HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Bifidobacterium subtile (GCA_000741775.1)

Select a Genome:
BAKTA Annotations for GCA_000741775.1
Genome Selected: Bifidobacterium subtile
ContigsBases CDSrRNA tmRNAtRNA
27 2790088 2274 4 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4674 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:9]    |    Number of Records Found: 4674 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4001 JGZR01000016.1 regulatory_region open 231489-231591 TPP riboswitch aptamer (THI element)
4002 JGZR01000016.1 repeat_region open 311307-314545 CRISPR array with 50 repeats of length 31%2C consensus sequence ATTTCAATCCACGCTCCCGTGAGGGAGCGAC and spacer length 34
4003 JGZR01000016.1 GCA000741775_01995 CDS open 96-1277 _na     393_aa hypothetical protein
4004 JGZR01000016.1 GCA000741775_01996 CDS open 1096-3873 _na     925_aa hypothetical protein
4005 JGZR01000016.1 GCA000741775_01997 CDS open 4277-4765 _na     162_aa hypothetical protein
4006 JGZR01000016.1 GCA000741775_01998 CDS open 4790-5503 _na     237_aa hypothetical protein
4007 JGZR01000016.1 GCA000741775_01999 CDS open 6026-6295 _na     89_aa hypothetical protein
4008 JGZR01000016.1 GCA000741775_02000 CDS open 6292-7170 _na     292_aa Mobilization protein
4009 JGZR01000016.1 GCA000741775_02001 CDS open 7574-8185 _na     203_aa hypothetical protein
4010 JGZR01000016.1 GCA000741775_02002 CDS open 8216-8524 _na     102_aa hypothetical protein
4011 JGZR01000016.1 GCA000741775_02003 CDS open 8929-10488 _na     519_aa parB Chromosome partitioning protein parB
4012 JGZR01000016.1 GCA000741775_02004 CDS open 10509-11126 _na     205_aa hypothetical protein
4013 JGZR01000016.1 GCA000741775_02005 CDS open 11615-11833 _na     72_aa Glutaredoxin
4014 JGZR01000016.1 GCA000741775_02006 CDS open 12583-13119 _na     178_aa hypothetical protein
4015 JGZR01000016.1 GCA000741775_02007 CDS open 13273-13497 _na     74_aa sdhE FAD assembly factor SdhE
4016 JGZR01000016.1 GCA000741775_02008 CDS open 13488-13712 _na     74_aa hypothetical protein
4017 JGZR01000016.1 GCA000741775_02009 CDS open 14151-14480 _na     109_aa DUF4258 domain-containing protein
4018 JGZR01000016.1 GCA000741775_02010 CDS open 14507-14848 _na     113_aa Toxin-antitoxin system protein
4019 JGZR01000016.1 GCA000741775_02011 CDS open 14885-15073 _na     62_aa hypothetical protein
4020 JGZR01000016.1 GCA000741775_02012 CDS open 15415-16401 _na     328_aa Zeta toxin domain-containing protein
4021 JGZR01000016.1 GCA000741775_02013 CDS open 16404-16685 _na     93_aa hypothetical protein
4022 JGZR01000016.1 GCA000741775_02014 CDS open 16750-17109 _na     119_aa Single-stranded DNA-binding protein
4023 JGZR01000016.1 GCA000741775_02015 CDS open 17313-17549 _na     78_aa hypothetical protein
4024 JGZR01000016.1 GCA000741775_02016 CDS open 17546-18142 _na     198_aa Peptide transporter
4025 JGZR01000016.1 GCA000741775_02017 CDS open 18441-19361 _na     306_aa PD-(D/E)XK endonuclease-like domain-containing protein
4026 JGZR01000016.1 GCA000741775_02018 CDS open 19679-19837 _na     52_aa hypothetical protein
4027 JGZR01000016.1 GCA000741775_02019 CDS open 19903-20766 _na     287_aa DNA integration/recombination/inversion protein
4028 JGZR01000016.1 GCA000741775_02020 CDS open 21181-21408 _na     75_aa feoA FeoA family protein
4029 JGZR01000016.1 GCA000741775_02021 CDS open 21542-23935 _na     797_aa feoB ferrous iron transport protein B
4030 JGZR01000016.1 GCA000741775_02022 CDS open 23932-24357 _na     141_aa Peptidase
4031 JGZR01000016.1 GCA000741775_02023 CDS open 24981-26462 _na     493_aa N-ethylammeline chlorohydrolase
4032 JGZR01000016.1 GCA000741775_02024 CDS open 26632-28251 _na     539_aa Extracellular solute-binding protein family 5
4033 JGZR01000016.1 GCA000741775_02025 CDS open 28308-29240 _na     310_aa Diguanylate cyclase
4034 JGZR01000016.1 GCA000741775_02026 CDS open 29242-30174 _na     310_aa nikB nickel ABC transporter permease
4035 JGZR01000016.1 GCA000741775_02027 CDS open 30168-31241 _na     357_aa Peptide ABC transporter ATP-binding protein
4036 JGZR01000016.1 GCA000741775_02028 CDS open 31238-32266 _na     342_aa Oligopeptide/dipeptide ABC transporter ATPase
4037 JGZR01000016.1 GCA000741775_02029 CDS open 32315-33529 _na     404_aa Putative amidohydrolase family protein
4038 JGZR01000016.1 GCA000741775_02030 CDS open 33841-34824 _na     327_aa Ornithine cyclodeaminase
4039 JGZR01000016.1 GCA000741775_02031 CDS open 35253-36761 _na     502_aa Transcriptional regulator
4040 JGZR01000016.1 GCA000741775_02032 CDS open 37035-38510 _na     491_aa lpqU Putative lipoprotein LpqU
4041 JGZR01000016.1 GCA000741775_02033 CDS open 38507-40159 _na     550_aa anchored repeat-type ABC transporter permease subunit
4042 JGZR01000016.1 GCA000741775_02034 CDS open 40156-41757 _na     533_aa anchored repeat ABC transporter%2C substrate-binding protein
4043 JGZR01000016.1 GCA000741775_02035 CDS open 41757-44486 _na     909_aa Putative surface-anchored protein
4044 JGZR01000016.1 GCA000741775_02036 CDS open 44708-45778 _na     356_aa Actinobacterial surface-anchored protein domain protein
4045 JGZR01000016.1 GCA000741775_02038 CDS open 47179-48153 _na     324_aa ArgP/LysG family DNA-binding transcriptional regulator
4046 JGZR01000016.1 GCA000741775_02039 CDS open 48471-49397 _na     308_aa lysE Lysine transporter LysE
