCA000281175_00034 | CDS | open | 39215-41110 | _na 631_aa | recN | DNA repair protein RecN |
| 80 | AP012337.1 | GCA000281175_00035 | CDS | open | 41160-42005 | _na 281_aa | Methyltransferase type 11 domain-containing protein | |
| 81 | AP012337.1 | GCA000281175_00036 | CDS | open | 42214-43857 | _na 547_aa | pgm | phosphoglucomutase (alpha-D-glucose-1%2C6-bisphosphate-dependent) |
| 82 | AP012337.1 | GCA000281175_00037 | CDS | open | 43889-45178 | _na 429_aa | aCH1 | Acetyl-CoA hydrolase/transferase family protein |
| 83 | AP012337.1 | GCA000281175_00038 | CDS | open | 45175-45837 | _na 220_aa | N-acetyltransferase domain-containing protein | |
| 84 | AP012337.1 | GCA000281175_00039 | CDS | open | 45922-46482 | _na 186_aa | yjhB | Putative ADP-ribose pyrophosphatase |
| 85 | AP012337.1 | GCA000281175_00040 | CDS | open | 46454-47578 | _na 374_aa | NAD-dependent epimerase/dehydratase family protein | |
| 86 | AP012337.1 | GCA000281175_00041 | CDS | open | 47606-48091 | _na 161_aa | hypothetical protein | |
| 87 | AP012337.1 | GCA000281175_00042 | CDS | open | 48231-49112 | _na 293_aa | yqjQ | NADP-dependent 3-hydroxy acid dehydrogenase YdfG |
| 88 | AP012337.1 | GCA000281175_00043 | CDS | open | 49165-50157 | _na 330_aa | DUF5107 domain-containing protein | |
| 89 | AP012337.1 | GCA000281175_00044 | CDS | open | 50197-50967 | _na 256_aa | fabG | Putative oxidoreductase |
| 90 | AP012337.1 | GCA000281175_00045 | CDS | open | 50950-52020 | _na 356_aa | yliI | Putative dehydrogenase |
| 91 | AP012337.1 | GCA000281175_00046 | CDS | open | 52017-52919 | _na 300_aa | sseA | Putative sulfurtransferase |
| 92 | AP012337.1 | GCA000281175_00047 | CDS | open | 52966-54870 | _na 634_aa | dAP2 | Peptidase S9 family protein |
| 93 | AP012337.1 | GCA000281175_00048 | CDS | open | 55450-55728 | _na 92_aa | moaD | Putative sulfur carrier protein |
| 94 | AP012337.1 | GCA000281175_00049 | CDS | open | 55732-56952 | _na 406_aa | moeB | molybdopterin-synthase adenylyltransferase MoeB |
| 95 | AP012337.1 | GCA000281175_00050 | CDS | open | 57034-57969 | _na 311_aa | cysK | Cysteine synthase B |
| 96 | AP012337.1 | GCA000281175_00051 | CDS | open | 58021-58518 | _na 165_aa | DUF4395 domain-containing protein | |
| 97 | AP012337.1 | GCA000281175_00052 | CDS | open | 58522-58932 | _na 136_aa | trxA | Thioredoxin-like fold domain-containing protein |
| 98 | AP012337.1 | GCA000281175_00053 | CDS | open | 58944-60347 | _na 467_aa | ssnA | Putative hydrolase |
| 99 | AP012337.1 | GCA000281175_00054 | CDS | open | 60366-60548 | _na 60_aa | Transposase | |
| 100 | AP012337.1 | GCA000281175_00055 | CDS | open | 60646-66750 | _na 2034_aa | yfaS | Alpha-2-macroglobulin |
| 101 | AP012337.1 | GCA000281175_00056 | CDS | open | 66874-71694 | _na 1606_aa | kinE | histidine kinase |
| 102 | AP012337.1 | GCA000281175_00057 | CDS | open | 72008-72733 | _na 241_aa | DUF981 domain-containing protein | |
| 103 | AP012337.1 | GCA000281175_00058 | CDS | open | 73164-74129 | _na 321_aa | mch | methenyltetrahydromethanopterin cyclohydrolase |
| 104 | AP012337.1 | GCA000281175_00059 | CDS | open | 74170-74952 | _na 260_aa | fabG | Glucose 1-dehydrogenase |
| 105 | AP012337.1 | GCA000281175_00060 | CDS | open | 75019-75729 | _na 236_aa | aceF | Putative acetoin dehydrogenase E2 component |
| 106 | AP012337.1 | GCA000281175_00061 | CDS | open | 75737-76009 | _na 90_aa | aceF | Biotin attachment protein |
| 107 | AP012337.1 | GCA000281175_00062 | CDS | open | 76070-77059 | _na 329_aa | acoB | Acetoin dehydrogenase E1 component beta subunit |
| 108 | AP012337.1 | GCA000281175_00063 | CDS | open | 77056-78039 | _na 327_aa | acoA | Acetoin dehydrogenase E1 component alpha subunit |
| 109 | AP012337.1 | GCA000281175_00064 | CDS | open | 78314-81253 | _na 979_aa | cutS | Xanthine dehydrogenase |
| 110 | AP012337.1 | GCA000281175_00065 | CDS | open | 81250-82062 | _na 270_aa | cutB | FAD-binding PCMH-type domain-containing protein |
| 111 | AP012337.1 | GCA000281175_00066 | CDS | open | 82215-82826 | _na 203_aa | qdoI | Putative DNA-binding protein |
| 112 | AP012337.1 | GCA000281175_00067 | CDS | open | 82989-85058 | _na 689_aa | ptrB | Protease II |
| 113 | AP012337.1 | GCA000281175_00068 | CDS | open | 85148-86446 | _na 432_aa | mpfA | HlyC/CorC family transporter |
| 114 | AP012337.1 | GCA000281175_00069 | CDS | open | 86489-87448 | _na 319_aa | ilvA | threonine/serine dehydratase |
| 115 | AP012337.1 | GCA000281175_00070 | CDS | open | 87775-88443 | _na 222_aa | rimL | Putative acetyltransferase |
| 116 | AP012337.1 | GCA000281175_00071 | CDS | open | 88430-89113 | _na 227_aa | ubiG | Methyltransferase domain-containing protein |
| 117 | AP012337.1 | GCA000281175_00072 | CDS | open | 89110-89892 | _na 260_aa | ubiG | Putative methyltransferase |
| 118 | AP012337.1 | GCA000281175_00073 | CDS | open | 89901-91436 | _na 511_aa | gppA | Putative exopolyphosphatase |
| 119 | AP012337.1 | GCA000281175_00074 | CDS | open | 91812-92471 | _na 219_aa | rpoE | Putative RNA polymerase ECF-type sigma factor |
| 120 | AP012337.1 | GCA000281175_00075 | CDS | open | 92652-93263 | _na 203_aa | Carboxypeptidase regulatory-like domain-containing protein | |
| 121 | AP012337.1 | GCA000281175_00076 | CDS | open | 93264-96191 | _na 975_aa | CHAT domain-containing protein | |
| 122 | AP012337.1 | GCA000281175_00077 | CDS | open | 96314-97963 | _na 549_aa | aprE | Peptidase S8/S53 domain-containing protein |
| 123 | AP012337.1 | GCA000281175_00078 | CDS | open | 97960-115443 | _na 5827_aa | cARDB | DUF11 domain-containing protein |
| 124 | AP012337.1 | GCA000281175_00079 | CDS | open | 115464-116813 | _na 449_aa | tlpA | TlpA family protein disulfide reductase |
| 125 | AP012337.1 | GCA000281175_00080 | CDS | open | 117368-118198 | _na 276_aa | pstB | phosphate ABC transporter ATP-binding protein PstB |
| 126 | AP012337.1 | GCA000281175_00081 | CDS | open | 118208-119125 | _na 305_aa | pstA | phosphate ABC transporter permease PstA |
| 127 | AP012337.1 | GCA000281175_00082 | CDS | open | 119122-120063 | _na 313_aa | pstC | phosphate ABC transporter permease subunit PstC |
| 128 | AP012337.1 | GCA000281175_00083 | CDS | open | 120312-121373 | _na 353_aa | pstS | Phosphate-binding protein |
| 129 | AP012337.1 | GCA000281175_00084 | CDS | open | 121527-123062 | _na 511_aa | walK | histidine kinase |
| 130 | AP012337.1 | GCA000281175_00085 | CDS | open | 123277-123996 | _na 239_aa | ompR | Putative OmpR family two-component response regulator |
| 131 | AP012337.1 | GCA000281175_00086 | CDS | open | 124253-124951 | _na 232_aa | bcsA | Putative glycosyltransferase |
