HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Bifidobacterium subtile (GCA_000741775.1)

Select a Genome:
BAKTA Annotations for GCA_000741775.1
Genome Selected: Bifidobacterium subtile
ContigsBases CDSrRNA tmRNAtRNA
27 2790088 2274 4 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4674 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4674 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 JGZR01000005.1 GCA000741775_00750 CDS open 4348-6312 _na     654_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
1502 JGZR01000005.1 GCA000741775_00751 CDS open 6317-7027 _na     236_aa cas5c type I-C CRISPR-associated protein Cas5c
1503 JGZR01000005.1 GCA000741775_00752 CDS open 7038-9425 _na     795_aa CRISPR-associated protein Cas3
1504 JGZR01000005.1 GCA000741775_00753 CDS open 9661-10905 _na     414_aa Filamentation induced by cAMP protein fic
1505 JGZR01000005.1 GCA000741775_00754 CDS open 10989-14342 _na     1117_aa ileS mupirocin-resistant isoleucine--tRNA ligase
1506 JGZR01000005.1 GCA000741775_00755 CDS open 14787-15233 _na     148_aa marR Transcriptional regulator%2C MarR family
1507 JGZR01000005.1 GCA000741775_00756 CDS open 15315-16283 _na     322_aa Major facilitator superfamily protein
1508 JGZR01000005.1 GCA000741775_00757 CDS open 16625-17317 _na     230_aa L-ribulose-5-phosphate 4-epimerase
1509 JGZR01000005.1 GCA000741775_00758 CDS open 17891-19252 _na     453_aa Sugar transporter
1510 JGZR01000005.1 GCA000741775_00759 CDS open 19301-19933 _na     210_aa 2-keto-3-deoxygluconate kinase
1511 JGZR01000005.1 GCA000741775_00761 CDS open 20305-21288 _na     327_aa diaminopimelate dehydrogenase
1512 JGZR01000005.1 GCA000741775_00762 CDS open 21412-22500 _na     362_aa Transporter%2C probably Formate efflux permease
1513 JGZR01000005.1 GCA000741775_00763 CDS open 22779-24869 _na     696_aa Cation transport ATPase
1514 JGZR01000005.1 GCA000741775_00764 CDS open 24951-25181 _na     76_aa merP MerTP family mercury (Hg2 ) permease%2C binding protein MerP
1515 JGZR01000005.1 GCA000741775_00765 CDS open 25181-25771 _na     196_aa DNA-binding ferritin-like protein (Oxidative damage protectant)
1516 JGZR01000005.1 GCA000741775_00766 CDS open 25740-26516 _na     258_aa CRP/FNR family transcriptional regulator%2C anaerobic regulatory protein
1517 JGZR01000005.1 GCA000741775_00767 CDS open 26981-27556 _na     191_aa repB RepB protein
1518 JGZR01000005.1 GCA000741775_00768 CDS open 27559-27795 _na     78_aa Helix-turn-helix domain-containing protein
1519 JGZR01000005.1 GCA000741775_00769 CDS open 27856-28671 _na     271_aa HNH endonuclease
1520 JGZR01000005.1 GCA000741775_00770 CDS open 28718-29443 _na     241_aa Transposase subunit B
1521 JGZR01000005.1 GCA000741775_00771 CDS open 29472-29930 _na     152_aa Insertion element IS6110 membrane protein
1522 JGZR01000005.1 GCA000741775_00772 CDS open 29945-30514 _na     189_aa Phosphotriesterase family protein
1523 JGZR01000005.1 GCA000741775_00773 CDS open 30726-31694 _na     322_aa Sugar-binding protein
1524 JGZR01000005.1 GCA000741775_00774 CDS open 31709-34039 _na     776_aa GTP pyrophosphokinase/Guanosine 3'%2C5'-bis(Diphosphate)3'-pyrophosphohydrolase
1525 JGZR01000005.1 GCA000741775_00775 CDS open 34215-34691 _na     158_aa dut dUTP diphosphatase
1526 JGZR01000005.1 GCA000741775_00776 CDS open 34691-34984 _na     97_aa dUTPase
1527 JGZR01000005.1 GCA000741775_00777 CDS open 35147-36385 _na     412_aa sepH septation protein SepH
1528 JGZR01000005.1 GCA000741775_00778 CDS open 36636-38006 _na     456_aa Nucleotide pyrophosphatase
1529 JGZR01000005.1 GCA000741775_00779 CDS open 38586-41243 _na     885_aa DNA topoisomerase (ATP-hydrolyzing)
1530 JGZR01000005.1 GCA000741775_00780 CDS open 41394-41636 _na     80_aa Antitoxin
1531 JGZR01000005.1 GCA000741775_00781 CDS open 41691-42314 _na     207_aa Phosphatidylinositol kinase
1532 JGZR01000005.1 GCA000741775_00782 CDS open 42307-42642 _na     111_aa XRE family transcriptional regulator
1533 JGZR01000005.1 GCA000741775_00783 CDS open 42784-48339 _na     1851_aa ATP-dependent helicase
1534 JGZR01000005.1 GCA000741775_00784 CDS open 48374-49627 _na     417_aa Transporter%2C major facilitator family protein
1535 JGZR01000005.1 GCA000741775_00785 CDS open 50264-51814 _na     516_aa Aspartate ammonia-lyase
1536 JGZR01000005.1 GCA000741775_00786 CDS open 51956-54370 _na     804_aa DNA topoisomerase (ATP-hydrolyzing)
1537 JGZR01000005.1 GCA000741775_00787 CDS open 54609-56024 _na     471_aa RNA polymerase sigma factor
1538 JGZR01000005.1 GCA000741775_00788 CDS open 56149-57057 _na     302_aa DUF4192 domain-containing protein
1539 JGZR01000005.1 GCA000741775_00789 CDS open 57276-58454 _na     392_aa Polyprenyl synthase
1540 JGZR01000005.1 GCA000741775_00790 CDS open 58541-60850 _na     769_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
1541 JGZR01000005.1 GCA000741775_00791 CDS open 61346-63379 _na     677_aa nikD nickel import ATP-binding protein NikD
1542 JGZR01000005.1 GCA000741775_00792 CDS open 63401-64387 _na     328_aa Peptide ABC transporter permease
1543 JGZR01000005.1 GCA000741775_00793 CDS open 64408-65334 _na     308_aa Peptide ABC transporter permease
1544 JGZR01000005.1 GCA000741775_00794 CDS open 65682-67106 _na     474_aa ABC transporter substrate-binding protein
1545 JGZR01000005.1 GCA000741775_00795 CDS open 68137-69456 _na     439_aa Phage integrase family protein
1546 JGZR01000005.1 GCA000741775_00796 CDS open 69885-70154 _na     89_aa DUF6725 domain-containing protein
1547 JGZR01000005.1 GCA000741775_00797 CDS open 70257-71384 _na     375_aa Prephenate dehydrogenase
1548 JGZR01000005.1 GCA000741775_00798 CDS open 71378-72769 _na     463_aa Prephenate dehydratase
1549 JGZR01000005.1 GCA000741775_00799 CDS open 72769-73368 _na     199_aa Alcohol dehydrogenase