4047 JGZR01000016.1 GCA000741775_02040 CDS open 49664-51103 _na     479_aa ATPase
4048 JGZR01000016.1 GCA000741775_02041 CDS open 51242-52690 _na     482_aa Putative transcriptional regulator
4049 JGZR01000016.1 GCA000741775_02042 CDS open 53642-54571 _na     309_aa DUF1684 domain-containing protein
4050 JGZR01000016.1 GCA000741775_02043 CDS open 54757-55596 _na     279_aa hypothetical protein
4051 JGZR01000016.1 GCA000741775_02044 CDS open 55812-57233 _na     473_aa glcD Glycolate oxidase%2C subunit GlcD
4052 JGZR01000016.1 GCA000741775_02045 CDS open 57319-58260 _na     313_aa NLPA lipoprotein
4053 JGZR01000016.1 GCA000741775_02046 CDS open 58292-58978 _na     228_aa Methionine ABC transporter permease
4054 JGZR01000016.1 GCA000741775_02047 CDS open 58975-60036 _na     353_aa Methionine ABC transporter ATP-binding protein
4055 JGZR01000016.1 GCA000741775_02048 CDS open 60068-61021 _na     317_aa DUF1684 domain-containing protein
4056 JGZR01000016.1 GCA000741775_02049 CDS open 61428-62345 _na     305_aa Solute-binding protein family 3/N-terminal domain-containing protein
4057 JGZR01000016.1 GCA000741775_02050 CDS open 62459-63439 _na     326_aa tcyL L-cystine transport system permease protein TcyL
4058 JGZR01000016.1 GCA000741775_02051 CDS open 63542-64291 _na     249_aa tcyN L-cystine ABC transporter%2C ATP-binding protein TcyN
4059 JGZR01000016.1 GCA000741775_02052 CDS open 64295-65164 _na     289_aa Sortase
4060 JGZR01000016.1 GCA000741775_02053 CDS open 65265-66191 _na     308_aa DUF1684 domain-containing protein
4061 JGZR01000016.1 GCA000741775_02054 CDS open 66440-66838 _na     132_aa DNA-binding protein
4062 JGZR01000016.1 GCA000741775_02055 CDS open 67144-68676 _na     510_aa Transcriptional regulator
4063 JGZR01000016.1 GCA000741775_02056 CDS open 69416-69973 _na     185_aa DUF1697 domain-containing protein
4064 JGZR01000016.1 GCA000741775_02057 CDS open 70241-71104 _na     287_aa merR Transcriptional regulator%2C MerR family
4065 JGZR01000016.1 GCA000741775_02058 CDS open 71208-71840 _na     210_aa Dimethyladenosine transferase
4066 JGZR01000016.1 GCA000741775_02059 CDS open 71853-72302 _na     149_aa merR MerR family regulatory protein
4067 JGZR01000016.1 GCA000741775_02060 CDS open 72427-73839 _na     470_aa Nramp family divalent metal transporter
4068 JGZR01000016.1 GCA000741775_02061 CDS open 74212-75549 _na     445_aa ABC transporter permease
4069 JGZR01000016.1 GCA000741775_02062 CDS open 75546-77156 _na     536_aa ABC transporter ATP-binding protein
4070 JGZR01000016.1 GCA000741775_02063 CDS open 77336-78463 _na     375_aa Phosphohydrolase
4071 JGZR01000016.1 GCA000741775_02064 CDS open 78625-79494 _na     289_aa Glutamine amidotransferase
4072 JGZR01000016.1 GCA000741775_02065 CDS open 79566-82244 _na     892_aa putative potassium transport system protein Kup
4073 JGZR01000016.1 GCA000741775_02066 CDS open 82703-83710 _na     335_aa tatD TatD family hydrolase
4074 JGZR01000016.1 GCA000741775_02067 CDS open 83912-86833 _na     973_aa Transporter%2C probably putative Ca2 ATPase%2C Pmo1
4075 JGZR01000016.1 GCA000741775_02068 CDS open 87897-89813 _na     638_aa Methionine--tRNA ligase
4076 JGZR01000016.1 GCA000741775_02069 CDS open 89963-90673 _na     236_aa AbiEi antitoxin C-terminal domain-containing protein
4077 JGZR01000016.1 GCA000741775_02070 CDS open 90684-91478 _na     264_aa hypothetical protein
4078 JGZR01000016.1 GCA000741775_02071 CDS open 91767-93539 _na     590_aa Permease of the major facilitator superfamily
4079 JGZR01000016.1 GCA000741775_02072 CDS open 93699-94763 _na     354_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
4080 JGZR01000016.1 GCA000741775_02073 CDS open 95097-96854 _na     585_aa Dolichyl-phosphate-mannose--protein mannosyltransferase
4081 JGZR01000016.1 GCA000741775_02074 CDS open 97334-98020 _na     228_aa dedA DedA integral membrane protein
4082 JGZR01000016.1 GCA000741775_02075 CDS open 98489-99715 _na     408_aa CTP synthase
4083 JGZR01000016.1 GCA000741775_02077 CDS open 100139-101266 _na     375_aa IS1249 family transposase
4084 JGZR01000016.1 GCA000741775_02078 CDS open 101888-102133 _na     81_aa Transposase
4085 JGZR01000016.1 GCA000741775_02079 CDS open 102317-102928 _na     203_aa hypothetical protein
4086 JGZR01000016.1 GCA000741775_02080 CDS open 102931-106548 _na     1205_aa S-layer domain protein
4087 JGZR01000016.1 GCA000741775_02081 CDS open 107914-108195 _na     93_aa helix-turn-helix domain-containing protein
4088 JGZR01000016.1 GCA000741775_02082 CDS open 108529-110064 _na     511_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
4089 JGZR01000016.1 GCA000741775_02083 CDS open 110440-111654 _na     404_aa cysteine-S-conjugate beta-lyase
4090 JGZR01000016.1 GCA000741775_02084 CDS open 112081-112302 _na     73_aa Binding-protein-dependent transport system inner membrane protein
4091 JGZR01000016.1 GCA000741775_02085 CDS open 112394-113488 _na     364_aa Lysophospholipase L2
4092 JGZR01000016.1 GCA000741775_02086 CDS open 113608-114666 _na     352_aa FAD-binding 9 siderophore-interacting domain protein
4093 JGZR01000016.1 GCA000741775_02087 CDS open 114663-115670 _na     335_aa ABC transporter%2C ATP binding protein%2C probably Coelichelin uptake porter (Iron Chelate Uptake)
4094 JGZR01000016.1 GCA000741775_02088 CDS open 115670-116824 _na     384_aa ABC transporter%2C permease protein%2C probably Coelichelin uptake porter (Iron Chelate Uptake)