| 132 | AP012337.1 | GCA000281175_00087 | CDS | open | 124955-126157 | _na 400_aa | rfaB | Mannosyltransferase MgtA |
| 133 | AP012337.1 | GCA000281175_00088 | CDS | open | 126422-126757 | _na 111_aa | rpnC | Putative transposase |
| 134 | AP012337.1 | GCA000281175_00089 | CDS | open | 126808-127056 | _na 82_aa | Transposase | |
| 135 | AP012337.1 | GCA000281175_00090 | CDS | open | 127187-128686 | _na 499_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 136 | AP012337.1 | GCA000281175_00091 | CDS | open | 128785-131406 | _na 873_aa | ybgF | tol-pal system protein YbgF |
| 137 | AP012337.1 | GCA000281175_00092 | CDS | open | 131634-132509 | _na 291_aa | ugpE | Putative ABC transporter permease protein |
| 138 | AP012337.1 | GCA000281175_00093 | CDS | open | 132521-133411 | _na 296_aa | lplB | Putative ABC transporter permease protein |
| 139 | AP012337.1 | GCA000281175_00094 | CDS | open | 133532-135220 | _na 562_aa | ugpB | Extracellular solute-binding protein |
| 140 | AP012337.1 | GCA000281175_00095 | CDS | open | 135597-135953 | _na 118_aa | hinT | HIT family protein |
| 141 | AP012337.1 | GCA000281175_00096 | CDS | open | 135996-138266 | _na 756_aa | coxL | Carbon monoxide dehydrogenase molybdoprotein family protein |
| 142 | AP012337.1 | GCA000281175_00097 | CDS | open | 138266-139003 | _na 245_aa | yfcE | Putative phosphoesterase |
| 143 | AP012337.1 | GCA000281175_00098 | CDS | open | 139000-139983 | _na 327_aa | mviM | Putative oxidoreductase |
| 144 | AP012337.1 | GCA000281175_00099 | CDS | open | 140089-141345 | _na 418_aa | gsh2 | glutamate--cysteine ligase |
| 145 | AP012337.1 | GCA000281175_00100 | CDS | open | 141486-146189 | _na 1567_aa | kinE | histidine kinase |
| 146 | AP012337.1 | GCA000281175_00101 | CDS | open | 146471-146905 | _na 144_aa | Zinc ribbon domain-containing protein | |
| 147 | AP012337.1 | GCA000281175_00102 | CDS | open | 147098-148438 | _na 446_aa | yqeC | selenium cofactor biosynthesis protein YqeC |
| 148 | AP012337.1 | GCA000281175_00103 | CDS | open | 148528-150345 | _na 605_aa | ykwD | SCP domain-containing protein |
| 149 | AP012337.1 | GCA000281175_00104 | CDS | open | 150496-151560 | _na 354_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 150 | AP012337.1 | GCA000281175_00105 | CDS | open | 151667-152806 | _na 379_aa | tsaD | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD |
| 151 | AP012337.1 | GCA000281175_00106 | CDS | open | 153156-154676 | _na 506_aa | Peptidase M48 domain-containing protein | |
| 152 | AP012337.1 | GCA000281175_00107 | CDS | open | 154687-156882 | _na 731_aa | Bacillopeptidase F%2C M6 metalloprotease family | |
| 153 | AP012337.1 | GCA000281175_00108 | CDS | open | 156891-160646 | _na 1251_aa | yvrE | PA14 domain-containing protein |
| 154 | AP012337.1 | GCA000281175_00109 | CDS | open | 160677-162527 | _na 616_aa | capA | Capsule synthesis protein CapA domain-containing protein |
| 155 | AP012337.1 | GCA000281175_00110 | CDS | open | 162787-164346 | _na 519_aa | murJ | murein biosynthesis integral membrane protein MurJ |
| 156 | AP012337.1 | GCA000281175_00111 | CDS | open | 164627-165313 | _na 228_aa | yugP | Zinc metallopeptidase |
| 157 | AP012337.1 | GCA000281175_00112 | CDS | open | 165421-166965 | _na 514_aa | lysS | lysine--tRNA ligase |
| 158 | AP012337.1 | GCA000281175_00113 | CDS | open | 167007-167483 | _na 158_aa | greA | transcription elongation factor GreA |
| 159 | AP012337.1 | GCA000281175_00114 | CDS | open | 168411-169385 | _na 324_aa | dppB | Putative oligopeptide ABC transporter permease protein |
| 160 | AP012337.1 | GCA000281175_00115 | CDS | open | 169378-170298 | _na 306_aa | dppC | Putative oligopeptide ABC transporter permease protein |
| 161 | AP012337.1 | GCA000281175_00116 | CDS | open | 170377-172104 | _na 575_aa | ddpA | Putative oligopeptide ABC transporter substrate binding protein |
| 162 | AP012337.1 | GCA000281175_00117 | CDS | open | 172107-173723 | _na 538_aa | ytcJ | Amidohydrolase 3 domain-containing protein |
| 163 | AP012337.1 | GCA000281175_00118 | CDS | open | 173849-176533 | _na 894_aa | rfaL | O-antigen ligase-related domain-containing protein |
| 164 | AP012337.1 | GCA000281175_00119 | CDS | open | 176535-177965 | _na 476_aa | CHAT domain-containing protein | |
| 165 | AP012337.1 | GCA000281175_00120 | CDS | open | 178322-179233 | _na 303_aa | DUF5656 domain-containing protein | |
| 166 | AP012337.1 | GCA000281175_00121 | CDS | open | 179401-180117 | _na 238_aa | yveK | Polysaccharide chain length determinant N-terminal domain-containing protein |
| 167 | AP012337.1 | GCA000281175_00122 | CDS | open | 180133-182625 | _na 830_aa | DUF2079 domain-containing protein | |
| 168 | AP012337.1 | GCA000281175_00123 | CDS | open | 182622-183239 | _na 205_aa | mrp | Non-specific protein-tyrosine kinase |
| 169 | AP012337.1 | GCA000281175_00124 | CDS | open | 183317-184384 | _na 355_aa | rmlA1 | glucose-1-phosphate thymidylyltransferase |
| 170 | AP012337.1 | GCA000281175_00125 | CDS | open | 184385-185134 | _na 249_aa | hypothetical protein | |
| 171 | AP012337.1 | GCA000281175_00126 | CDS | open | 185204-186238 | _na 344_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 172 | AP012337.1 | GCA000281175_00127 | CDS | open | 186267-187535 | _na 422_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 173 | AP012337.1 | GCA000281175_00128 | CDS | open | 187532-188731 | _na 399_aa | abgB | Peptidase M20 family protein |
| 174 | AP012337.1 | GCA000281175_00129 | CDS | open | 189036-189494 | _na 152_aa | ibpA | Hsp20/alpha crystallin family protein |
| 175 | AP012337.1 | GCA000281175_00130 | CDS | open | 189815-190657 | _na 280_aa | Heparan-alpha-glucosaminide N-acetyltransferase catalytic domain-containing protein | |
| 176 | AP012337.1 | GCA000281175_00131 | CDS | open | 190788-191285 | _na 165_aa | DinB-like domain-containing protein | |
| 177 | AP012337.1 | GCA000281175_00132 | CDS | open | 191289-191603 | _na 104_aa | PDGLE domain-containing protein | |
| 178 | AP012337.1 | GCA000281175_00133 | CDS | open | 191600-192385 | _na 261_aa | DUF3891 domain-containing protein | |
| 179 | AP012337.1 | GCA000281175_00134 | CDS | open | 192394-193845 | _na 483_aa | cutS | Putative oxidoreductase |
| 180 | AP012337.1 | GCA000281175_00135 | CDS | open | 193880-194374 | _na 164_aa | purE | N5-carboxyaminoimidazole ribonucleotide mutase |
| 181 | AP012337.1 | GCA000281175_00136 | CDS | open | 194540-195706 | _na 388_aa | purK | 5-(carboxyamino)imidazole ribonucleotide synthase |
| 182 | AP012337.1 | GCA000281175_00137 | CDS | open | 195760-197208 | _na 482_aa | purF | amidophosphoribosyltransferase |
| 183 | AP012337.1 | GCA000281175_00138 | CDS | open | 197212-198003 | _na 263_aa | caiD | Enoyl-CoA hydratase |