1550 JGZR01000005.1 GCA000741775_00800 CDS open 73671-75593 _na     640_aa typA translational GTPase TypA
1551 JGZR01000005.1 GCA000741775_00801 CDS open 75883-77283 _na     466_aa Sugar transporter
1552 JGZR01000005.1 GCA000741775_00802 CDS open 77477-78439 _na     320_aa ADP-ribose pyrophosphatase
1553 JGZR01000005.1 GCA000741775_00803 CDS open 78581-79516 _na     311_aa scpB SMC-Scp complex subunit ScpB
1554 JGZR01000005.1 GCA000741775_00804 CDS open 79513-80457 _na     314_aa Segregation and condensation protein A
1555 JGZR01000005.1 GCA000741775_00805 CDS open 80464-81528 _na     354_aa Chromosome partitioning protein
1556 JGZR01000005.1 GCA000741775_00806 CDS open 81861-82427 _na     188_aa Lipoprotein
1557 JGZR01000005.1 GCA000741775_00807 CDS open 82424-84856 _na     810_aa Phosphoesterase
1558 JGZR01000005.1 GCA000741775_00808 CDS open 85046-85972 _na     308_aa xerD site-specific tyrosine recombinase XerD
1559 JGZR01000005.1 GCA000741775_00809 CDS open 86159-86542 _na     127_aa rplT 50S ribosomal protein L20
1560 JGZR01000005.1 GCA000741775_00810 CDS open 86589-86783 _na     64_aa rpmI 50S ribosomal protein L35
1561 JGZR01000005.1 GCA000741775_00811 CDS open 86902-87612 _na     236_aa infC translation initiation factor IF-3
1562 JGZR01000005.1 GCA000741775_00812 CDS open 87971-89854 _na     627_aa asnB asparagine synthase (glutamine-hydrolyzing)
1563 JGZR01000005.1 GCA000741775_00813 CDS open 90074-91774 _na     566_aa Spermine synthase
1564 JGZR01000005.1 GCA000741775_00814 CDS open 91875-92738 _na     287_aa thiamine diphosphokinase
1565 JGZR01000005.1 GCA000741775_00815 CDS open 92752-93147 _na     131_aa arsC ArsC family protein
1566 JGZR01000005.1 GCA000741775_00816 CDS open 93218-94273 _na     351_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
1567 JGZR01000005.1 GCA000741775_00817 CDS open 94480-95214 _na     244_aa ybaK Cys-tRNA(Pro) deacylase
1568 JGZR01000005.1 GCA000741775_00818 CDS open 95461-96414 _na     317_aa Aldose 1-epimerase
1569 JGZR01000005.1 GCA000741775_00821 CDS open 97011-97664 _na     217_aa [ribosomal protein uS5]-alanine N-acetyltransferase
1570 JGZR01000005.1 GCA000741775_00822 CDS open 97926-99089 _na     387_aa Transcriptional regulator
1571 JGZR01000005.1 GCA000741775_00823 CDS open 99292-100407 _na     371_aa D-glutamate cyclase-like C-terminal domain-containing protein
1572 JGZR01000005.1 GCA000741775_00824 CDS open 100404-102194 _na     596_aa biotin carboxylase
1573 JGZR01000005.1 GCA000741775_00825 CDS open 102194-104110 _na     638_aa pxpB 5-oxoprolinase subunit PxpB
1574 JGZR01000005.1 GCA000741775_00826 CDS open 104098-104952 _na     284_aa 5-oxoprolinase subunit A
1575 JGZR01000005.1 GCA000741775_00827 CDS open 105134-105931 _na     265_aa putative hydro-lyase
1576 JGZR01000005.1 GCA000741775_00828 CDS open 106210-107172 _na     320_aa aminodeoxychorismate lyase
1577 JGZR01000005.1 GCA000741775_00829 CDS open 107472-109604 _na     710_aa DNA primase
1578 JGZR01000005.1 GCA000741775_00830 CDS open 109670-110929 _na     419_aa deoxyguanosinetriphosphate triphosphohydrolase
1579 JGZR01000005.1 GCA000741775_00831 CDS open 111212-112570 _na     452_aa alr alanine racemase
1580 JGZR01000005.1 GCA000741775_00832 CDS open 112854-113393 _na     179_aa cysE Serine O-acetyltransferase CysE
1581 JGZR01000005.1 GCA000741775_00833 CDS open 113863-114381 _na     172_aa S-ribosylhomocysteine lyase
1582 JGZR01000005.1 GCA000741775_00834 CDS open 114779-116902 _na     707_aa recQ DNA helicase RecQ
1583 JGZR01000005.1 GCA000741775_00835 CDS open 117172-118356 _na     394_aa cystathionine gamma-synthase
1584 JGZR01000005.1 GCA000741775_00836 CDS open 118628-119836 _na     402_aa Cystathionine beta-synthase
1585 JGZR01000005.1 GCA000741775_00837 CDS open 120834-123014 _na     726_aa Multidrug ABC transporter permease
1586 JGZR01000005.1 GCA000741775_00838 CDS open 122992-123927 _na     311_aa ABC transporter ATP-binding protein
1587 JGZR01000005.1 GCA000741775_00839 CDS open 123991-124404 _na     137_aa Acetoin transport repressor
1588 JGZR01000005.1 GCA000741775_00840 CDS open 124880-127972 _na     1030_aa EmrB/QacA subfamily drug resistance transporter
1589 JGZR01000005.1 GCA000741775_00841 CDS open 128215-128844 _na     209_aa tetR Transcriptional regulator%2C TetR family
1590 JGZR01000005.1 GCA000741775_00842 CDS open 128863-129615 _na     250_aa AAA domain protein
1591 JGZR01000005.1 GCA000741775_00843 CDS open 129869-130861 _na     330_aa D-3-phosphoglycerate dehydrogenase
1592 JGZR01000005.1 GCA000741775_00844 CDS open 131354-132256 _na     300_aa ABC transporter
1593 JGZR01000005.1 GCA000741775_00845 CDS open 132256-133308 _na     350_aa Peptide ABC transporter ATP-binding protein
1594 JGZR01000005.1 GCA000741775_00846 CDS open 133305-134342 _na     345_aa Peptide ABC transporter permease
1595 JGZR01000005.1 GCA000741775_00847 CDS open 134404-135396 _na     330_aa Glutathione transport system permease
1596 JGZR01000005.1 GCA000741775_00848 CDS open 135417-137096 _na     559_aa Peptide/nickel ABC transporter substrate-binding protein
1597 JGZR01000005.1 GCA000741775_00849 CDS open 137314-138081 _na     255_aa type III pantothenate kinase
1598 JGZR01000005.1 GCA000741775_00850 CDS open 138139-139554 _na     471_aa Sugar ABC transporter substrate-binding protein
1599 JGZR01000005.1 GCA000741775_00851 CDS open 139773-140717 _na     314_aa 23S RNA-specific pseudouridylate synthase
1600 JGZR01000005.1 GCA000741775_00852 CDS open 141033-142925 _na     630_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
1601 JGZR01000005.1 GCA000741775_00853 CDS open 143177-144040 _na     287_aa ABC transporter ATP-binding protein
1602 JGZR01000005.1 GCA000741775_00854 CDS open 144051-145040 _na     329_aa Amino acid ABC transporter permease