4095 JGZR01000016.1 GCA000741775_02089 CDS open 116827-117975 _na     382_aa ABC transporter%2C permease protein
4096 JGZR01000016.1 GCA000741775_02090 CDS open 118052-119191 _na     379_aa ABC transporter%2C extracellular substrate binding protein
4097 JGZR01000016.1 GCA000741775_02091 CDS open 119603-122485 _na     960_aa Dipeptidyl peptidase
4098 JGZR01000016.1 GCA000741775_02092 CDS open 122625-123902 _na     425_aa Sam-dependent methyltransferase
4099 JGZR01000016.1 GCA000741775_02093 CDS open 124223-124918 _na     231_aa Membrane protein
4100 JGZR01000016.1 GCA000741775_02094 CDS open 125076-125294 _na     72_aa Secreted protein
4101 JGZR01000016.1 GCA000741775_02095 CDS open 125488-125586 _na     32_aa hypothetical protein
4102 JGZR01000016.1 GCA000741775_02096 CDS open 125583-126599 _na     338_aa Signal transduction histidine kinase subgroup 3 dimerisation and phosphoacceptor domain-containing protein
4103 JGZR01000016.1 GCA000741775_02097 CDS open 126599-129253 _na     884_aa luxR LuxR family transcriptional regulator
4104 JGZR01000016.1 GCA000741775_02098 CDS open 129479-130210 _na     243_aa hypothetical protein
4105 JGZR01000016.1 GCA000741775_02099 CDS open 130488-132023 _na     511_aa MFS transporter
4106 JGZR01000016.1 GCA000741775_02100 CDS open 132319-134775 _na     818_aa Alpha-1%2C4 glucan phosphorylase
4107 JGZR01000016.1 GCA000741775_02101 CDS open 135103-135735 _na     210_aa Bacterial SCP orthologue domain-containing protein
4108 JGZR01000016.1 GCA000741775_02102 CDS open 135956-136777 _na     273_aa His/Glu/Gln/Arg/opine family amino ABC transporter%2C permease%2C 3-TM region
4109 JGZR01000016.1 GCA000741775_02103 CDS open 136768-137448 _na     226_aa Amino acid ABC transporter permease
4110 JGZR01000016.1 GCA000741775_02104 CDS open 137801-138775 _na     324_aa ABC transporter substrate-binding protein
4111 JGZR01000016.1 GCA000741775_02105 CDS open 139064-139795 _na     243_aa NADPH:quinone reductase
4112 JGZR01000016.1 GCA000741775_02106 CDS open 140158-140835 _na     225_aa DUF3073 domain-containing protein
4113 JGZR01000016.1 GCA000741775_02107 CDS open 140990-142081 _na     363_aa trpS tryptophan--tRNA ligase
4114 JGZR01000016.1 GCA000741775_02108 CDS open 142316-144142 _na     608_aa Membrane protein
4115 JGZR01000016.1 GCA000741775_02109 CDS open 144307-147060 _na     917_aa Phosphoenolpyruvate carboxylase
4116 JGZR01000016.1 GCA000741775_02110 CDS open 147439-148125 _na     228_aa Carbonic anhydrase
4117 JGZR01000016.1 GCA000741775_02111 CDS open 148960-150102 _na     380_aa ATPase AAA
4118 JGZR01000016.1 GCA000741775_02112 CDS open 150332-151726 _na     464_aa Putative transport protein
4119 JGZR01000016.1 GCA000741775_02113 CDS open 152504-152983 _na     159_aa Ferritin%2C Dps family protein
4120 JGZR01000016.1 GCA000741775_02114 CDS open 153408-154172 _na     254_aa Short-chain dehydrogenase/reductase SDR
4121 JGZR01000016.1 GCA000741775_02115 CDS open 154373-154726 _na     117_aa mobF MobF family relaxase
4122 JGZR01000016.1 GCA000741775_02116 CDS open 154832-154987 _na     51_aa Transposase
4123 JGZR01000016.1 GCA000741775_02117 CDS open 155292-155918 _na     208_aa arsR ArsR family transcriptional regulator
4124 JGZR01000016.1 GCA000741775_02118 CDS open 156099-156962 _na     287_aa dprA DNA protecting protein DprA
4125 JGZR01000016.1 GCA000741775_02119 CDS open 157166-157501 _na     111_aa Sulfate permease
4126 JGZR01000016.1 GCA000741775_02120 CDS open 157538-157927 _na     129_aa Resolvase/invertase-type recombinase catalytic domain-containing protein
4127 JGZR01000016.1 GCA000741775_02121 CDS open 158117-158698 _na     193_aa Resolvase
4128 JGZR01000016.1 GCA000741775_02122 CDS open 159035-159499 _na     154_aa hypothetical protein
4129 JGZR01000016.1 GCA000741775_02123 CDS open 159514-160296 _na     260_aa hypothetical protein
4130 JGZR01000016.1 GCA000741775_02124 CDS open 160344-161723 _na     459_aa ATPase AAA
4131 JGZR01000016.1 GCA000741775_02125 CDS open 162223-163272 _na     349_aa lysR LysR family transcriptional regulator
4132 JGZR01000016.1 GCA000741775_02126 CDS open 163322-164632 _na     436_aa MFS superfamily transporter
4133 JGZR01000016.1 GCA000741775_02127 CDS open 164760-165140 _na     126_aa mRNA interferase
4134 JGZR01000016.1 GCA000741775_02128 CDS open 165137-165397 _na     86_aa PemI-like protein
4135 JGZR01000016.1 GCA000741775_02129 CDS open 165682-166815 _na     377_aa mutM bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase
4136 JGZR01000016.1 GCA000741775_02130 CDS open 167122-167502 _na     126_aa Membrane associated protein
4137 JGZR01000016.1 GCA000741775_02131 CDS open 167757-168350 _na     197_aa DUF1541 domain-containing protein
4138 JGZR01000016.1 GCA000741775_02132 CDS open 168652-169485 _na     277_aa Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen
4139 JGZR01000016.1 GCA000741775_02133 CDS open 169466-170428 _na     320_aa Cytochrome c biogenesis protein%2C transmembrane region
4140 JGZR01000016.1 GCA000741775_02134 CDS open 170431-170832 _na     133_aa Glutaredoxin
4141 JGZR01000016.1 GCA000741775_02135 CDS open 171053-171802 _na     249_aa Transcriptional regulator
4142 JGZR01000016.1 GCA000741775_02136 CDS open 171799-173091 _na     430_aa histidine kinase