| 184 | AP012337.1 | GCA000281175_00139 | CDS | open | 198251-198805 | _na 184_aa | 2-amino-thiazoline-4-carboxylic acid hydrolase | |
| 185 | AP012337.1 | GCA000281175_00140 | CDS | open | 198868-199629 | _na 253_aa | DUF429 domain-containing protein | |
| 186 | AP012337.1 | GCA000281175_00141 | CDS | open | 199631-200740 | _na 369_aa | lysM | Putative lysozyme |
| 187 | AP012337.1 | GCA000281175_00142 | CDS | open | 200870-201421 | _na 183_aa | Putative cytochrome c oxidase subunit II | |
| 188 | AP012337.1 | GCA000281175_00146 | CDS | open | 202175-203467 | _na 430_aa | eno | phosphopyruvate hydratase |
| 189 | AP012337.1 | GCA000281175_00147 | CDS | open | 203566-204333 | _na 255_aa | fabG | Putative 3-hydroxyacyl-CoA dehydrogenase |
| 190 | AP012337.1 | GCA000281175_00148 | CDS | open | 204358-205938 | _na 526_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 191 | AP012337.1 | GCA000281175_00149 | CDS | open | 206306-206575 | _na 89_aa | rpsO | 30S ribosomal protein S15 |
| 192 | AP012337.1 | GCA000281175_00150 | CDS | open | 206925-209195 | _na 756_aa | pnp | polyribonucleotide nucleotidyltransferase |
| 193 | AP012337.1 | GCA000281175_00151 | CDS | open | 209256-210803 | _na 515_aa | perM | AI-2E family transporter |
| 194 | AP012337.1 | GCA000281175_00152 | CDS | open | 211036-212016 | _na 326_aa | Putative dipeptidase | |
| 195 | AP012337.1 | GCA000281175_00153 | CDS | open | 212013-213212 | _na 399_aa | nurA | NurA domain-containing protein |
| 196 | AP012337.1 | GCA000281175_00154 | CDS | open | 213263-213907 | _na 214_aa | rri1 | Peptidase M67 family protein |
| 197 | AP012337.1 | GCA000281175_00155 | CDS | open | 213904-215010 | _na 368_aa | trxB | Pyridine nucleotide-disulfide oxidoreductase |
| 198 | AP012337.1 | GCA000281175_00156 | CDS | open | 215138-215365 | _na 75_aa | Transposase | |
| 199 | AP012337.1 | GCA000281175_00157 | CDS | open | 215416-215751 | _na 111_aa | rpnC | Putative transposase |
| 200 | AP012337.1 | GCA000281175_00158 | CDS | open | 216133-216765 | _na 210_aa | msrP | Oxidoreductase molybdopterin-binding domain-containing protein |
| 201 | AP012337.1 | GCA000281175_00159 | CDS | open | 216769-218127 | _na 452_aa | mtaB | tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB |
| 202 | AP012337.1 | GCA000281175_00160 | CDS | open | 218201-218704 | _na 167_aa | ykgJ | YkgJ family cysteine cluster protein |
| 203 | AP012337.1 | GCA000281175_00161 | CDS | open | 218967-219992 | _na 341_aa | Endonuclease/exonuclease/phosphatase domain-containing protein | |
| 204 | AP012337.1 | GCA000281175_00162 | CDS | open | 220032-221807 | _na 591_aa | ampC | Putative hydrolase |
| 205 | AP012337.1 | GCA000281175_00163 | CDS | open | 221935-222399 | _na 154_aa | ybbJ | NfeD-like C-terminal domain-containing protein |
| 206 | AP012337.1 | GCA000281175_00164 | CDS | open | 222444-223391 | _na 315_aa | hflC | Band 7 domain-containing protein |
| 207 | AP012337.1 | GCA000281175_00165 | CDS | open | 223491-224309 | _na 272_aa | pflX | Radical SAM core domain-containing protein |
| 208 | AP012337.1 | GCA000281175_00166 | CDS | open | 224306-226507 | _na 733_aa | 4Fe-4S ferredoxin-type domain-containing protein | |
| 209 | AP012337.1 | GCA000281175_00167 | CDS | open | 226670-227590 | _na 306_aa | xerD | Tyrosine recombinase XerD |
| 210 | AP012337.1 | GCA000281175_00168 | CDS | open | 227580-228350 | _na 256_aa | fabG | Putative oxidoreductase |
| 211 | AP012337.1 | GCA000281175_00169 | CDS | open | 228370-229446 | _na 358_aa | yigB | Putative pyrophosphatase |
| 212 | AP012337.1 | GCA000281175_00170 | CDS | open | 229466-229963 | _na 165_aa | yjhB | Putative hydrolase |
| 213 | AP012337.1 | GCA000281175_00171 | CDS | open | 229955-230875 | _na 306_aa | rbsK | ribokinase |
| 214 | AP012337.1 | GCA000281175_00172 | CDS | open | 231096-232406 | _na 436_aa | murA | UDP-N-acetylglucosamine 1-carboxyvinyltransferase |
| 215 | AP012337.1 | GCA000281175_00173 | CDS | open | 232842-233729 | _na 295_aa | Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein | |
| 216 | AP012337.1 | GCA000281175_00174 | CDS | open | 233815-235764 | _na 649_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 217 | AP012337.1 | GCA000281175_00175 | CDS | open | 236068-237249 | _na 393_aa | eutG | Alcohol dehydrogenase |
| 218 | AP012337.1 | GCA000281175_00176 | CDS | open | 237263-238387 | _na 374_aa | rspA | Putative mandelate racemase |
| 219 | AP012337.1 | GCA000281175_00177 | CDS | open | 238473-239480 | _na 335_aa | aglD2 | Flippase-like domain-containing protein |
| 220 | AP012337.1 | GCA000281175_00178 | CDS | open | 239565-240995 | _na 476_aa | gdhA | Glutamate dehydrogenase |
| 221 | AP012337.1 | GCA000281175_00179 | CDS | open | 241243-242625 | _na 460_aa | secD | Protein translocase subunit SecD |
| 222 | AP012337.1 | GCA000281175_00180 | CDS | open | 242677-243624 | _na 315_aa | secF | Protein-export membrane protein SecF |
| 223 | AP012337.1 | GCA000281175_00181 | CDS | open | 243682-244659 | _na 325_aa | tdh | alcohol dehydrogenase catalytic domain-containing protein |
| 224 | AP012337.1 | GCA000281175_00182 | CDS | open | 244739-245602 | _na 287_aa | rsuA | Pseudouridine synthase |
| 225 | AP012337.1 | GCA000281175_00183 | CDS | open | 245616-246377 | _na 253_aa | cmk | (d)CMP kinase |
| 226 | AP012337.1 | GCA000281175_00184 | CDS | open | 246397-247377 | _na 326_aa | acoA | Acetoin dehydrogenase E1 component alpha subunit |
| 227 | AP012337.1 | GCA000281175_00185 | CDS | open | 247383-248426 | _na 347_aa | acoB | 2-oxoisovalerate dehydrogenase beta subunit |
| 228 | AP012337.1 | GCA000281175_00186 | CDS | open | 248480-249301 | _na 273_aa | natB | ABC transporter permease |
| 229 | AP012337.1 | GCA000281175_00187 | CDS | open | 249301-250260 | _na 319_aa | rbbA | Putative ABC transporter ATP-binding protein |
| 230 | AP012337.1 | GCA000281175_00188 | CDS | open | 250383-252986 | _na 867_aa | Carbohydrate-binding domain-containing protein | |
| 231 | AP012337.1 | GCA000281175_00189 | CDS | open | 253040-254152 | _na 370_aa | xynA | Endo-1%2C4-beta-xylanase%2C GH35 family |
| 232 | AP012337.1 | GCA000281175_00190 | CDS | open | 254113-254994 | _na 293_aa | hisJ | Amino acid ABC transporter substrate-binding protein |
| 233 | AP012337.1 | GCA000281175_00191 | CDS | open | 254991-255920 | _na 309_aa | cpdA | Calcineurin-like phosphoesterase domain-containing protein |
| 234 | AP012337.1 | GCA000281175_00192 | CDS | open | 256139-258598 | _na 819_aa | lonB | endopeptidase La |
| 235 | AP012337.1 | GCA000281175_00193 | CDS | open | 258641-259444 | _na 267_aa | uspA | UspA domain-containing protein |