1603 JGZR01000005.1 GCA000741775_00855 CDS open 145173-146102 _na     309_aa Solute-binding protein of ABC transporter system
1604 JGZR01000005.1 GCA000741775_00856 CDS open 146274-147203 _na     309_aa ABC transporter substrate-binding protein
1605 JGZR01000005.1 GCA000741775_00857 CDS open 147515-147997 _na     160_aa smpB SsrA-binding protein SmpB
1606 JGZR01000005.1 GCA000741775_00858 CDS open 148213-149628 _na     471_aa Amidase
1607 JGZR01000005.1 GCA000741775_00859 CDS open 149882-150805 _na     307_aa ftsX permease-like cell division protein FtsX
1608 JGZR01000005.1 GCA000741775_00860 CDS open 150809-152170 _na     453_aa ftsE cell division ATP-binding protein FtsE
1609 JGZR01000005.1 GCA000741775_00861 CDS open 152210-153343 _na     377_aa prfB peptide chain release factor 2
1610 JGZR01000005.1 GCA000741775_00862 CDS open 154505-155494 _na     329_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
1611 JGZR01000005.1 GCA000741775_00863 CDS open 155728-156234 _na     168_aa HXXEE domain-containing protein
1612 JGZR01000005.1 GCA000741775_00864 CDS open 156527-156778 _na     83_aa RelB/DinJ family addiction module antitoxin
1613 JGZR01000005.1 GCA000741775_00865 CDS open 156798-157037 _na     79_aa hypothetical protein
1614 JGZR01000005.1 GCA000741775_00866 CDS open 157060-158079 _na     339_aa Metal-dependent membrane protease
1615 JGZR01000005.1 GCA000741775_00867 CDS open 158217-158552 _na     111_aa DUF3887 domain-containing protein
1616 JGZR01000005.1 GCA000741775_00868 CDS open 159152-160444 _na     430_aa citrate synthase
1617 JGZR01000005.1 GCA000741775_00869 CDS open 160893-161669 _na     258_aa map type I methionyl aminopeptidase
1618 JGZR01000005.1 GCA000741775_00870 CDS open 161746-162387 _na     213_aa Membrane protein
1619 JGZR01000005.1 GCA000741775_00871 CDS open 162554-164620 _na     688_aa Neutral endopeptidase
1620 JGZR01000005.1 GCA000741775_00872 CDS open 164631-165437 _na     268_aa Single-stranded DNA-binding protein
1621 JGZR01000005.1 GCA000741775_00873 CDS open 165771-166619 _na     282_aa 3-hydroxyacyl-CoA dehydrogenase
1622 JGZR01000005.1 GCA000741775_00874 CDS open 167022-168836 _na     604_aa proline--tRNA ligase
1623 JGZR01000005.1 GCA000741775_00875 CDS open 168979-170469 _na     496_aa Secreted polysaccharide deacetylase
1624 JGZR01000005.1 GCA000741775_00876 CDS open 170865-172277 _na     470_aa Helicase
1625 JGZR01000005.1 GCA000741775_00877 CDS open 172321-173253 _na     310_aa Hydrolase
1626 JGZR01000005.1 GCA000741775_00878 CDS open 173434-174141 _na     235_aa orn oligoribonuclease
1627 JGZR01000005.1 GCA000741775_00879 CDS open 174438-175967 _na     509_aa guaB IMP dehydrogenase
1628 JGZR01000005.1 GCA000741775_00880 CDS open 176186-177550 _na     454_aa Undecaprenyl-phosphate alpha-N-acetylglucosaminyltransferase
1629 JGZR01000005.1 GCA000741775_00881 CDS open 177547-178206 _na     219_aa L-threonylcarbamoyladenylate synthase
1630 JGZR01000005.1 GCA000741775_00882 CDS open 178735-179964 _na     409_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
1631 JGZR01000005.1 GCA000741775_00883 CDS open 180005-181087 _na     360_aa prfA peptide chain release factor 1
1632 JGZR01000005.1 GCA000741775_00884 CDS open 181257-181469 _na     70_aa rpmE 50S ribosomal protein L31
1633 JGZR01000005.1 GCA000741775_00886 CDS open 182087-182773 _na     228_aa Hydroxymethylpyrimidine transport system permease protein
1634 JGZR01000005.1 GCA000741775_00887 CDS open 183201-184613 _na     470_aa Succinate-semialdehyde dehdyrogenase
1635 JGZR01000005.1 GCA000741775_00888 CDS open 185002-185433 _na     143_aa hypothetical protein
1636 JGZR01000005.1 GCA000741775_00889 CDS open 185610-186347 _na     245_aa NAD(P)H-dependent FMN reductase
1637 JGZR01000005.1 GCA000741775_00890 CDS open 186749-188182 _na     477_aa Major facilitator superfamily transporter
1638 JGZR01000005.1 GCA000741775_00891 CDS open 188466-188726 _na     86_aa Transcriptional regulator
1639 JGZR01000005.1 GCA000741775_00892 CDS open 188749-189384 _na     211_aa YceJ-like MFS-type transporter
1640 JGZR01000005.1 GCA000741775_00893 CDS open 189741-190286 _na     181_aa Putative NADPH-dependent FMN reductase
1641 JGZR01000005.1 GCA000741775_00894 CDS open 190523-191779 _na     418_aa ATP-grasp domain-containing protein
1642 JGZR01000005.1 GCA000741775_00895 CDS open 191869-192471 _na     200_aa NAD(P)H oxidoreductase
1643 JGZR01000005.1 GCA000741775_00896 CDS open 192671-193735 _na     354_aa asnC Putative AsnC family transcriptional regulator
1644 JGZR01000005.1 GCA000741775_00897 CDS open 193907-194101 _na     64_aa bioY Biotin transporter BioY
1645 JGZR01000005.1 GCA000741775_00898 CDS open 194120-195256 _na     378_aa Membrane protein
1646 JGZR01000005.1 GCA000741775_00899 CDS open 195440-196660 _na     406_aa Peptidase M20 domain-containing protein 2
1647 JGZR01000005.1 GCA000741775_00900 CDS open 197060-201646 _na     1528_aa Putative ATP-dependent helicase
1648 JGZR01000005.1 GCA000741775_00901 CDS open 201850-202500 _na     216_aa Phospholipase/Carboxylesterase
1649 JGZR01000005.1 GCA000741775_00902 CDS open 202697-203725 _na     342_aa msrA Peptide methionine sulfoxide reductase MsrA
1650 JGZR01000005.1 GCA000741775_00903 CDS open 203743-204348 _na     201_aa nicotinamidase
1651 JGZR01000005.1 GCA000741775_00904 CDS open 205060-205740 _na     226_aa Nicotinamidase-like amidase protein
1652 JGZR01000005.1 GCA000741775_00905 CDS open 205826-206407 _na     193_aa Cysteine hydrolase
1653 JGZR01000005.1 GCA000741775_00906 CDS open 206404-207429 _na     341_aa Basic membrane lipoprotein
1654 JGZR01000005.1 GCA000741775_00907 CDS open 207588-208487 _na     299_aa ABC transporter permease