4143 JGZR01000016.1 GCA000741775_02137 CDS open 173066-173536 _na     156_aa DUF2933 domain-containing protein
4144 JGZR01000016.1 GCA000741775_02138 CDS open 173824-174459 _na     211_aa lysE Translocator protein%2C LysE family
4145 JGZR01000016.1 GCA000741775_02139 CDS open 174596-175207 _na     203_aa RES domain-containing protein
4146 JGZR01000016.1 GCA000741775_02140 CDS open 175207-175845 _na     212_aa XRE family transcriptional regulator
4147 JGZR01000016.1 GCA000741775_02141 CDS open 175961-176740 _na     259_aa DUF1829 domain-containing protein
4148 JGZR01000016.1 GCA000741775_02142 CDS open 176997-178106 _na     369_aa Cell division protein
4149 JGZR01000016.1 GCA000741775_02143 CDS open 178106-179671 _na     521_aa murC UDP-N-acetylmuramate--L-alanine ligase
4150 JGZR01000016.1 GCA000741775_02144 CDS open 179861-181051 _na     396_aa UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase
4151 JGZR01000016.1 GCA000741775_02145 CDS open 181067-182470 _na     467_aa ftsW putative peptidoglycan glycosyltransferase FtsW
4152 JGZR01000016.1 GCA000741775_02146 CDS open 182457-183950 _na     497_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
4153 JGZR01000016.1 GCA000741775_02147 CDS open 184037-185125 _na     362_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
4154 JGZR01000016.1 GCA000741775_02148 CDS open 185191-186774 _na     527_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
4155 JGZR01000016.1 GCA000741775_02149 CDS open 186809-187690 _na     293_aa UDP-N-acetylmuramyl peptide synthase
4156 JGZR01000016.1 GCA000741775_02150 CDS open 187716-189503 _na     595_aa Peptidoglycan synthetase FtsI%2C penicillin-binding protein
4157 JGZR01000016.1 GCA000741775_02151 CDS open 189496-189954 _na     152_aa ftsL Cell division protein FtsL
4158 JGZR01000016.1 GCA000741775_02152 CDS open 189954-191015 _na     353_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
4159 JGZR01000016.1 GCA000741775_02153 CDS open 191015-191554 _na     179_aa mraZ division/cell wall cluster transcriptional repressor MraZ
4160 JGZR01000016.1 GCA000741775_02154 CDS open 191777-194056 _na     759_aa ATP-dependent DNA helicase
4161 JGZR01000016.1 GCA000741775_02155 CDS open 194058-195266 _na     402_aa serA phosphoglycerate dehydrogenase
4162 JGZR01000016.1 GCA000741775_02156 CDS open 195530-196102 _na     190_aa nrdR transcriptional regulator NrdR
4163 JGZR01000016.1 GCA000741775_02157 CDS open 196177-196563 _na     128_aa Peptidoglycan-binding protein
4164 JGZR01000016.1 GCA000741775_02158 CDS open 196813-197526 _na     237_aa lexA transcriptional repressor LexA
4165 JGZR01000016.1 GCA000741775_02159 CDS open 197550-198500 _na     316_aa Cation transporter
4166 JGZR01000016.1 GCA000741775_02160 CDS open 198618-199580 _na     320_aa L-lactate dehydrogenase
4167 JGZR01000016.1 GCA000741775_02161 CDS open 199892-201397 _na     501_aa hflX GTPase HflX
4168 JGZR01000016.1 GCA000741775_02162 CDS open 201577-202266 _na     229_aa Methyltransferase domain containing protein
4169 JGZR01000016.1 GCA000741775_02163 CDS open 202263-206357 _na     1364_aa hrpA ATP-dependent RNA helicase HrpA
4170 JGZR01000016.1 GCA000741775_02164 CDS open 206641-207453 _na     270_aa Hemagglutinin
4171 JGZR01000016.1 GCA000741775_02165 CDS open 207510-208847 _na     445_aa glnA type I glutamate--ammonia ligase
4172 JGZR01000016.1 GCA000741775_02166 CDS open 208946-209668 _na     240_aa priA bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA
4173 JGZR01000016.1 GCA000741775_02167 CDS open 209695-210342 _na     215_aa hisH imidazole glycerol phosphate synthase subunit HisH
4174 JGZR01000016.1 GCA000741775_02168 CDS open 210538-211344 _na     268_aa hypothetical protein
4175 JGZR01000016.1 GCA000741775_02169 CDS open 211344-211943 _na     199_aa hisB imidazoleglycerol-phosphate dehydratase HisB
4176 JGZR01000016.1 GCA000741775_02170 CDS open 212165-213349 _na     394_aa histidinol-phosphate transaminase
4177 JGZR01000016.1 GCA000741775_02171 CDS open 213346-214743 _na     465_aa Histidinol dehydrogenase
4178 JGZR01000016.1 GCA000741775_02172 CDS open 214837-215874 _na     345_aa Glycosyltransferase
4179 JGZR01000016.1 GCA000741775_02173 CDS open 216059-217678 _na     539_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
4180 JGZR01000016.1 GCA000741775_02174 CDS open 218203-221760 _na     1185_aa dnaE DNA polymerase III subunit alpha
4181 JGZR01000016.1 GCA000741775_02175 CDS open 222186-222680 _na     164_aa hypothetical protein
4182 JGZR01000016.1 GCA000741775_02176 CDS open 222738-223706 _na     322_aa Pseudouridine synthase
4183 JGZR01000016.1 GCA000741775_02177 CDS open 223703-224389 _na     228_aa Lipoprotein signal peptidase
4184 JGZR01000016.1 GCA000741775_02178 CDS open 224407-225888 _na     493_aa Cell wall synthesis protein Wag31
4185 JGZR01000016.1 GCA000741775_02179 CDS open 226007-226285 _na     92_aa Hemolysin
4186 JGZR01000016.1 GCA000741775_02180 CDS open 226452-226922 _na     156_aa sepF Cell division protein SepF
4187 JGZR01000016.1 GCA000741775_02181 CDS open 226976-228190 _na     404_aa ftsZ cell division protein FtsZ
4188 JGZR01000016.1 GCA000741775_02182 CDS open 228335-229723 _na     462_aa dusB tRNA dihydrouridine synthase DusB
4189 JGZR01000016.1 GCA000741775_02183 CDS open 229797-231311 _na     504_aa glycine--tRNA ligase
4190 JGZR01000016.1 GCA000741775_02184 CDS open 231583-232665 _na     360_aa Hydroxyethylthiazole kinase