| 236 | AP012337.1 | GCA000281175_00194 | CDS | open | 259475-261739 | _na 754_aa | Glycosyltransferase RgtA/B/C/D-like domain-containing protein | |
| 237 | AP012337.1 | GCA000281175_00195 | CDS | open | 261736-263793 | _na 685_aa | putative membrane protein PF0508%2C contains N-terminal glycosyltransferase domain of PMT family | |
| 238 | AP012337.1 | GCA000281175_00196 | CDS | open | 264062-266149 | _na 695_aa | arnT | Glycosyltransferase RgtA/B/C/D-like domain-containing protein |
| 239 | AP012337.1 | GCA000281175_00197 | CDS | open | 266124-267299 | _na 391_aa | rfaB | Putative glycosyltransferase |
| 240 | AP012337.1 | GCA000281175_00198 | CDS | open | 267303-268244 | _na 313_aa | N-acetyltransferase domain-containing protein | |
| 241 | AP012337.1 | GCA000281175_00199 | CDS | open | 268254-268688 | _na 144_aa | PH domain-containing protein | |
| 242 | AP012337.1 | GCA000281175_00200 | CDS | open | 268801-269424 | _na 207_aa | rhtB | LysE family translocator |
| 243 | AP012337.1 | GCA000281175_00201 | CDS | open | 269421-270668 | _na 415_aa | rfaB | Putative glycosyltransferase |
| 244 | AP012337.1 | GCA000281175_00202 | CDS | open | 270949-272880 | _na 643_aa | VCBS repeat-containing protein | |
| 245 | AP012337.1 | GCA000281175_00203 | CDS | open | 272877-275132 | _na 751_aa | wcaE | Putative glycosyltransferase |
| 246 | AP012337.1 | GCA000281175_00204 | CDS | open | 275146-275691 | _na 181_aa | hypothetical protein | |
| 247 | AP012337.1 | GCA000281175_00205 | CDS | open | 275816-277111 | _na 431_aa | Transposase IS4-like domain-containing protein | |
| 248 | AP012337.1 | GCA000281175_00206 | CDS | open | 277190-277696 | _na 168_aa | hypothetical protein | |
| 249 | AP012337.1 | GCA000281175_00207 | CDS | open | 277735-279861 | _na 708_aa | Glycosyltransferase RgtA/B/C/D-like domain-containing protein | |
| 250 | AP012337.1 | GCA000281175_00208 | CDS | open | 279827-281074 | _na 415_aa | rfaB | Putative glycosyltransferase |
| 251 | AP012337.1 | GCA000281175_00209 | CDS | open | 281067-282398 | _na 443_aa | wcaE | Putative glycosyltransferase |
| 252 | AP012337.1 | GCA000281175_00210 | CDS | open | 282695-283978 | _na 427_aa | tagH | Putative ABC transporter ATP-binding protein |
| 253 | AP012337.1 | GCA000281175_00211 | CDS | open | 284076-285332 | _na 418_aa | hypothetical protein | |
| 254 | AP012337.1 | GCA000281175_00212 | CDS | open | 285666-287270 | _na 534_aa | Glycosyltransferase RgtA/B/C/D-like domain-containing protein | |
| 255 | AP012337.1 | GCA000281175_00213 | CDS | open | 287279-288865 | _na 528_aa | CARDB domain-containing protein | |
| 256 | AP012337.1 | GCA000281175_00214 | CDS | open | 288907-290409 | _na 500_aa | Glycoside hydrolase family 5 protein | |
| 257 | AP012337.1 | GCA000281175_00215 | CDS | open | 290797-291954 | _na 385_aa | vgb | Streptogramin lyase |
| 258 | AP012337.1 | GCA000281175_00216 | CDS | open | 291980-292852 | _na 290_aa | tagG | Transport permease protein |
| 259 | AP012337.1 | GCA000281175_00217 | CDS | open | 292890-294194 | _na 434_aa | rfaB | Putative glycosyltransferase |
| 260 | AP012337.1 | GCA000281175_00218 | CDS | open | 294262-295737 | _na 491_aa | rfbX | Flippase |
| 261 | AP012337.1 | GCA000281175_00219 | CDS | open | 295755-296282 | _na 175_aa | Metal-dependent hydrolase | |
| 262 | AP012337.1 | GCA000281175_00220 | CDS | open | 296359-297309 | _na 316_aa | nupQ | Putative ABC transporter permease protein |
| 263 | AP012337.1 | GCA000281175_00221 | CDS | open | 297313-298431 | _na 372_aa | nupP | Putative ABC transporter permease protein |
| 264 | AP012337.1 | GCA000281175_00222 | CDS | open | 298451-300007 | _na 518_aa | nupO | Putative ABC transporter ATP-binding protein |
| 265 | AP012337.1 | GCA000281175_00223 | CDS | open | 300112-301365 | _na 417_aa | med | BMP family ABC transporter substrate-binding protein |
| 266 | AP012337.1 | GCA000281175_00224 | CDS | open | 301506-303893 | _na 795_aa | ftsN | FAS1 domain-containing protein |
| 267 | AP012337.1 | GCA000281175_00225 | CDS | open | 304298-304648 | _na 116_aa | 2Fe2S | 2Fe-2S ferredoxin |
| 268 | AP012337.1 | GCA000281175_00226 | CDS | open | 304667-305497 | _na 276_aa | yqxC | Putative hemolysin |
| 269 | AP012337.1 | GCA000281175_00227 | CDS | open | 305594-306517 | _na 307_aa | ubiA | decaprenyl-phosphate phosphoribosyltransferase |
| 270 | AP012337.1 | GCA000281175_00228 | CDS | open | 306629-308506 | _na 625_aa | Schlafen AlbA-2 domain-containing protein | |
| 271 | AP012337.1 | GCA000281175_00229 | CDS | open | 308849-311515 | _na 888_aa | lon | endopeptidase La |
| 272 | AP012337.1 | GCA000281175_00230 | CDS | open | 311665-312303 | _na 212_aa | ftcD | Putative formiminotransferase-cyclodeaminase |
| 273 | AP012337.1 | GCA000281175_00231 | CDS | open | 312300-313157 | _na 285_aa | folD | Bifunctional protein FolD |
| 274 | AP012337.1 | GCA000281175_00232 | CDS | open | 313218-315494 | _na 758_aa | yfhO | YfhO family protein |
| 275 | AP012337.1 | GCA000281175_00233 | CDS | open | 315512-316294 | _na 260_aa | hypothetical protein | |
| 276 | AP012337.1 | GCA000281175_00234 | CDS | open | 316291-317169 | _na 292_aa | gloB | Metallo-beta-lactamase domain-containing protein |
| 277 | AP012337.1 | GCA000281175_00236 | CDS | open | 317595-319400 | _na 601_aa | aspS | aspartate--tRNA ligase |
| 278 | AP012337.1 | GCA000281175_00237 | CDS | open | 319821-321335 | _na 504_aa | diacylglycerol O-acyltransferase | |
| 279 | AP012337.1 | GCA000281175_00238 | CDS | open | 321451-321804 | _na 117_aa | hypothetical protein | |
| 280 | AP012337.1 | GCA000281175_00239 | CDS | open | 321952-325293 | _na 1113_aa | hepA | Putative helicase |
| 281 | AP012337.1 | GCA000281175_00240 | CDS | open | 325316-326245 | _na 309_aa | putative protein%2C contains SWIM-type Zn finger domain | |
| 282 | AP012337.1 | GCA000281175_00241 | CDS | open | 326276-326866 | _na 196_aa | RHS repeat protein | |
| 283 | AP012337.1 | GCA000281175_00242 | CDS | open | 326980-327258 | _na 92_aa | hypothetical protein | |
| 284 | AP012337.1 | GCA000281175_00243 | CDS | open | 327268-328527 | _na 419_aa | RHS repeat-associated core domain-containing protein | |
| 285 | AP012337.1 | GCA000281175_00244 | CDS | open | 328694-329497 | _na 267_aa | IS630 family transposase | |
| 286 | AP012337.1 | GCA000281175_00245 | CDS | open | 329572-329844 | _na 90_aa | hypothetical protein | |
| 287 | AP012337.1 | GCA000281175_00246 | CDS | open | 329853-330890 | _na 345_aa | RHS repeat-associated core domain-containing protein | |
| 288 | AP012337.1 | GCA000281175_00247 | CDS | open | 331019-331300 | _na 93_aa | secE | Preprotein translocase subunit SecE |