1655 JGZR01000005.1 GCA000741775_00908 CDS open 208484-209536 _na     350_aa ABC transporter permease
1656 JGZR01000005.1 GCA000741775_00909 CDS open 209533-211074 _na     513_aa ABC transporter
1657 JGZR01000005.1 GCA000741775_00910 CDS open 211067-211795 _na     242_aa gntR GntR family transcriptional regulator
1658 JGZR01000005.1 GCA000741775_00911 CDS open 211827-213302 _na     491_aa atzF allophanate hydrolase
1659 JGZR01000005.1 GCA000741775_00912 CDS open 213690-214394 _na     234_aa AB hydrolase-1 domain-containing protein
1660 JGZR01000005.1 GCA000741775_00913 CDS open 214513-215679 _na     388_aa AAA domain protein
1661 JGZR01000005.1 GCA000741775_00914 CDS open 216089-216820 _na     243_aa Glycerol uptake facilitator protein
1662 JGZR01000005.1 GCA000741775_00915 CDS open 217450-218004 _na     184_aa ECF-type riboflavin transporter%2C S component
1663 JGZR01000005.1 GCA000741775_00916 CDS open 218129-220453 _na     774_aa energy-coupling factor transporter ATPase
1664 JGZR01000005.1 GCA000741775_00917 CDS open 220443-221222 _na     259_aa Cobalt transport protein
1665 JGZR01000005.1 GCA000741775_00918 CDS open 222023-223198 _na     391_aa Serine--pyruvate transaminase
1666 JGZR01000005.1 GCA000741775_00919 CDS open 223195-223461 _na     88_aa hypothetical protein
1667 JGZR01000005.1 GCA000741775_00920 CDS open 224077-225348 _na     423_aa O-antigen ligase family protein
1668 JGZR01000005.1 GCA000741775_00921 CDS open 225561-227138 _na     525_aa Sugar-binding protein
1669 JGZR01000005.1 GCA000741775_00922 CDS open 227350-228759 _na     469_aa non-specific protein-tyrosine kinase
1670 JGZR01000005.1 GCA000741775_00923 CDS open 229281-230633 _na     450_aa D-serine ammonia-lyase
1671 JGZR01000005.1 GCA000741775_00924 CDS open 230715-231155 _na     146_aa Antitoxin SocA-like Panacea domain-containing protein
1672 JGZR01000005.1 GCA000741775_00925 CDS open 231439-232302 _na     287_aa RelA/SpoT domain-containing protein
1673 JGZR01000005.1 GCA000741775_00926 CDS open 232670-233083 _na     137_aa hypothetical protein
1674 JGZR01000005.1 GCA000741775_00927 CDS open 233815-235041 _na     408_aa ATPase
1675 JGZR01000005.1 GCA000741775_00928 CDS open 235957-236727 _na     256_aa hypothetical protein
1676 JGZR01000005.1 GCA000741775_00929 CDS open 236762-237952 _na     396_aa Helix-turn-helix domain-containing protein
1677 JGZR01000005.1 GCA000741775_00930 CDS open 238419-238925 _na     168_aa DUF4411 domain-containing protein
1678 JGZR01000005.1 GCA000741775_00931 CDS open 238922-240025 _na     367_aa irrE IrrE N-terminal-like domain-containing protein
1679 JGZR01000005.1 GCA000741775_00932 CDS open 240529-240933 _na     134_aa hypothetical protein
1680 JGZR01000005.1 GCA000741775_00933 CDS open 242020-242763 _na     247_aa GmrSD restriction endonucleases C-terminal domain-containing protein
1681 JGZR01000005.1 GCA000741775_00934 CDS open 242840-244555 _na     571_aa hypothetical protein
1682 JGZR01000005.1 GCA000741775_00935 CDS open 244738-245631 _na     297_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
1683 JGZR01000005.1 GCA000741775_00746 gene open 1344-1634 cas2
1684 JGZR01000005.1 GCA000741775_00747 gene open 1641-2672 cas1c
1685 JGZR01000005.1 GCA000741775_00748 gene open 2669-3379 cas4
1686 JGZR01000005.1 GCA000741775_00749 gene open 3500-4342 cas7c
1687 JGZR01000005.1 GCA000741775_00750 gene open 4348-6312 cas8c
1688 JGZR01000005.1 GCA000741775_00751 gene open 6317-7027 cas5c
1689 JGZR01000005.1 GCA000741775_00752 gene open 7038-9425
1690 JGZR01000005.1 GCA000741775_00753 gene open 9661-10905
1691 JGZR01000005.1 GCA000741775_00754 gene open 10989-14342 ileS
1692 JGZR01000005.1 GCA000741775_00755 gene open 14787-15233 marR
1693 JGZR01000005.1 GCA000741775_00756 gene open 15315-16283
1694 JGZR01000005.1 GCA000741775_00757 gene open 16625-17317
1695 JGZR01000005.1 GCA000741775_00758 gene open 17891-19252
1696 JGZR01000005.1 GCA000741775_00759 gene open 19301-19933
1697 JGZR01000005.1 GCA000741775_00761 gene open 20305-21288
1698 JGZR01000005.1 GCA000741775_00762 gene open 21412-22500
1699 JGZR01000005.1 GCA000741775_00763 gene open 22779-24869
1700 JGZR01000005.1 GCA000741775_00764 gene open 24951-25181 merP
1701 JGZR01000005.1 GCA000741775_00765 gene open 25181-25771
1702 JGZR01000005.1 GCA000741775_00766 gene open 25740-26516
1703 JGZR01000005.1 GCA000741775_00767 gene open 26981-27556 repB
1704 JGZR01000005.1 GCA000741775_00768 gene open 27559-27795
1705 JGZR01000005.1 GCA000741775_00769 gene open 27856-28671
1706 JGZR01000005.1 GCA000741775_00770 gene open 28718-29443
1707 JGZR01000005.1 GCA000741775_00771 gene open 29472-29930
1708 JGZR01000005.1 GCA000741775_00772 gene open 29945-30514
1709 JGZR01000005.1 GCA000741775_00773 gene open 30726-31694
1710 JGZR01000005.1 GCA000741775_00774 gene open 31709-34039
1711 JGZR01000005.1 GCA000741775_00775 gene open 34215-34691 dut
1712 JGZR01000005.1 GCA000741775_00776 gene open 34691-34984
1713 JGZR01000005.1 GCA000741775_00777 gene open 35147-36385 sepH
1714 JGZR01000005.1 GCA000741775_00778 gene open 36636-38006
1715 JGZR01000005.1 GCA000741775_00779 gene open 38586-41243
1716 JGZR01000005.1 GCA000741775_00780 gene open 41394-41636
1717 JGZR01000005.1 GCA000741775_00781 gene open 41691-42314
1718 JGZR01000005.1 GCA000741775_00782 gene open 42307-42642
1719 JGZR01000005.1 GCA000741775_00783 gene open 42784-48339
1720 JGZR01000005.1 GCA000741775_00784 gene open 48374-49627
1721 JGZR01000005.1 GCA000741775_00785 gene open 50264-51814
1722 JGZR01000005.1 GCA000741775_00786 gene open 51956-54370
1723 JGZR01000005.1 GCA000741775_00787 gene open 54609-56024
1724 JGZR01000005.1 GCA000741775_00788 gene open 56149-57057
1725 JGZR01000005.1 GCA000741775_00789 gene open 57276-58454
1726 JGZR01000005.1 GCA000741775_00790 gene open 58541-60850 pknB