4191 JGZR01000016.1 GCA000741775_02185 CDS open 232889-235537 _na     882_aa thiC phosphomethylpyrimidine synthase ThiC
4192 JGZR01000016.1 GCA000741775_02186 CDS open 235544-235837 _na     97_aa Secreted protein
4193 JGZR01000016.1 GCA000741775_02187 CDS open 235869-236642 _na     257_aa Hydrolase%2C HAD superfamily%2C Cof family
4194 JGZR01000016.1 GCA000741775_02188 CDS open 236739-237104 _na     121_aa Thiamine-binding protein domain-containing protein
4195 JGZR01000016.1 GCA000741775_02189 CDS open 237408-238460 _na     350_aa LacI-type transcriptional regulator
4196 JGZR01000016.1 GCA000741775_02190 CDS open 238861-240186 _na     441_aa Sugar-binding protein
4197 JGZR01000016.1 GCA000741775_02191 CDS open 240199-241149 _na     316_aa Carbohydrate ABC transporter membrane protein 1%2C CUT1 family
4198 JGZR01000016.1 GCA000741775_02192 CDS open 241188-242144 _na     318_aa Carbohydrate ABC transporter permease
4199 JGZR01000016.1 GCA000741775_02193 CDS open 242296-243843 _na     515_aa beta-fructofuranosidase
4200 JGZR01000016.1 GCA000741775_02194 CDS open 244005-244796 _na     263_aa uppS isoprenyl transferase
4201 JGZR01000016.1 GCA000741775_02195 CDS open 244799-245521 _na     240_aa recO DNA repair protein RecO
4202 JGZR01000016.1 GCA000741775_02196 CDS open 245753-247525 _na     590_aa Hydrolase
4203 JGZR01000016.1 GCA000741775_02197 CDS open 247666-249282 _na     538_aa Cell division protein DivIVA
4204 JGZR01000016.1 GCA000741775_02198 CDS open 249826-250182 _na     118_aa Tetracyclin repressor-like C-terminal group 31 domain-containing protein
4205 JGZR01000016.1 GCA000741775_02199 CDS open 250410-250631 _na     73_aa Dipeptidyl aminopeptidase
4206 JGZR01000016.1 GCA000741775_02200 CDS open 250780-251082 _na     100_aa hypothetical protein
4207 JGZR01000016.1 GCA000741775_02201 CDS open 251101-253989 _na     962_aa secA preprotein translocase subunit SecA
4208 JGZR01000016.1 GCA000741775_02202 CDS open 254292-254954 _na     220_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
4209 JGZR01000016.1 GCA000741775_02204 CDS open 255502-256035 _na     177_aa recX Regulatory protein RecX
4210 JGZR01000016.1 GCA000741775_02205 CDS open 256471-257643 _na     390_aa recA recombinase RecA
4211 JGZR01000016.1 GCA000741775_02206 CDS open 257986-258219 _na     77_aa DUF3046 domain-containing protein
4212 JGZR01000016.1 GCA000741775_02207 CDS open 258419-258934 _na     171_aa DNA binding protein
4213 JGZR01000016.1 GCA000741775_02208 CDS open 258999-259643 _na     214_aa Competence damage-inducible protein A
4214 JGZR01000016.1 GCA000741775_02209 CDS open 259606-260265 _na     219_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
4215 JGZR01000016.1 GCA000741775_02210 CDS open 260374-263280 _na     968_aa FtsK/SpoIIIE family protein
4216 JGZR01000016.1 GCA000741775_02211 CDS open 263384-264085 _na     233_aa protein adenylyltransferase
4217 JGZR01000016.1 GCA000741775_02212 CDS open 264051-265205 _na     384_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
4218 JGZR01000016.1 GCA000741775_02213 CDS open 265341-266084 _na     247_aa RelA/SpoT domain-containing protein
4219 JGZR01000016.1 GCA000741775_02214 CDS open 266261-267094 _na     277_aa 2%2C5-didehydrogluconate reductase
4220 JGZR01000016.1 GCA000741775_02215 CDS open 267322-268179 _na     285_aa Inhibitor of apoptosis-promoting Bax1
4221 JGZR01000016.1 GCA000741775_02216 CDS open 268281-270980 _na     899_aa acnA aconitate hydratase AcnA
4222 JGZR01000016.1 GCA000741775_02217 CDS open 271157-273781 _na     874_aa Haloacid dehalogenase
4223 JGZR01000016.1 GCA000741775_02218 CDS open 273794-274459 _na     221_aa Sugar ABC transporter substrate-binding protein
4224 JGZR01000016.1 GCA000741775_02219 CDS open 274456-275796 _na     446_aa SAM-dependent methyl transferase
4225 JGZR01000016.1 GCA000741775_02220 CDS open 276056-276811 _na     251_aa Mn2+/Zn2+ ABC transporter permease
4226 JGZR01000016.1 GCA000741775_02221 CDS open 276871-277701 _na     276_aa DUF3710 domain-containing protein
4227 JGZR01000016.1 GCA000741775_02222 CDS open 277832-278692 _na     286_aa exodeoxyribonuclease III
4228 JGZR01000016.1 GCA000741775_02223 CDS open 278737-279603 _na     288_aa Aldo/keto reductase
4229 JGZR01000016.1 GCA000741775_02224 CDS open 279669-279989 _na     106_aa hypothetical protein
4230 JGZR01000016.1 GCA000741775_02225 CDS open 280027-280998 _na     323_aa Ribokinase
4231 JGZR01000016.1 GCA000741775_02226 CDS open 281076-282491 _na     471_aa Tetracycline resistant protein Tet38
4232 JGZR01000016.1 GCA000741775_02227 CDS open 282617-283573 _na     318_aa Inosine-uridine nucleoside N-ribohydrolase
4233 JGZR01000016.1 GCA000741775_02228 CDS open 283910-285931 _na     673_aa Multidrug ABC transporter ATPase/permease
4234 JGZR01000016.1 GCA000741775_02229 CDS open 285928-287910 _na     660_aa Multidrug ABC transporter ATPase/permease
4235 JGZR01000016.1 GCA000741775_02230 CDS open 288265-289545 _na     426_aa Glutamate--cysteine ligase
4236 JGZR01000016.1 GCA000741775_02231 CDS open 289681-294816 _na     1711_aa Activase
4237 JGZR01000016.1 GCA000741775_02232 CDS open 295155-295694 _na     179_aa abiEi type IV toxin-antitoxin system AbiEi family antitoxin
4238 JGZR01000016.1 GCA000741775_02233 CDS open 295687-296550 _na     287_aa Nucleotidyltransferase