| 289 | AP012337.1 | GCA000281175_00248 | CDS | open | 331306-333327 | _na 673_aa | rhsA | RHS repeat-associated core domain-containing protein |
| 290 | AP012337.1 | GCA000281175_00249 | CDS | open | 333385-333654 | _na 89_aa | Holin | |
| 291 | AP012337.1 | GCA000281175_00250 | CDS | open | 333654-334484 | _na 276_aa | RHS repeat-associated core domain-containing protein | |
| 292 | AP012337.1 | GCA000281175_00251 | CDS | open | 334669-335091 | _na 140_aa | hypothetical protein | |
| 293 | AP012337.1 | GCA000281175_00252 | CDS | open | 335420-335521 | _na 33_aa | hypothetical protein | |
| 294 | AP012337.1 | GCA000281175_00253 | CDS | open | 335522-336136 | _na 204_aa | Lipocalin-like domain-containing protein | |
| 295 | AP012337.1 | GCA000281175_00254 | CDS | open | 336133-337020 | _na 295_aa | RHS repeat-associated core domain-containing protein | |
| 296 | AP012337.1 | GCA000281175_00255 | CDS | open | 337368-338579 | _na 403_aa | RHS repeat-associated core domain-containing protein | |
| 297 | AP012337.1 | GCA000281175_00256 | CDS | open | 338770-339789 | _na 339_aa | GH18 domain-containing protein | |
| 298 | AP012337.1 | GCA000281175_00257 | CDS | open | 339786-340400 | _na 204_aa | Lipoprotein | |
| 299 | AP012337.1 | GCA000281175_00258 | CDS | open | 340397-342571 | _na 724_aa | rhsA | Carbamoyl-phosphate synthetase large subunit-like ATP-binding domain-containing protein |
| 300 | AP012337.1 | GCA000281175_00259 | CDS | open | 342568-345060 | _na 830_aa | RHS repeat protein | |
| 301 | AP012337.1 | GCA000281175_00260 | CDS | open | 345235-345828 | _na 197_aa | hypothetical protein | |
| 302 | AP012337.1 | GCA000281175_00261 | CDS | open | 345878-346363 | _na 161_aa | hypothetical protein | |
| 303 | AP012337.1 | GCA000281175_00262 | CDS | open | 346960-348255 | _na 431_aa | serS | serine--tRNA ligase |
| 304 | AP012337.1 | GCA000281175_00263 | CDS | open | 348563-349312 | _na 249_aa | cutC | PF03932 family protein CutC |
| 305 | AP012337.1 | GCA000281175_00264 | CDS | open | 349431-350507 | _na 358_aa | ruvB | Holliday junction branch migration DNA helicase RuvB |
| 306 | AP012337.1 | GCA000281175_00265 | CDS | open | 350517-351290 | _na 257_aa | hypothetical protein | |
| 307 | AP012337.1 | GCA000281175_00266 | CDS | open | 351265-351519 | _na 84_aa | MBL fold metallo-hydrolase | |
| 308 | AP012337.1 | GCA000281175_00267 | CDS | open | 351491-351685 | _na 64_aa | DUF2997 domain-containing protein | |
| 309 | AP012337.1 | GCA000281175_00268 | CDS | open | 351703-352077 | _na 124_aa | ycf35 | DUF1257 domain-containing protein |
| 310 | AP012337.1 | GCA000281175_00269 | CDS | open | 352090-353373 | _na 427_aa | glpC | Glycolate oxidase iron-sulfur subunit |
| 311 | AP012337.1 | GCA000281175_00270 | CDS | open | 353424-354554 | _na 376_aa | glcE | Glycolate oxidase subunit GlcE |
| 312 | AP012337.1 | GCA000281175_00271 | CDS | open | 354564-356012 | _na 482_aa | glcD | Glycolate oxidase subunit GlcD |
| 313 | AP012337.1 | GCA000281175_00272 | CDS | open | 356128-359037 | _na 969_aa | recQ | DNA helicase RecQ |
| 314 | AP012337.1 | GCA000281175_00273 | CDS | open | 359247-359747 | _na 166_aa | DUF488 domain-containing protein | |
| 315 | AP012337.1 | GCA000281175_00274 | CDS | open | 359848-360405 | _na 185_aa | DUF488 domain-containing protein | |
| 316 | AP012337.1 | GCA000281175_00275 | CDS | open | 360730-363378 | _na 882_aa | two-component regulator propeller domain-containing protein | |
| 317 | AP012337.1 | GCA000281175_00276 | CDS | open | 363383-364843 | _na 486_aa | guaB | IMP dehydrogenase |
| 318 | AP012337.1 | GCA000281175_00277 | CDS | open | 365032-367548 | _na 838_aa | glgB | 1%2C4-alpha-glucan branching protein GlgB |
| 319 | AP012337.1 | GCA000281175_00278 | CDS | open | 368042-369124 | _na 360_aa | ompR | histidine kinase |
| 320 | AP012337.1 | GCA000281175_00279 | CDS | open | 369081-370037 | _na 318_aa | mvk | mevalonate kinase |
| 321 | AP012337.1 | GCA000281175_00280 | CDS | open | 370058-370813 | _na 251_aa | ugpQ | Putative glycerophosphoryl diester phosphodiesterase |
| 322 | AP012337.1 | GCA000281175_00281 | CDS | open | 370837-371472 | _na 211_aa | mrr | Putative restriction endonuclease |
| 323 | AP012337.1 | GCA000281175_00282 | CDS | open | 371526-371936 | _na 136_aa | paaD | MIP18 family-like domain-containing protein |
| 324 | AP012337.1 | GCA000281175_00283 | CDS | open | 371944-372348 | _na 134_aa | mce | methylmalonyl-CoA epimerase |
| 325 | AP012337.1 | GCA000281175_00284 | CDS | open | 372622-374793 | _na 723_aa | galA | Putative alpha-galactosidase |
| 326 | AP012337.1 | GCA000281175_00285 | CDS | open | 374802-376832 | _na 676_aa | galA | Putative alpha-galactosidase |
| 327 | AP012337.1 | GCA000281175_00286 | CDS | open | 377128-378258 | _na 376_aa | tsaC | L-threonylcarbamoyladenylate synthase |
| 328 | AP012337.1 | GCA000281175_00287 | CDS | open | 378499-379044 | _na 181_aa | fldA | flavodoxin |
| 329 | AP012337.1 | GCA000281175_00288 | CDS | open | 379582-381543 | _na 653_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 330 | AP012337.1 | GCA000281175_00289 | CDS | open | 381607-382374 | _na 255_aa | DUF3137 domain-containing protein | |
| 331 | AP012337.1 | GCA000281175_00290 | CDS | open | 382393-382902 | _na 169_aa | comEB | Putative dCMP deaminase |
| 332 | AP012337.1 | GCA000281175_00291 | CDS | open | 382899-384272 | _na 457_aa | bglB | Putative glycoside hydrolase |
| 333 | AP012337.1 | GCA000281175_00292 | CDS | open | 384362-384880 | _na 172_aa | phaE | Poly(3-hydroxyalkanoate) polymerase subunit PhaE |
| 334 | AP012337.1 | GCA000281175_00293 | CDS | open | 384955-385788 | _na 277_aa | pldB | Alpha/beta hydrolase |
| 335 | AP012337.1 | GCA000281175_00294 | CDS | open | 385902-386312 | _na 136_aa | ybjN | YbjN domain-containing protein |
| 336 | AP012337.1 | GCA000281175_00295 | CDS | open | 386371-386961 | _na 196_aa | yciW | Carboxymuconolactone decarboxylase-like domain-containing protein |
| 337 | AP012337.1 | GCA000281175_00296 | CDS | open | 387191-387625 | _na 144_aa | hypothetical protein | |
| 338 | AP012337.1 | GCA000281175_00297 | CDS | open | 387889-389649 | _na 586_aa | pyk | pyruvate kinase |
| 339 | AP012337.1 | GCA000281175_00298 | CDS | open | 389722-391077 | _na 451_aa | btlA | Putative major facilitator superfamily transporter |
| 340 | AP012337.1 | GCA000281175_00299 | CDS | open | 391154-392476 | _na 440_aa | glyA | Serine hydroxymethyltransferase |
| 341 | AP012337.1 | GCA000281175_00300 | CDS | open | 392716-393744 | _na 342_aa | purR | Putative LacI family transcriptional regulator |