1727 JGZR01000005.1 GCA000741775_00791 gene open 61346-63379 nikD
1728 JGZR01000005.1 GCA000741775_00792 gene open 63401-64387
1729 JGZR01000005.1 GCA000741775_00793 gene open 64408-65334
1730 JGZR01000005.1 GCA000741775_00794 gene open 65682-67106
1731 JGZR01000005.1 GCA000741775_00795 gene open 68137-69456
1732 JGZR01000005.1 GCA000741775_00796 gene open 69885-70154
1733 JGZR01000005.1 GCA000741775_00797 gene open 70257-71384
1734 JGZR01000005.1 GCA000741775_00798 gene open 71378-72769
1735 JGZR01000005.1 GCA000741775_00799 gene open 72769-73368
1736 JGZR01000005.1 GCA000741775_00800 gene open 73671-75593 typA
1737 JGZR01000005.1 GCA000741775_00801 gene open 75883-77283
1738 JGZR01000005.1 GCA000741775_00802 gene open 77477-78439
1739 JGZR01000005.1 GCA000741775_00803 gene open 78581-79516 scpB
1740 JGZR01000005.1 GCA000741775_00804 gene open 79513-80457
1741 JGZR01000005.1 GCA000741775_00805 gene open 80464-81528
1742 JGZR01000005.1 GCA000741775_00806 gene open 81861-82427
1743 JGZR01000005.1 GCA000741775_00807 gene open 82424-84856
1744 JGZR01000005.1 GCA000741775_00808 gene open 85046-85972 xerD
1745 JGZR01000005.1 GCA000741775_00809 gene open 86159-86542 rplT
1746 JGZR01000005.1 GCA000741775_00810 gene open 86589-86783 rpmI
1747 JGZR01000005.1 GCA000741775_00811 gene open 86902-87612 infC
1748 JGZR01000005.1 GCA000741775_00812 gene open 87971-89854 asnB
1749 JGZR01000005.1 GCA000741775_00813 gene open 90074-91774
1750 JGZR01000005.1 GCA000741775_00814 gene open 91875-92738
1751 JGZR01000005.1 GCA000741775_00815 gene open 92752-93147 arsC
1752 JGZR01000005.1 GCA000741775_00816 gene open 93218-94273 gap
1753 JGZR01000005.1 GCA000741775_00817 gene open 94480-95214 ybaK
1754 JGZR01000005.1 GCA000741775_00818 gene open 95461-96414
1755 JGZR01000005.1 GCA000741775_00821 gene open 97011-97664
1756 JGZR01000005.1 GCA000741775_00822 gene open 97926-99089
1757 JGZR01000005.1 GCA000741775_00823 gene open 99292-100407
1758 JGZR01000005.1 GCA000741775_00824 gene open 100404-102194
1759 JGZR01000005.1 GCA000741775_00825 gene open 102194-104110 pxpB
1760 JGZR01000005.1 GCA000741775_00826 gene open 104098-104952
1761 JGZR01000005.1 GCA000741775_00827 gene open 105134-105931
1762 JGZR01000005.1 GCA000741775_00828 gene open 106210-107172
1763 JGZR01000005.1 GCA000741775_00829 gene open 107472-109604
1764 JGZR01000005.1 GCA000741775_00830 gene open 109670-110929
1765 JGZR01000005.1 GCA000741775_00831 gene open 111212-112570 alr
1766 JGZR01000005.1 GCA000741775_00832 gene open 112854-113393 cysE
1767 JGZR01000005.1 GCA000741775_00833 gene open 113863-114381
1768 JGZR01000005.1 GCA000741775_00834 gene open 114779-116902 recQ
1769 JGZR01000005.1 GCA000741775_00835 gene open 117172-118356
1770 JGZR01000005.1 GCA000741775_00836 gene open 118628-119836
1771 JGZR01000005.1 GCA000741775_00837 gene open 120834-123014
1772 JGZR01000005.1 GCA000741775_00838 gene open 122992-123927
1773 JGZR01000005.1 GCA000741775_00839 gene open 123991-124404
1774 JGZR01000005.1 GCA000741775_00840 gene open 124880-127972
1775 JGZR01000005.1 GCA000741775_00841 gene open 128215-128844 tetR
1776 JGZR01000005.1 GCA000741775_00842 gene open 128863-129615
1777 JGZR01000005.1 GCA000741775_00843 gene open 129869-130861
1778 JGZR01000005.1 GCA000741775_00844 gene open 131354-132256
1779 JGZR01000005.1 GCA000741775_00845 gene open 132256-133308
1780 JGZR01000005.1 GCA000741775_00846 gene open 133305-134342
1781 JGZR01000005.1 GCA000741775_00847 gene open 134404-135396
1782 JGZR01000005.1 GCA000741775_00848 gene open 135417-137096
1783 JGZR01000005.1 GCA000741775_00849 gene open 137314-138081
1784 JGZR01000005.1 GCA000741775_00850 gene open 138139-139554
1785 JGZR01000005.1 GCA000741775_00851 gene open 139773-140717
1786 JGZR01000005.1 GCA000741775_00852 gene open 141033-142925 glmS
1787 JGZR01000005.1 GCA000741775_00853 gene open 143177-144040
1788 JGZR01000005.1 GCA000741775_00854 gene open 144051-145040
1789 JGZR01000005.1 GCA000741775_00855 gene open 145173-146102
1790 JGZR01000005.1 GCA000741775_00856 gene open 146274-147203
1791 JGZR01000005.1 GCA000741775_00857 gene open 147515-147997 smpB
1792 JGZR01000005.1 GCA000741775_00858 gene open 148213-149628
1793 JGZR01000005.1 GCA000741775_00859 gene open 149882-150805 ftsX
1794 JGZR01000005.1 GCA000741775_00860 gene open 150809-152170 ftsE
1795 JGZR01000005.1 GCA000741775_00861 gene open 152210-153343 prfB
1796 JGZR01000005.1 GCA000741775_00862 gene open 154505-155494 dapD
1797 JGZR01000005.1 GCA000741775_00863 gene open 155728-156234
1798 JGZR01000005.1 GCA000741775_00864 gene open 156527-156778
1799 JGZR01000005.1 GCA000741775_00865 gene open 156798-157037
1800 JGZR01000005.1 GCA000741775_00866 gene open 157060-158079
1801 JGZR01000005.1 GCA000741775_00867 gene open 158217-158552
1802 JGZR01000005.1 GCA000741775_00868 gene open 159152-160444
1803 JGZR01000005.1 GCA000741775_00869 gene open 160893-161669 map
1804 JGZR01000005.1 GCA000741775_00870 gene open 161746-162387
1805 JGZR01000005.1 GCA000741775_00871 gene open 162554-164620
1806 JGZR01000005.1 GCA000741775_00872 gene open 164631-165437
1807 JGZR01000005.1 GCA000741775_00873 gene open 165771-166619
1808 JGZR01000005.1 GCA000741775_00874 gene open 167022-168836
1809 JGZR01000005.1 GCA000741775_00875 gene open 168979-170469
1810 JGZR01000005.1 GCA000741775_00876 gene open 170865-172277
1811 JGZR01000005.1 GCA000741775_00877 gene open 172321-173253
1812 JGZR01000005.1 GCA000741775_00878 gene open 173434-174141 orn
1813 JGZR01000005.1 GCA000741775_00879 gene open 174438-175967 guaB
1814 JGZR01000005.1 GCA000741775_00880 gene open 176186-177550
1815 JGZR01000005.1 GCA000741775_00881 gene open 177547-178206
1816 JGZR01000005.1 GCA000741775_00882 gene open 178735-179964 prmC