4239 JGZR01000016.1 GCA000741775_02234 CDS open 296716-297420 _na     234_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
4240 JGZR01000016.1 GCA000741775_02235 CDS open 297885-300284 _na     799_aa nrdD anaerobic ribonucleoside-triphosphate reductase
4241 JGZR01000016.1 GCA000741775_02236 CDS open 300600-301940 _na     446_aa xseA exodeoxyribonuclease VII large subunit
4242 JGZR01000016.1 GCA000741775_02237 CDS open 301995-302330 _na     111_aa xseB exodeoxyribonuclease VII small subunit
4243 JGZR01000016.1 GCA000741775_02238 CDS open 302820-303857 _na     345_aa Endonuclease
4244 JGZR01000016.1 GCA000741775_02239 CDS open 303946-304131 _na     61_aa Unassigned protein
4245 JGZR01000016.1 GCA000741775_02240 CDS open 304312-304944 _na     210_aa tetR TetR family regulatory protein
4246 JGZR01000016.1 GCA000741775_02241 CDS open 305478-306359 _na     293_aa ABC transporter ATP-binding protein
4247 JGZR01000016.1 GCA000741775_02242 CDS open 306373-307995 _na     540_aa Tetronasin resistance transmembrane protein
4248 JGZR01000016.1 GCA000741775_02244 CDS open 308714-308803 _na     29_aa hypothetical protein
4249 JGZR01000016.1 GCA000741775_02245 CDS open 308879-309058 _na     59_aa hypothetical protein
4250 JGZR01000016.1 GCA000741775_02246 CDS open 314626-314871 _na     81_aa IstB-like ATP-binding protein
4251 JGZR01000016.1 GCA000741775_01995 gene open 96-1277
4252 JGZR01000016.1 GCA000741775_01996 gene open 1096-3873
4253 JGZR01000016.1 GCA000741775_01997 gene open 4277-4765
4254 JGZR01000016.1 GCA000741775_01998 gene open 4790-5503
4255 JGZR01000016.1 GCA000741775_01999 gene open 6026-6295
4256 JGZR01000016.1 GCA000741775_02000 gene open 6292-7170
4257 JGZR01000016.1 GCA000741775_02001 gene open 7574-8185
4258 JGZR01000016.1 GCA000741775_02002 gene open 8216-8524
4259 JGZR01000016.1 GCA000741775_02003 gene open 8929-10488 parB
4260 JGZR01000016.1 GCA000741775_02004 gene open 10509-11126
4261 JGZR01000016.1 GCA000741775_02005 gene open 11615-11833
4262 JGZR01000016.1 GCA000741775_02006 gene open 12583-13119
4263 JGZR01000016.1 GCA000741775_02007 gene open 13273-13497 sdhE
4264 JGZR01000016.1 GCA000741775_02008 gene open 13488-13712
4265 JGZR01000016.1 GCA000741775_02009 gene open 14151-14480
4266 JGZR01000016.1 GCA000741775_02010 gene open 14507-14848
4267 JGZR01000016.1 GCA000741775_02011 gene open 14885-15073
4268 JGZR01000016.1 GCA000741775_02012 gene open 15415-16401
4269 JGZR01000016.1 GCA000741775_02013 gene open 16404-16685
4270 JGZR01000016.1 GCA000741775_02014 gene open 16750-17109
4271 JGZR01000016.1 GCA000741775_02015 gene open 17313-17549
4272 JGZR01000016.1 GCA000741775_02016 gene open 17546-18142
4273 JGZR01000016.1 GCA000741775_02017 gene open 18441-19361
4274 JGZR01000016.1 GCA000741775_02018 gene open 19679-19837
4275 JGZR01000016.1 GCA000741775_02019 gene open 19903-20766
4276 JGZR01000016.1 GCA000741775_02020 gene open 21181-21408 feoA
4277 JGZR01000016.1 GCA000741775_02021 gene open 21542-23935 feoB
4278 JGZR01000016.1 GCA000741775_02022 gene open 23932-24357
4279 JGZR01000016.1 GCA000741775_02023 gene open 24981-26462
4280 JGZR01000016.1 GCA000741775_02024 gene open 26632-28251
4281 JGZR01000016.1 GCA000741775_02025 gene open 28308-29240
4282 JGZR01000016.1 GCA000741775_02026 gene open 29242-30174 nikB
4283 JGZR01000016.1 GCA000741775_02027 gene open 30168-31241
4284 JGZR01000016.1 GCA000741775_02028 gene open 31238-32266
4285 JGZR01000016.1 GCA000741775_02029 gene open 32315-33529
4286 JGZR01000016.1 GCA000741775_02030 gene open 33841-34824
4287 JGZR01000016.1 GCA000741775_02031 gene open 35253-36761
4288 JGZR01000016.1 GCA000741775_02032 gene open 37035-38510 lpqU
4289 JGZR01000016.1 GCA000741775_02033 gene open 38507-40159
4290 JGZR01000016.1 GCA000741775_02034 gene open 40156-41757
4291 JGZR01000016.1 GCA000741775_02035 gene open 41757-44486
4292 JGZR01000016.1 GCA000741775_02036 gene open 44708-45778
4293 JGZR01000016.1 GCA000741775_02038 gene open 47179-48153
4294 JGZR01000016.1 GCA000741775_02039 gene open 48471-49397 lysE
4295 JGZR01000016.1 GCA000741775_02040 gene open 49664-51103
4296 JGZR01000016.1 GCA000741775_02041 gene open 51242-52690
4297 JGZR01000016.1 GCA000741775_02042 gene open 53642-54571
4298 JGZR01000016.1 GCA000741775_02043 gene open 54757-55596
4299 JGZR01000016.1 GCA000741775_02044 gene open 55812-57233 glcD
4300 JGZR01000016.1 GCA000741775_02045 gene open 57319-58260
4301 JGZR01000016.1 GCA000741775_02046 gene open 58292-58978
4302 JGZR01000016.1 GCA000741775_02047 gene open 58975-60036
4303 JGZR01000016.1 GCA000741775_02048 gene open 60068-61021
4304 JGZR01000016.1 GCA000741775_02049 gene open 61428-62345
4305 JGZR01000016.1 GCA000741775_02050 gene open 62459-63439 tcyL
4306 JGZR01000016.1 GCA000741775_02051 gene open 63542-64291 tcyN
4307 JGZR01000016.1 GCA000741775_02052 gene open 64295-65164
4308 JGZR01000016.1 GCA000741775_02053 gene open 65265-66191
4309 JGZR01000016.1 GCA000741775_02054 gene open 66440-66838
4310 JGZR01000016.1 GCA000741775_02055 gene open 67144-68676
4311 JGZR01000016.1 GCA000741775_02056 gene open 69416-69973
4312 JGZR01000016.1 GCA000741775_02057 gene open 70241-71104 merR
4313 JGZR01000016.1 GCA000741775_02058 gene open 71208-71840
4314 JGZR01000016.1 GCA000741775_02059 gene open 71853-72302 merR
4315 JGZR01000016.1 GCA000741775_02060 gene open 72427-73839