| 342 | AP012337.1 | GCA000281175_00301 | CDS | open | 393787-395739 | _na 650_aa | ddpA | Putative ABC transporter substrate binding protein |
| 343 | AP012337.1 | GCA000281175_00302 | CDS | open | 395888-396892 | _na 334_aa | dppB | Putative ABC transporter permease protein |
| 344 | AP012337.1 | GCA000281175_00303 | CDS | open | 396907-397761 | _na 284_aa | dppC | Putative ABC transporter permease protein |
| 345 | AP012337.1 | GCA000281175_00304 | CDS | open | 397764-398774 | _na 336_aa | dppD | Putative ABC transporter ATP-binding protein |
| 346 | AP012337.1 | GCA000281175_00305 | CDS | open | 398758-399720 | _na 320_aa | dppD | Putative ABC transporter ATP-binding protein |
| 347 | AP012337.1 | GCA000281175_00306 | CDS | open | 399699-399986 | _na 95_aa | hypothetical protein | |
| 348 | AP012337.1 | GCA000281175_00307 | CDS | open | 400060-402432 | _na 790_aa | bglX | Beta-xylosidase |
| 349 | AP012337.1 | GCA000281175_00308 | CDS | open | 402533-403027 | _na 164_aa | yfcE | Phosphoesterase |
| 350 | AP012337.1 | GCA000281175_00309 | CDS | open | 403098-404120 | _na 340_aa | lysM | LysM domain-containing protein |
| 351 | AP012337.1 | GCA000281175_00310 | CDS | open | 404343-405011 | _na 222_aa | srtA | Peptidase C60 family protein |
| 352 | AP012337.1 | GCA000281175_00311 | CDS | open | 405240-405512 | _na 90_aa | hypothetical protein | |
| 353 | AP012337.1 | GCA000281175_00312 | CDS | open | 406008-406973 | _na 321_aa | mviM | Putative oxidoreductase |
| 354 | AP012337.1 | GCA000281175_00313 | CDS | open | 407073-407498 | _na 141_aa | ugpE | Putative ABC transporter permease protein |
| 355 | AP012337.1 | GCA000281175_00314 | CDS | open | 407523-408437 | _na 304_aa | nagC | ROK family protein |
| 356 | AP012337.1 | GCA000281175_00315 | CDS | open | 408424-410112 | _na 562_aa | DUF4127 domain-containing protein | |
| 357 | AP012337.1 | GCA000281175_00316 | CDS | open | 410128-410835 | _na 235_aa | nanE | Putative N-acetylmannosamine-6-phosphate 2-epimerase |
| 358 | AP012337.1 | GCA000281175_00317 | CDS | open | 410862-411563 | _na 233_aa | mngR | Putative GntR family transcriptional regulator |
| 359 | AP012337.1 | GCA000281175_00318 | CDS | open | 411873-412565 | _na 230_aa | ureG | urease accessory protein UreG |
| 360 | AP012337.1 | GCA000281175_00319 | CDS | open | 412658-413365 | _na 235_aa | urtE | urea ABC transporter ATP-binding subunit UrtE |
| 361 | AP012337.1 | GCA000281175_00320 | CDS | open | 413441-414217 | _na 258_aa | urtD | urea ABC transporter ATP-binding protein UrtD |
| 362 | AP012337.1 | GCA000281175_00321 | CDS | open | 414220-415350 | _na 376_aa | urtC | urea ABC transporter permease subunit UrtC |
| 363 | AP012337.1 | GCA000281175_00322 | CDS | open | 415417-416313 | _na 298_aa | urtB | urea ABC transporter permease subunit UrtB |
| 364 | AP012337.1 | GCA000281175_00323 | CDS | open | 416438-417745 | _na 435_aa | urtA | urea ABC transporter substrate-binding protein |
| 365 | AP012337.1 | GCA000281175_00324 | CDS | open | 418435-420150 | _na 571_aa | ureC | urease subunit alpha |
| 366 | AP012337.1 | GCA000281175_00326 | CDS | open | 420157-420555 | _na 132_aa | ureB | urease subunit beta |
| 367 | AP012337.1 | GCA000281175_00327 | CDS | open | 420581-420883 | _na 100_aa | ureA | urease subunit gamma |
| 368 | AP012337.1 | GCA000281175_00328 | CDS | open | 420973-421869 | _na 298_aa | ureD | Urease accessory protein UreD |
| 369 | AP012337.1 | GCA000281175_00329 | CDS | open | 421912-422640 | _na 242_aa | ureF | Urease accessory protein UreF |
| 370 | AP012337.1 | GCA000281175_00330 | CDS | open | 423209-424483 | _na 424_aa | argG | argininosuccinate synthase |
| 371 | AP012337.1 | GCA000281175_00331 | CDS | open | 424603-425838 | _na 411_aa | argJ | bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ |
| 372 | AP012337.1 | GCA000281175_00332 | CDS | open | 425889-426440 | _na 183_aa | DUF4062 domain-containing protein | |
| 373 | AP012337.1 | GCA000281175_00333 | CDS | open | 426484-428019 | _na 511_aa | Glycosyltransferase RgtA/B/C/D-like domain-containing protein | |
| 374 | AP012337.1 | GCA000281175_00334 | CDS | open | 428009-429925 | _na 638_aa | pTPS | Membrane protein 6-pyruvoyl-tetrahydropterin synthase-related domain-containing protein |
| 375 | AP012337.1 | GCA000281175_00335 | CDS | open | 429926-430249 | _na 107_aa | hypothetical protein | |
| 376 | AP012337.1 | GCA000281175_00336 | CDS | open | 430346-431029 | _na 227_aa | can | carbonate dehydratase |
| 377 | AP012337.1 | GCA000281175_00337 | CDS | open | 431085-431717 | _na 210_aa | yjhB | NADH pyrophosphatase |
| 378 | AP012337.1 | GCA000281175_00338 | CDS | open | 431731-434301 | _na 856_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 379 | AP012337.1 | GCA000281175_00339 | CDS | open | 434393-435265 | _na 290_aa | uRH1 | Putative nucleosidase |
| 380 | AP012337.1 | GCA000281175_00340 | CDS | open | 435502-437517 | _na 671_aa | yliI | PA14 domain-containing protein |
| 381 | AP012337.1 | GCA000281175_00341 | CDS | open | 437726-438505 | _na 259_aa | ycjR | Xylose isomerase-like TIM barrel domain-containing protein |
| 382 | AP012337.1 | GCA000281175_00342 | CDS | open | 438602-439711 | _na 369_aa | mviM | Putative oxidoreductase |
| 383 | AP012337.1 | GCA000281175_00343 | CDS | open | 439961-440236 | _na 91_aa | yeaQ | GlsB/YeaQ/YmgE family stress response membrane protein |
| 384 | AP012337.1 | GCA000281175_00344 | CDS | open | 440318-441376 | _na 352_aa | mrp | Iron-sulfur cluster carrier protein |
| 385 | AP012337.1 | GCA000281175_00345 | CDS | open | 441564-442247 | _na 227_aa | citB | Putative two-component response regulator |
| 386 | AP012337.1 | GCA000281175_00346 | CDS | open | 442244-443725 | _na 493_aa | ntrY | histidine kinase |
| 387 | AP012337.1 | GCA000281175_00347 | CDS | open | 443722-444693 | _na 323_aa | phnD | Phosphate/phosphite/phosphonate ABC transporter substrate-binding protein |
| 388 | AP012337.1 | GCA000281175_00348 | CDS | open | 444693-446192 | _na 499_aa | grxC | Thioredoxin domain-containing protein |
| 389 | AP012337.1 | GCA000281175_00349 | CDS | open | 446564-448606 | _na 680_aa | glpC | 4Fe-4S ferredoxin-type domain-containing protein |
| 390 | AP012337.1 | GCA000281175_00350 | CDS | open | 448603-450984 | _na 793_aa | ampC | Class A beta-lactamase-related serine hydrolase |
| 391 | AP012337.1 | GCA000281175_00351 | CDS | open | 450992-452554 | _na 520_aa | pepN | M1 family peptidase |
| 392 | AP012337.1 | GCA000281175_00352 | CDS | open | 452680-453405 | _na 241_aa | phoE | MSMEG_4193 family phosphomutase |
| 393 | AP012337.1 | GCA000281175_00353 | CDS | open | 453402-453953 | _na 183_aa | DUF3090 domain-containing protein | |