1817 JGZR01000005.1 GCA000741775_00883 gene open 180005-181087 prfA
1818 JGZR01000005.1 GCA000741775_00884 gene open 181257-181469 rpmE
1819 JGZR01000005.1 GCA000741775_00886 gene open 182087-182773
1820 JGZR01000005.1 GCA000741775_00887 gene open 183201-184613
1821 JGZR01000005.1 GCA000741775_00888 gene open 185002-185433
1822 JGZR01000005.1 GCA000741775_00889 gene open 185610-186347
1823 JGZR01000005.1 GCA000741775_00890 gene open 186749-188182
1824 JGZR01000005.1 GCA000741775_00891 gene open 188466-188726
1825 JGZR01000005.1 GCA000741775_00892 gene open 188749-189384
1826 JGZR01000005.1 GCA000741775_00893 gene open 189741-190286
1827 JGZR01000005.1 GCA000741775_00894 gene open 190523-191779
1828 JGZR01000005.1 GCA000741775_00895 gene open 191869-192471
1829 JGZR01000005.1 GCA000741775_00896 gene open 192671-193735 asnC
1830 JGZR01000005.1 GCA000741775_00897 gene open 193907-194101 bioY
1831 JGZR01000005.1 GCA000741775_00898 gene open 194120-195256
1832 JGZR01000005.1 GCA000741775_00899 gene open 195440-196660
1833 JGZR01000005.1 GCA000741775_00900 gene open 197060-201646
1834 JGZR01000005.1 GCA000741775_00901 gene open 201850-202500
1835 JGZR01000005.1 GCA000741775_00902 gene open 202697-203725 msrA
1836 JGZR01000005.1 GCA000741775_00903 gene open 203743-204348
1837 JGZR01000005.1 GCA000741775_00904 gene open 205060-205740
1838 JGZR01000005.1 GCA000741775_00905 gene open 205826-206407
1839 JGZR01000005.1 GCA000741775_00906 gene open 206404-207429
1840 JGZR01000005.1 GCA000741775_00907 gene open 207588-208487
1841 JGZR01000005.1 GCA000741775_00908 gene open 208484-209536
1842 JGZR01000005.1 GCA000741775_00909 gene open 209533-211074
1843 JGZR01000005.1 GCA000741775_00910 gene open 211067-211795 gntR
1844 JGZR01000005.1 GCA000741775_00911 gene open 211827-213302 atzF
1845 JGZR01000005.1 GCA000741775_00912 gene open 213690-214394
1846 JGZR01000005.1 GCA000741775_00913 gene open 214513-215679
1847 JGZR01000005.1 GCA000741775_00914 gene open 216089-216820
1848 JGZR01000005.1 GCA000741775_00915 gene open 217450-218004
1849 JGZR01000005.1 GCA000741775_00916 gene open 218129-220453
1850 JGZR01000005.1 GCA000741775_00917 gene open 220443-221222
1851 JGZR01000005.1 GCA000741775_00918 gene open 222023-223198
1852 JGZR01000005.1 GCA000741775_00919 gene open 223195-223461
1853 JGZR01000005.1 GCA000741775_00920 gene open 224077-225348
1854 JGZR01000005.1 GCA000741775_00921 gene open 225561-227138
1855 JGZR01000005.1 GCA000741775_00922 gene open 227350-228759
1856 JGZR01000005.1 GCA000741775_00923 gene open 229281-230633
1857 JGZR01000005.1 GCA000741775_00924 gene open 230715-231155
1858 JGZR01000005.1 GCA000741775_00925 gene open 231439-232302
1859 JGZR01000005.1 GCA000741775_00926 gene open 232670-233083
1860 JGZR01000005.1 GCA000741775_00927 gene open 233815-235041
1861 JGZR01000005.1 GCA000741775_00928 gene open 235957-236727
1862 JGZR01000005.1 GCA000741775_00929 gene open 236762-237952
1863 JGZR01000005.1 GCA000741775_00930 gene open 238419-238925
1864 JGZR01000005.1 GCA000741775_00931 gene open 238922-240025 irrE
1865 JGZR01000005.1 GCA000741775_00932 gene open 240529-240933
1866 JGZR01000005.1 GCA000741775_00933 gene open 242020-242763
1867 JGZR01000005.1 GCA000741775_00934 gene open 242840-244555
1868 JGZR01000005.1 GCA000741775_00935 gene open 244738-245631 rfbA
1869 JGZR01000005.1 GCA000741775_00760 gene open 19962-20026 trnfM
1870 JGZR01000005.1 GCA000741775_00820 gene open 96743-96816 trnR
1871 JGZR01000005.1 GCA000741775_00885 gene open 181793-181866 trnI
1872 JGZR01000005.1 GCA000741775_00760 tRNA open 19962-20026 trnfM tRNA-fMet(cat)
1873 JGZR01000005.1 GCA000741775_00820 tRNA open 96743-96816 trnR tRNA-Arg(tct)
1874 JGZR01000005.1 GCA000741775_00885 tRNA open 181793-181866 trnI tRNA-Ile2(cat)
1875 JGZR01000006.1 rep_origin open 107397-108040
1876 JGZR01000006.1 GCA000741775_01059 gene open 171809-173331 rrs
1877 JGZR01000006.1 GCA000741775_01060 gene open 173778-176847 rrl
1878 JGZR01000006.1 GCA000741775_01061 gene open 177044-177160 rrf
1879 JGZR01000006.1 GCA000741775_01107 gene open 235777-235896 DUF3800-I
1880 JGZR01000006.1 GCA000741775_01376 gene open 577930-578026 Bacteria_small_SRP
1881 JGZR01000006.1 GCA000741775_01107 ncRNA open 235777-235896 DUF3800-I RNA
1882 JGZR01000006.1 GCA000741775_01376 ncRNA open 577930-578026 Bacterial small signal recognition particle RNA
1883 JGZR01000006.1 regulatory_region open 53481-53539 msiK RNA
1884 JGZR01000006.1 regulatory_region open 227799-227872 Fluoride riboswitch aptamer (crcB RNA motif)
1885 JGZR01000006.1 regulatory_region open 503070-503166 TPP riboswitch aptamer (THI element)
1886 JGZR01000006.1 GCA000741775_01059 rRNA open 171809-173331 rrs 16S ribosomal RNA
1887 JGZR01000006.1 GCA000741775_01060 rRNA open 173778-176847 rrl 23S ribosomal RNA
1888 JGZR01000006.1 GCA000741775_01061 rRNA open 177044-177160 rrf 5S ribosomal RNA
1889 JGZR01000006.1 repeat_region open 625210-628951 CRISPR array with 58 repeats of length 31%2C consensus sequence GTCGCTCCCTCACGGGAGCGTGGATTGAAAT and spacer length 33
1890 JGZR01000006.1 GCA000741775_00936 CDS open 1671-4160 _na     829_aa Glycosyl transferase group 2 family protein
1891 JGZR01000006.1 GCA000741775_00937 CDS open 4052-5155 _na     367_aa Putative endoglucanase
1892 JGZR01000006.1 GCA000741775_00938 CDS open 5281-6540 _na     419_aa Beta-mannanase
1893 JGZR01000006.1 GCA000741775_00939 CDS open 6544-7395 _na     283_aa Aldo/keto reductase
1894 JGZR01000006.1 GCA000741775_00940 CDS open 7651-8274 _na     207_aa tetR TetR family transcriptional regulator
1895 JGZR01000006.1 GCA000741775_00941 CDS open 8271-9575 _na     434_aa Major facilitator superfamily MFS_1
1896 JGZR01000006.1 GCA000741775_00942 CDS open 9635-10597 _na     320_aa Orotate transport protein