4316 JGZR01000016.1 GCA000741775_02061 gene open 74212-75549
4317 JGZR01000016.1 GCA000741775_02062 gene open 75546-77156
4318 JGZR01000016.1 GCA000741775_02063 gene open 77336-78463
4319 JGZR01000016.1 GCA000741775_02064 gene open 78625-79494
4320 JGZR01000016.1 GCA000741775_02065 gene open 79566-82244
4321 JGZR01000016.1 GCA000741775_02066 gene open 82703-83710 tatD
4322 JGZR01000016.1 GCA000741775_02067 gene open 83912-86833
4323 JGZR01000016.1 GCA000741775_02068 gene open 87897-89813
4324 JGZR01000016.1 GCA000741775_02069 gene open 89963-90673
4325 JGZR01000016.1 GCA000741775_02070 gene open 90684-91478
4326 JGZR01000016.1 GCA000741775_02071 gene open 91767-93539
4327 JGZR01000016.1 GCA000741775_02072 gene open 93699-94763 rsmI
4328 JGZR01000016.1 GCA000741775_02073 gene open 95097-96854
4329 JGZR01000016.1 GCA000741775_02074 gene open 97334-98020 dedA
4330 JGZR01000016.1 GCA000741775_02075 gene open 98489-99715
4331 JGZR01000016.1 GCA000741775_02077 gene open 100139-101266
4332 JGZR01000016.1 GCA000741775_02078 gene open 101888-102133
4333 JGZR01000016.1 GCA000741775_02079 gene open 102317-102928
4334 JGZR01000016.1 GCA000741775_02080 gene open 102931-106548
4335 JGZR01000016.1 GCA000741775_02081 gene open 107914-108195
4336 JGZR01000016.1 GCA000741775_02082 gene open 108529-110064 coaBC
4337 JGZR01000016.1 GCA000741775_02083 gene open 110440-111654
4338 JGZR01000016.1 GCA000741775_02084 gene open 112081-112302
4339 JGZR01000016.1 GCA000741775_02085 gene open 112394-113488
4340 JGZR01000016.1 GCA000741775_02086 gene open 113608-114666
4341 JGZR01000016.1 GCA000741775_02087 gene open 114663-115670
4342 JGZR01000016.1 GCA000741775_02088 gene open 115670-116824
4343 JGZR01000016.1 GCA000741775_02089 gene open 116827-117975
4344 JGZR01000016.1 GCA000741775_02090 gene open 118052-119191
4345 JGZR01000016.1 GCA000741775_02091 gene open 119603-122485
4346 JGZR01000016.1 GCA000741775_02092 gene open 122625-123902
4347 JGZR01000016.1 GCA000741775_02093 gene open 124223-124918
4348 JGZR01000016.1 GCA000741775_02094 gene open 125076-125294
4349 JGZR01000016.1 GCA000741775_02095 gene open 125488-125586
4350 JGZR01000016.1 GCA000741775_02096 gene open 125583-126599
4351 JGZR01000016.1 GCA000741775_02097 gene open 126599-129253 luxR
4352 JGZR01000016.1 GCA000741775_02098 gene open 129479-130210
4353 JGZR01000016.1 GCA000741775_02099 gene open 130488-132023
4354 JGZR01000016.1 GCA000741775_02100 gene open 132319-134775
4355 JGZR01000016.1 GCA000741775_02101 gene open 135103-135735
4356 JGZR01000016.1 GCA000741775_02102 gene open 135956-136777
4357 JGZR01000016.1 GCA000741775_02103 gene open 136768-137448
4358 JGZR01000016.1 GCA000741775_02104 gene open 137801-138775
4359 JGZR01000016.1 GCA000741775_02105 gene open 139064-139795
4360 JGZR01000016.1 GCA000741775_02106 gene open 140158-140835
4361 JGZR01000016.1 GCA000741775_02107 gene open 140990-142081 trpS
4362 JGZR01000016.1 GCA000741775_02108 gene open 142316-144142
4363 JGZR01000016.1 GCA000741775_02109 gene open 144307-147060
4364 JGZR01000016.1 GCA000741775_02110 gene open 147439-148125
4365 JGZR01000016.1 GCA000741775_02111 gene open 148960-150102
4366 JGZR01000016.1 GCA000741775_02112 gene open 150332-151726
4367 JGZR01000016.1 GCA000741775_02113 gene open 152504-152983
4368 JGZR01000016.1 GCA000741775_02114 gene open 153408-154172
4369 JGZR01000016.1 GCA000741775_02115 gene open 154373-154726 mobF
4370 JGZR01000016.1 GCA000741775_02116 gene open 154832-154987
4371 JGZR01000016.1 GCA000741775_02117 gene open 155292-155918 arsR
4372 JGZR01000016.1 GCA000741775_02118 gene open 156099-156962 dprA
4373 JGZR01000016.1 GCA000741775_02119 gene open 157166-157501
4374 JGZR01000016.1 GCA000741775_02120 gene open 157538-157927
4375 JGZR01000016.1 GCA000741775_02121 gene open 158117-158698
4376 JGZR01000016.1 GCA000741775_02122 gene open 159035-159499
4377 JGZR01000016.1 GCA000741775_02123 gene open 159514-160296
4378 JGZR01000016.1 GCA000741775_02124 gene open 160344-161723
4379 JGZR01000016.1 GCA000741775_02125 gene open 162223-163272 lysR
4380 JGZR01000016.1 GCA000741775_02126 gene open 163322-164632
4381 JGZR01000016.1 GCA000741775_02127 gene open 164760-165140
4382 JGZR01000016.1 GCA000741775_02128 gene open 165137-165397
4383 JGZR01000016.1 GCA000741775_02129 gene open 165682-166815 mutM
4384 JGZR01000016.1 GCA000741775_02130 gene open 167122-167502
4385 JGZR01000016.1 GCA000741775_02131 gene open 167757-168350
4386 JGZR01000016.1 GCA000741775_02132 gene open 168652-169485
4387 JGZR01000016.1 GCA000741775_02133 gene open 169466-170428
4388 JGZR01000016.1 GCA000741775_02134 gene open 170431-170832
4389 JGZR01000016.1 GCA000741775_02135 gene open 171053-171802
4390 JGZR01000016.1 GCA000741775_02136 gene open 171799-173091
4391 JGZR01000016.1 GCA000741775_02137 gene open 173066-173536
4392 JGZR01000016.1 GCA000741775_02138 gene open 173824-174459 lysE
4393 JGZR01000016.1 GCA000741775_02139 gene open 174596-175207
4394 JGZR01000016.1 GCA000741775_02140 gene open 175207-175845
4395 JGZR01000016.1 GCA000741775_02141 gene open 175961-176740
4396 JGZR01000016.1 GCA000741775_02142 gene open 176997-178106
4397 JGZR01000016.1 GCA000741775_02143 gene open 178106-179671 murC
4398 JGZR01000016.1 GCA000741775_02144 gene open 179861-181051
4399 JGZR01000016.1 GCA000741775_02145 gene open 181067-182470 ftsW