| 394 | AP012337.1 | GCA000281175_00354 | CDS | open | 453993-454730 | _na 245_aa | PI3K/PI4K catalytic domain-containing protein | |
| 395 | AP012337.1 | GCA000281175_00355 | CDS | open | 454822-457356 | _na 844_aa | gCD1 | Putative mannose-1-phosphate guanyltransferase |
| 396 | AP012337.1 | GCA000281175_00356 | CDS | open | 457386-457904 | _na 172_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 397 | AP012337.1 | GCA000281175_00357 | CDS | open | 457981-458910 | _na 309_aa | rocF | arginase |
| 398 | AP012337.1 | GCA000281175_00358 | CDS | open | 458930-459790 | _na 286_aa | erfK | L%2CD-TPase catalytic domain-containing protein |
| 399 | AP012337.1 | GCA000281175_00359 | CDS | open | 459861-461117 | _na 418_aa | dnaJ | Curved DNA-binding protein |
| 400 | AP012337.1 | GCA000281175_00360 | CDS | open | 461121-462353 | _na 410_aa | perM | AI-2E family transporter |
| 401 | AP012337.1 | GCA000281175_00361 | CDS | open | 462399-464873 | _na 824_aa | uvrD | DNA 3'-5' helicase |
| 402 | AP012337.1 | GCA000281175_00362 | CDS | open | 464877-465917 | _na 346_aa | rsgA | ribosome small subunit-dependent GTPase A |
| 403 | AP012337.1 | GCA000281175_00364 | CDS | open | 466279-469248 | _na 989_aa | ompR | histidine kinase |
| 404 | AP012337.1 | GCA000281175_00365 | CDS | open | 469811-473065 | _na 1084_aa | fhlA | histidine kinase |
| 405 | AP012337.1 | GCA000281175_00366 | CDS | open | 473069-474715 | _na 548_aa | kinE | histidine kinase |
| 406 | AP012337.1 | GCA000281175_00367 | CDS | open | 474742-475503 | _na 253_aa | lmbE | Putative deacetylase |
| 407 | AP012337.1 | GCA000281175_00368 | CDS | open | 475635-476060 | _na 141_aa | psb27 | DUF4363 domain-containing protein |
| 408 | AP012337.1 | GCA000281175_00369 | CDS | open | 476196-477566 | _na 456_aa | araJ | Putative major facilitator superfamily transporter |
| 409 | AP012337.1 | GCA000281175_00370 | CDS | open | 477628-478359 | _na 243_aa | thuA | ThuA-like domain-containing protein |
| 410 | AP012337.1 | GCA000281175_00371 | CDS | open | 478447-479517 | _na 356_aa | mviM | Putative oxidoreductase |
| 411 | AP012337.1 | GCA000281175_00372 | CDS | open | 479704-480402 | _na 232_aa | maf | dTTP/UTP pyrophosphatase |
| 412 | AP012337.1 | GCA000281175_00373 | CDS | open | 480520-481317 | _na 265_aa | nnr1 | NAD(P)H-hydrate epimerase |
| 413 | AP012337.1 | GCA000281175_00374 | CDS | open | 481275-481544 | _na 89_aa | DUF6504 domain-containing protein | |
| 414 | AP012337.1 | GCA000281175_00375 | CDS | open | 481541-482050 | _na 169_aa | pncC | CinA C-terminal domain-containing protein |
| 415 | AP012337.1 | GCA000281175_00376 | CDS | open | 482047-483345 | _na 432_aa | trmN6 | THUMP-like domain-containing protein |
| 416 | AP012337.1 | GCA000281175_00377 | CDS | open | 483613-484464 | _na 283_aa | SD-repeat containing protein B domain-containing protein | |
| 417 | AP012337.1 | GCA000281175_00378 | CDS | open | 484652-486010 | _na 452_aa | cofD | Putative gluconeogenesis factor |
| 418 | AP012337.1 | GCA000281175_00379 | CDS | open | 486298-487308 | _na 336_aa | gap | type I glyceraldehyde-3-phosphate dehydrogenase |
| 419 | AP012337.1 | GCA000281175_00380 | CDS | open | 487503-488684 | _na 393_aa | pgk | Phosphoglycerate kinase |
| 420 | AP012337.1 | GCA000281175_00381 | CDS | open | 488691-489074 | _na 127_aa | DUF4288 domain-containing protein | |
| 421 | AP012337.1 | GCA000281175_00382 | CDS | open | 489160-489924 | _na 254_aa | tpiA | triose-phosphate isomerase |
| 422 | AP012337.1 | GCA000281175_00383 | CDS | open | 489988-490836 | _na 282_aa | Exosortase/archaeosortase family protein | |
| 423 | AP012337.1 | GCA000281175_00384 | CDS | open | 490839-491567 | _na 242_aa | epsI | Methanolan biosynthesis EpsI domain-containing protein |
| 424 | AP012337.1 | GCA000281175_00385 | CDS | open | 491734-492111 | _na 125_aa | hypothetical protein | |
| 425 | AP012337.1 | GCA000281175_00386 | CDS | open | 492160-492891 | _na 243_aa | Site-2 protease family protein | |
| 426 | AP012337.1 | GCA000281175_00387 | CDS | open | 493010-493336 | _na 108_aa | trxA | thioredoxin |
| 427 | AP012337.1 | GCA000281175_00388 | CDS | open | 493662-494783 | _na 373_aa | tal | transaldolase |
| 428 | AP012337.1 | GCA000281175_00389 | CDS | open | 494814-495512 | _na 232_aa | moaB | MoaB/Mog domain-containing protein |
| 429 | AP012337.1 | GCA000281175_00390 | CDS | open | 495648-496037 | _na 129_aa | rpsI | 30S ribosomal protein S9 |
| 430 | AP012337.1 | GCA000281175_00391 | CDS | open | 496064-496498 | _na 144_aa | rplM | 50S ribosomal protein L13 |
| 431 | AP012337.1 | GCA000281175_00392 | CDS | open | 496518-497390 | _na 290_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 432 | AP012337.1 | GCA000281175_00393 | CDS | open | 497416-497799 | _na 127_aa | rplQ | 50S ribosomal protein L17 |
| 433 | AP012337.1 | GCA000281175_00394 | CDS | open | 497818-498825 | _na 335_aa | rpoA | DNA-directed RNA polymerase subunit alpha |
| 434 | AP012337.1 | GCA000281175_00395 | CDS | open | 498915-499556 | _na 213_aa | rpsD | 30S ribosomal protein S4 |
| 435 | AP012337.1 | GCA000281175_00396 | CDS | open | 499793-500200 | _na 135_aa | rpsK | 30S ribosomal protein S11 |
| 436 | AP012337.1 | GCA000281175_00397 | CDS | open | 500294-500674 | _na 126_aa | rpsM | 30S ribosomal protein S13 |
| 437 | AP012337.1 | GCA000281175_00398 | CDS | open | 501035-501862 | _na 275_aa | map | type I methionyl aminopeptidase |
| 438 | AP012337.1 | GCA000281175_00399 | CDS | open | 501890-502558 | _na 222_aa | adk | adenylate kinase |
| 439 | AP012337.1 | GCA000281175_00400 | CDS | open | 502676-504025 | _na 449_aa | secY | preprotein translocase subunit SecY |
| 440 | AP012337.1 | GCA000281175_00401 | CDS | open | 504111-504590 | _na 159_aa | rplO | 50S ribosomal protein L15 |
| 441 | AP012337.1 | GCA000281175_00402 | CDS | open | 504687-504881 | _na 64_aa | rpmD | 50S ribosomal protein L30 |
| 442 | AP012337.1 | GCA000281175_00403 | CDS | open | 504874-505434 | _na 186_aa | rpsE | 30S ribosomal protein S5 |
| 443 | AP012337.1 | GCA000281175_00404 | CDS | open | 505461-505826 | _na 121_aa | rplR | 50S ribosomal protein L18 |
| 444 | AP012337.1 | GCA000281175_00405 | CDS | open | 505839-506396 | _na 185_aa | rplF | 50S ribosomal protein L6 |
| 445 | AP012337.1 | GCA000281175_00406 | CDS | open | 506407-506802 | _na 131_aa | rpsH | 30S ribosomal protein S8 |
| 446 | AP012337.1 | GCA000281175_00407 | CDS | open | 506936-507118 | _na 60_aa | rpsN | type Z 30S ribosomal protein S14 |
| 447 | AP012337.1 | GCA000281175_00408 | CDS | open | 507131-507697 | _na 188_aa | rplE | 50S ribosomal protein L5 |