1897 JGZR01000006.1 GCA000741775_00943 CDS open 10636-10980 _na     114_aa Putative beta-glucosidase
1898 JGZR01000006.1 GCA000741775_00944 CDS open 11295-12563 _na     422_aa ISL3 family transposase
1899 JGZR01000006.1 GCA000741775_00945 CDS open 13018-14781 _na     587_aa Membrane protein
1900 JGZR01000006.1 GCA000741775_00946 CDS open 14801-16276 _na     491_aa Putative membrane protein
1901 JGZR01000006.1 GCA000741775_00947 CDS open 16273-17907 _na     544_aa Copper-containing nitrite reductase
1902 JGZR01000006.1 GCA000741775_00948 CDS open 18387-19103 _na     238_aa Zeta toxin
1903 JGZR01000006.1 GCA000741775_00949 CDS open 19084-19281 _na     65_aa hypothetical protein
1904 JGZR01000006.1 GCA000741775_00950 CDS open 19513-20403 _na     296_aa Beta-hydroxyacid dehydrogenase%2C 3-hydroxyisobutyrate dehydrogenase
1905 JGZR01000006.1 GCA000741775_00951 CDS open 21073-22464 _na     463_aa gabT 4-aminobutyrate--2-oxoglutarate transaminase
1906 JGZR01000006.1 GCA000741775_00952 CDS open 22564-23427 _na     287_aa glnQ Glutamine transport ATP-binding protein GlnQ
1907 JGZR01000006.1 GCA000741775_00953 CDS open 23414-24046 _na     210_aa Polar amino acid ABC transporter inner membrane subunit
1908 JGZR01000006.1 GCA000741775_00954 CDS open 24146-24952 _na     268_aa ABC polar amino acid transporter%2C periplasmic ligand binding protein
1909 JGZR01000006.1 GCA000741775_00955 CDS open 25492-27144 _na     550_aa DNA-binding protein
1910 JGZR01000006.1 GCA000741775_00956 CDS open 27195-27416 _na     73_aa hicB Putative HicB family protein
1911 JGZR01000006.1 GCA000741775_00957 CDS open 27631-30861 _na     1076_aa Glycosyl hydrolase family 65 central catalytic domain protein
1912 JGZR01000006.1 GCA000741775_00958 CDS open 31202-32560 _na     452_aa LPXTG-motif cell wall anchor domain-containing protein
1913 JGZR01000006.1 GCA000741775_00959 CDS open 32708-33445 _na     245_aa Outer membrane protein
1914 JGZR01000006.1 GCA000741775_00960 CDS open 34006-34875 _na     289_aa Haloacid dehalogenase-like hydrolase
1915 JGZR01000006.1 GCA000741775_00961 CDS open 34869-36659 _na     596_aa Putative oligo-1%2C6-glucosidase
1916 JGZR01000006.1 GCA000741775_00962 CDS open 37146-38468 _na     440_aa Sugar-binding secreted protein
1917 JGZR01000006.1 GCA000741775_00963 CDS open 38612-40102 _na     496_aa Maltose/maltodextrin transport system permease protein
1918 JGZR01000006.1 GCA000741775_00964 CDS open 40099-41034 _na     311_aa ABC transporter permease
1919 JGZR01000006.1 GCA000741775_00965 CDS open 41166-41996 _na     276_aa ABC transporter permease
1920 JGZR01000006.1 GCA000741775_00966 CDS open 42100-42279 _na     59_aa Phosphoglycerate mutase
1921 JGZR01000006.1 GCA000741775_00967 CDS open 42841-43584 _na     247_aa Esterase
1922 JGZR01000006.1 GCA000741775_00968 CDS open 43697-44617 _na     306_aa hypothetical protein
1923 JGZR01000006.1 GCA000741775_00969 CDS open 45286-45867 _na     193_aa dcd dCTP deaminase
1924 JGZR01000006.1 GCA000741775_00970 CDS open 45980-49093 _na     1037_aa Haloacid dehalogenase
1925 JGZR01000006.1 GCA000741775_00971 CDS open 49585-50586 _na     333_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
1926 JGZR01000006.1 GCA000741775_00972 CDS open 50721-52181 _na     486_aa Lipopolysaccharide kinase
1927 JGZR01000006.1 GCA000741775_00973 CDS open 52352-53479 _na     375_aa malK ABC transporter ATP-binding component
1928 JGZR01000006.1 GCA000741775_00974 CDS open 53877-54596 _na     239_aa LytTR family transcriptional regulator
1929 JGZR01000006.1 GCA000741775_00975 CDS open 54593-55927 _na     444_aa Histidine kinase
1930 JGZR01000006.1 GCA000741775_00976 CDS open 55979-56620 _na     213_aa PTS system cellobiose-specific transporter subunit IIC
1931 JGZR01000006.1 GCA000741775_00977 CDS open 56617-59163 _na     848_aa Glycosyl hydrolase family 3%2C N-terminal domain protein
1932 JGZR01000006.1 GCA000741775_00978 CDS open 59711-61774 _na     687_aa Beta-glucosidase-related glycosidase
1933 JGZR01000006.1 GCA000741775_00979 CDS open 62012-62884 _na     290_aa Mutator family transposase
1934 JGZR01000006.1 GCA000741775_00980 CDS open 63538-64575 _na     345_aa Family 2 glycosyl transferase
1935 JGZR01000006.1 GCA000741775_00981 CDS open 65238-66101 _na     287_aa Methylglyoxal reductase (NADPH-dependent)
1936 JGZR01000006.1 GCA000741775_00982 CDS open 66317-66916 _na     199_aa Regulatory protein
1937 JGZR01000006.1 GCA000741775_00983 CDS open 67104-67502 _na     132_aa Cupin
1938 JGZR01000006.1 GCA000741775_00984 CDS open 67590-67946 _na     118_aa 4-carboxymuconolactone decarboxylase
1939 JGZR01000006.1 GCA000741775_00985 CDS open 68007-68753 _na     248_aa CTP synthase
1940 JGZR01000006.1 GCA000741775_00986 CDS open 69388-71754 _na     788_aa non-specific serine/threonine protein kinase
1941 JGZR01000006.1 GCA000741775_00987 CDS open 71923-72906 _na     327_aa DSBA oxidoreductase
1942 JGZR01000006.1 GCA000741775_00989 CDS open 73839-75320 _na     493_aa Lytic transglycosylase
1943 JGZR01000006.1 GCA000741775_00990 CDS open 75320-76474 _na     384_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
1944 JGZR01000006.1 GCA000741775_00991 CDS open 76471-77097 _na     208_aa LytR/CpsA/Psr regulator C-terminal domain-containing protein
1945 JGZR01000006.1 GCA000741775_00992 CDS open 77459-78886 _na     475_aa CCA tRNA nucleotidyltransferase
1946 JGZR01000006.1 GCA000741775_00993 CDS open 78969-79703 _na     244_aa Phosphohydrolase
1947 JGZR01000006.1 GCA000741775_00994 CDS open 79667-81136 _na     489_aa DUF6049 domain-containing protein
1948 JGZR01000006.1 GCA000741775_00995 CDS open 81136-81987 _na     283_aa DUF6049 domain-containing protein
1949 JGZR01000006.1 GCA000741775_00996 CDS open 81984-86264 _na     1426_aa mviN Putative integral membrane protein MviN