| 448 | AP012337.1 | GCA000281175_00409 | CDS | open | 507793-508152 | _na 119_aa | rplX | 50S ribosomal protein L24 |
| 449 | AP012337.1 | GCA000281175_00410 | CDS | open | 508165-508533 | _na 122_aa | rplN | 50S ribosomal protein L14 |
| 450 | AP012337.1 | GCA000281175_00411 | CDS | open | 508552-508824 | _na 90_aa | rpsQ | 30S ribosomal protein S17 |
| 451 | AP012337.1 | GCA000281175_00412 | CDS | open | 508837-509034 | _na 65_aa | rpmC | 50S ribosomal protein L29 |
| 452 | AP012337.1 | GCA000281175_00413 | CDS | open | 509046-509465 | _na 139_aa | rplP | 50S ribosomal protein L16 |
| 453 | AP012337.1 | GCA000281175_00414 | CDS | open | 509481-510194 | _na 237_aa | rpsC | 30S ribosomal protein S3 |
| 454 | AP012337.1 | GCA000281175_00415 | CDS | open | 510242-510580 | _na 112_aa | rplV | 50S ribosomal protein L22 |
| 455 | AP012337.1 | GCA000281175_00416 | CDS | open | 510617-510907 | _na 96_aa | rpsS | 30S ribosomal protein S19 |
| 456 | AP012337.1 | GCA000281175_00417 | CDS | open | 510920-511750 | _na 276_aa | rplB | 50S ribosomal protein L2 |
| 457 | AP012337.1 | GCA000281175_00418 | CDS | open | 511766-512056 | _na 96_aa | rplW | 50S ribosomal protein L23 |
| 458 | AP012337.1 | GCA000281175_00419 | CDS | open | 512059-512715 | _na 218_aa | rplD | 50S ribosomal protein L4 |
| 459 | AP012337.1 | GCA000281175_00420 | CDS | open | 512748-513401 | _na 217_aa | rplC | 50S ribosomal protein L3 |
| 460 | AP012337.1 | GCA000281175_00421 | CDS | open | 513602-513910 | _na 102_aa | rpsJ | 30S ribosomal protein S10 |
| 461 | AP012337.1 | GCA000281175_00422 | CDS | open | 514057-515256 | _na 399_aa | tuf | elongation factor Tu |
| 462 | AP012337.1 | GCA000281175_00423 | CDS | open | 515647-517740 | _na 697_aa | fusA | elongation factor G |
| 463 | AP012337.1 | GCA000281175_00424 | CDS | open | 517979-518446 | _na 155_aa | rpsG | 30S ribosomal protein S7 |
| 464 | AP012337.1 | GCA000281175_00425 | CDS | open | 518617-519036 | _na 139_aa | rpsL | 30S ribosomal protein S12 |
| 465 | AP012337.1 | GCA000281175_00426 | CDS | open | 519448-520608 | _na 386_aa | dsd1 | D-serine dehydratase-like domain-containing protein |
| 466 | AP012337.1 | GCA000281175_00427 | CDS | open | 521051-521590 | _na 179_aa | DUF2993 domain-containing protein | |
| 467 | AP012337.1 | GCA000281175_00428 | CDS | open | 521923-522597 | _na 224_aa | Helix-turn-helix domain-containing protein | |
| 468 | AP012337.1 | GCA000281175_00429 | CDS | open | 522802-523605 | _na 267_aa | IS630 family transposase | |
| 469 | AP012337.1 | GCA000281175_00430 | CDS | open | 523664-523942 | _na 92_aa | helix-turn-helix domain-containing protein | |
| 470 | AP012337.1 | GCA000281175_00431 | CDS | open | 524113-526662 | _na 849_aa | priA | primosomal protein N' |
| 471 | AP012337.1 | GCA000281175_00432 | CDS | open | 526685-528052 | _na 455_aa | hypothetical protein | |
| 472 | AP012337.1 | GCA000281175_00433 | CDS | open | 528380-528544 | _na 54_aa | rpmH | 50S ribosomal protein L34 |
| 473 | AP012337.1 | GCA000281175_00434 | CDS | open | 528631-529056 | _na 141_aa | rnpA | ribonuclease P protein component |
| 474 | AP012337.1 | GCA000281175_00435 | CDS | open | 529083-529292 | _na 69_aa | yidD | membrane protein insertion efficiency factor YidD |
| 475 | AP012337.1 | GCA000281175_00436 | CDS | open | 529329-530339 | _na 336_aa | yidC | Membrane insertase YidC/Oxa/ALB C-terminal domain-containing protein |
| 476 | AP012337.1 | GCA000281175_00437 | CDS | open | 530343-531218 | _na 291_aa | jag | RNA-binding cell elongation regulator Jag/EloR |
| 477 | AP012337.1 | GCA000281175_00438 | CDS | open | 531343-532260 | _na 305_aa | rbsK | Carbohydrate kinase PfkB domain-containing protein |
| 478 | AP012337.1 | GCA000281175_00439 | CDS | open | 532374-533189 | _na 271_aa | parA | Chromosome partitioning protein ParA |
| 479 | AP012337.1 | GCA000281175_00440 | CDS | open | 533205-534125 | _na 306_aa | parB | Chromosome partitioning protein ParB |
| 480 | AP012337.1 | GCA000281175_00441 | CDS | open | 534118-535191 | _na 357_aa | mviM | Putative oxidoreductase |
| 481 | AP012337.1 | GCA000281175_00442 | CDS | open | 535477-536538 | _na 353_aa | mtbC1 | Putative MerR family transcriptional regulator |
| 482 | AP012337.1 | GCA000281175_00443 | CDS | open | 536535-537281 | _na 248_aa | ispA | Polyprenyl synthetase family protein |
| 483 | AP012337.1 | GCA000281175_00444 | CDS | open | 537893-538630 | _na 245_aa | crp | Putative transcriptional regulator |
| 484 | AP012337.1 | GCA000281175_00445 | CDS | open | 539182-540459 | _na 425_aa | rho | transcription termination factor Rho |
| 485 | AP012337.1 | GCA000281175_00446 | CDS | open | 540758-542083 | _na 441_aa | spoIIQ2 | M23 family metallopeptidase |
| 486 | AP012337.1 | GCA000281175_00447 | CDS | open | 542172-543560 | _na 462_aa | fumC | Fumarate hydratase class II |
| 487 | AP012337.1 | GCA000281175_00448 | CDS | open | 543840-544517 | _na 225_aa | ompR | Response regulator transcription factor |
| 488 | AP012337.1 | GCA000281175_00449 | CDS | open | 544576-546090 | _na 504_aa | baeS | histidine kinase |
| 489 | AP012337.1 | GCA000281175_00450 | CDS | open | 546062-547324 | _na 420_aa | Cbb3-type cytochrome c oxidase subunit I | |
| 490 | AP012337.1 | GCA000281175_00454 | CDS | open | 548039-549463 | _na 474_aa | deoR | DeoR family transcriptional regulator |
| 491 | AP012337.1 | GCA000281175_00455 | CDS | open | 549505-550161 | _na 218_aa | rsmD | 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD |
| 492 | AP012337.1 | GCA000281175_00456 | CDS | open | 550181-550957 | _na 258_aa | Septum formation-related domain-containing protein | |
| 493 | AP012337.1 | GCA000281175_00457 | CDS | open | 550971-553322 | _na 783_aa | Glycosyltransferase RgtA/B/C/D-like domain-containing protein | |
| 494 | AP012337.1 | GCA000281175_00458 | CDS | open | 553326-555575 | _na 749_aa | DUF2029 domain-containing protein | |
| 495 | AP012337.1 | GCA000281175_00459 | CDS | open | 555572-556684 | _na 370_aa | aglD2 | Flippase-like domain-containing protein |
| 496 | AP012337.1 | GCA000281175_00460 | CDS | open | 556813-559086 | _na 757_aa | ygiM | SH3b domain-containing protein |
| 497 | AP012337.1 | GCA000281175_00461 | CDS | open | 559559-560092 | _na 177_aa | Redoxin domain-containing protein | |
| 498 | AP012337.1 | GCA000281175_00462 | CDS | open | 560107-560736 | _na 209_aa | DUF624 domain-containing protein | |
| 499 | AP012337.1 | GCA000281175_00463 | CDS | open | 560736-562370 | _na 544_aa | nnr2 | Bifunctional NAD(P)H-hydrate repair enzyme |
| 500 | AP012337.1 | GCA000281175_00464 | CDS | open | 562392-563534 | _na 380_aa | murG | Monogalactosyldiacylglycerol synthase family protein |