1950 JGZR01000006.1 GCA000741775_00997 CDS open 86458-86955 _na     165_aa GNAT family acetyltransferase
1951 JGZR01000006.1 GCA000741775_00998 CDS open 87010-87810 _na     266_aa ABC transporter permease
1952 JGZR01000006.1 GCA000741775_00999 CDS open 87826-88749 _na     307_aa ABC transporter%2C permease domain protein
1953 JGZR01000006.1 GCA000741775_01000 CDS open 89034-90362 _na     442_aa ABC transporter substrate-binding protein
1954 JGZR01000006.1 GCA000741775_01001 CDS open 90706-91821 _na     371_aa Ser/Thr phosphatase family protein
1955 JGZR01000006.1 GCA000741775_01002 CDS open 92158-93480 _na     440_aa gntR Putative transcriptional regulator%2C GntR family
1956 JGZR01000006.1 GCA000741775_01003 CDS open 93599-94765 _na     388_aa D-alanine--D-alanine ligase
1957 JGZR01000006.1 GCA000741775_01004 CDS open 94906-95847 _na     313_aa trxB thioredoxin-disulfide reductase
1958 JGZR01000006.1 GCA000741775_01005 CDS open 96080-97714 _na     544_aa Chromosome partitioning protein
1959 JGZR01000006.1 GCA000741775_01006 CDS open 97716-98660 _na     314_aa Chromosome partitioning protein PrA
1960 JGZR01000006.1 GCA000741775_01007 CDS open 100034-100720 _na     228_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
1961 JGZR01000006.1 GCA000741775_01008 CDS open 102020-102739 _na     239_aa Jag protein
1962 JGZR01000006.1 GCA000741775_01009 CDS open 103294-104310 _na     338_aa yidC membrane protein insertase YidC
1963 JGZR01000006.1 GCA000741775_01010 CDS open 104327-104626 _na     99_aa yidD membrane protein insertion efficiency factor YidD
1964 JGZR01000006.1 GCA000741775_01011 CDS open 104623-105372 _na     249_aa rnpA ribonuclease P protein component
1965 JGZR01000006.1 GCA000741775_01012 CDS open 105711-107396 _na     561_aa dnaA chromosomal replication initiator protein DnaA
1966 JGZR01000006.1 GCA000741775_01013 CDS open 108041-109165 _na     374_aa dnaN DNA polymerase III subunit beta
1967 JGZR01000006.1 GCA000741775_01014 CDS open 109340-110839 _na     499_aa recF DNA replication/repair protein RecF
1968 JGZR01000006.1 GCA000741775_01015 CDS open 110836-111324 _na     162_aa Zn-ribbon-containing RNA-binding protein
1969 JGZR01000006.1 GCA000741775_01016 CDS open 111472-113640 _na     722_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
1970 JGZR01000006.1 GCA000741775_01017 CDS open 113900-116626 _na     908_aa gyrA DNA gyrase subunit A
1971 JGZR01000006.1 GCA000741775_01018 CDS open 116756-117484 _na     242_aa Membrane protein
1972 JGZR01000006.1 GCA000741775_01019 CDS open 117597-118706 _na     369_aa vanZ Teicoplanin resistance protein VanZ
1973 JGZR01000006.1 GCA000741775_01020 CDS open 118701-120047 _na     448_aa gdhA NADP-specific glutamate dehydrogenase
1974 JGZR01000006.1 GCA000741775_01021 CDS open 120534-121535 _na     333_aa Lactate dehydrogenase
1975 JGZR01000006.1 GCA000741775_01022 CDS open 121877-122887 _na     336_aa Transcriptional regulator
1976 JGZR01000006.1 GCA000741775_01023 CDS open 123256-124563 _na     435_aa Sugar ABC transporter substrate-binding protein
1977 JGZR01000006.1 GCA000741775_01024 CDS open 124863-126086 _na     407_aa cebF Cellodextrin transport system permease protein CebF
1978 JGZR01000006.1 GCA000741775_01025 CDS open 126083-127093 _na     336_aa Putative sugar transport integral membrane protein
1979 JGZR01000006.1 GCA000741775_01026 CDS open 127123-128532 _na     469_aa GH1 family beta-glucosidase
1980 JGZR01000006.1 GCA000741775_01027 CDS open 128640-129065 _na     141_aa mscL large conductance mechanosensitive channel protein MscL
1981 JGZR01000006.1 GCA000741775_01028 CDS open 129474-129878 _na     134_aa hypothetical protein
1982 JGZR01000006.1 GCA000741775_01029 CDS open 130126-130266 _na     46_aa hypothetical protein
1983 JGZR01000006.1 GCA000741775_01030 CDS open 130236-131150 _na     304_aa Fimbrial protein
1984 JGZR01000006.1 GCA000741775_01031 CDS open 131322-133400 _na     692_aa Sodium:proton antiporter
1985 JGZR01000006.1 GCA000741775_01032 CDS open 134118-134318 _na     66_aa CMP deaminase
1986 JGZR01000006.1 GCA000741775_01033 CDS open 134440-136689 _na     749_aa alpha-galactosidase
1987 JGZR01000006.1 GCA000741775_01034 CDS open 136772-138046 _na     424_aa nagC NagC family transcriptional regulator
1988 JGZR01000006.1 GCA000741775_01035 CDS open 138292-139584 _na     430_aa Raffinose-binding protein
1989 JGZR01000006.1 GCA000741775_01036 CDS open 139607-140557 _na     316_aa Sugar ABC transporter permease
1990 JGZR01000006.1 GCA000741775_01037 CDS open 140622-141521 _na     299_aa Carbohydrate ABC transporter permease
1991 JGZR01000006.1 GCA000741775_01038 CDS open 142028-142381 _na     117_aa copG Ribbon-helix-helix protein CopG domain-containing protein
1992 JGZR01000006.1 GCA000741775_01039 CDS open 142452-143549 _na     365_aa rpiR RpiR family transcriptional regulatory protein
1993 JGZR01000006.1 GCA000741775_01040 CDS open 143751-145343 _na     530_aa Cytosine/uracil/thiamine/allantoin permease
1994 JGZR01000006.1 GCA000741775_01041 CDS open 145515-146252 _na     245_aa Hydantoin racemase
1995 JGZR01000006.1 GCA000741775_01042 CDS open 146370-147593 _na     407_aa Serine--pyruvate transaminase
1996 JGZR01000006.1 GCA000741775_01043 CDS open 147590-147682 _na     30_aa hypothetical protein
1997 JGZR01000006.1 GCA000741775_01044 CDS open 147702-149009 _na     435_aa Hydantoinase/carbamoylase family amidase
1998 JGZR01000006.1 GCA000741775_01045 CDS open 149165-150604 _na     479_aa allB allantoinase AllB
1999 JGZR01000006.1 GCA000741775_01046 CDS open 150685-153345 _na     886_aa Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit A
2000 JGZR01000006.1 GCA000741775_01047 CDS open 153342-154553 _na     403_aa hipA HipA N-terminal domain protein