4400 JGZR01000016.1 GCA000741775_02146 gene open 182457-183950 murD
4401 JGZR01000016.1 GCA000741775_02147 gene open 184037-185125 mraY
4402 JGZR01000016.1 GCA000741775_02148 gene open 185191-186774
4403 JGZR01000016.1 GCA000741775_02149 gene open 186809-187690
4404 JGZR01000016.1 GCA000741775_02150 gene open 187716-189503
4405 JGZR01000016.1 GCA000741775_02151 gene open 189496-189954 ftsL
4406 JGZR01000016.1 GCA000741775_02152 gene open 189954-191015 rsmH
4407 JGZR01000016.1 GCA000741775_02153 gene open 191015-191554 mraZ
4408 JGZR01000016.1 GCA000741775_02154 gene open 191777-194056
4409 JGZR01000016.1 GCA000741775_02155 gene open 194058-195266 serA
4410 JGZR01000016.1 GCA000741775_02156 gene open 195530-196102 nrdR
4411 JGZR01000016.1 GCA000741775_02157 gene open 196177-196563
4412 JGZR01000016.1 GCA000741775_02158 gene open 196813-197526 lexA
4413 JGZR01000016.1 GCA000741775_02159 gene open 197550-198500
4414 JGZR01000016.1 GCA000741775_02160 gene open 198618-199580
4415 JGZR01000016.1 GCA000741775_02161 gene open 199892-201397 hflX
4416 JGZR01000016.1 GCA000741775_02162 gene open 201577-202266
4417 JGZR01000016.1 GCA000741775_02163 gene open 202263-206357 hrpA
4418 JGZR01000016.1 GCA000741775_02164 gene open 206641-207453
4419 JGZR01000016.1 GCA000741775_02165 gene open 207510-208847 glnA
4420 JGZR01000016.1 GCA000741775_02166 gene open 208946-209668 priA
4421 JGZR01000016.1 GCA000741775_02167 gene open 209695-210342 hisH
4422 JGZR01000016.1 GCA000741775_02168 gene open 210538-211344
4423 JGZR01000016.1 GCA000741775_02169 gene open 211344-211943 hisB
4424 JGZR01000016.1 GCA000741775_02170 gene open 212165-213349
4425 JGZR01000016.1 GCA000741775_02171 gene open 213346-214743
4426 JGZR01000016.1 GCA000741775_02172 gene open 214837-215874
4427 JGZR01000016.1 GCA000741775_02173 gene open 216059-217678
4428 JGZR01000016.1 GCA000741775_02174 gene open 218203-221760 dnaE
4429 JGZR01000016.1 GCA000741775_02175 gene open 222186-222680
4430 JGZR01000016.1 GCA000741775_02176 gene open 222738-223706
4431 JGZR01000016.1 GCA000741775_02177 gene open 223703-224389
4432 JGZR01000016.1 GCA000741775_02178 gene open 224407-225888
4433 JGZR01000016.1 GCA000741775_02179 gene open 226007-226285
4434 JGZR01000016.1 GCA000741775_02180 gene open 226452-226922 sepF
4435 JGZR01000016.1 GCA000741775_02181 gene open 226976-228190 ftsZ
4436 JGZR01000016.1 GCA000741775_02182 gene open 228335-229723 dusB
4437 JGZR01000016.1 GCA000741775_02183 gene open 229797-231311
4438 JGZR01000016.1 GCA000741775_02184 gene open 231583-232665
4439 JGZR01000016.1 GCA000741775_02185 gene open 232889-235537 thiC
4440 JGZR01000016.1 GCA000741775_02186 gene open 235544-235837
4441 JGZR01000016.1 GCA000741775_02187 gene open 235869-236642
4442 JGZR01000016.1 GCA000741775_02188 gene open 236739-237104
4443 JGZR01000016.1 GCA000741775_02189 gene open 237408-238460
4444 JGZR01000016.1 GCA000741775_02190 gene open 238861-240186
4445 JGZR01000016.1 GCA000741775_02191 gene open 240199-241149
4446 JGZR01000016.1 GCA000741775_02192 gene open 241188-242144
4447 JGZR01000016.1 GCA000741775_02193 gene open 242296-243843
4448 JGZR01000016.1 GCA000741775_02194 gene open 244005-244796 uppS
4449 JGZR01000016.1 GCA000741775_02195 gene open 244799-245521 recO
4450 JGZR01000016.1 GCA000741775_02196 gene open 245753-247525
4451 JGZR01000016.1 GCA000741775_02197 gene open 247666-249282
4452 JGZR01000016.1 GCA000741775_02198 gene open 249826-250182
4453 JGZR01000016.1 GCA000741775_02199 gene open 250410-250631
4454 JGZR01000016.1 GCA000741775_02200 gene open 250780-251082
4455 JGZR01000016.1 GCA000741775_02201 gene open 251101-253989 secA
4456 JGZR01000016.1 GCA000741775_02202 gene open 254292-254954 hpf
4457 JGZR01000016.1 GCA000741775_02204 gene open 255502-256035 recX
4458 JGZR01000016.1 GCA000741775_02205 gene open 256471-257643 recA
4459 JGZR01000016.1 GCA000741775_02206 gene open 257986-258219
4460 JGZR01000016.1 GCA000741775_02207 gene open 258419-258934
4461 JGZR01000016.1 GCA000741775_02208 gene open 258999-259643
4462 JGZR01000016.1 GCA000741775_02209 gene open 259606-260265 pgsA
4463 JGZR01000016.1 GCA000741775_02210 gene open 260374-263280
4464 JGZR01000016.1 GCA000741775_02211 gene open 263384-264085
4465 JGZR01000016.1 GCA000741775_02212 gene open 264051-265205 miaA
4466 JGZR01000016.1 GCA000741775_02213 gene open 265341-266084
4467 JGZR01000016.1 GCA000741775_02214 gene open 266261-267094
4468 JGZR01000016.1 GCA000741775_02215 gene open 267322-268179
4469 JGZR01000016.1 GCA000741775_02216 gene open 268281-270980 acnA
4470 JGZR01000016.1 GCA000741775_02217 gene open 271157-273781
4471 JGZR01000016.1 GCA000741775_02218 gene open 273794-274459
4472 JGZR01000016.1 GCA000741775_02219 gene open 274456-275796
4473 JGZR01000016.1 GCA000741775_02220 gene open 276056-276811
4474 JGZR01000016.1 GCA000741775_02221 gene open 276871-277701
4475 JGZR01000016.1 GCA000741775_02222 gene open 277832-278692
4476 JGZR01000016.1 GCA000741775_02223 gene open 278737-279603
4477 JGZR01000016.1 GCA000741775_02224 gene open 279669-279989
4478 JGZR01000016.1 GCA000741775_02225 gene open 280027-280998
4479 JGZR01000016.1 GCA000741775_02226 gene open 281076-282491
4480 JGZR01000016.1 GCA000741775_02227 gene open 282617-283573
4481 JGZR01000016.1 GCA000741775_02228 gene open 283910-285931
4482 JGZR01000016.1 GCA000741775_02229 gene open 285928-287910
4483 JGZR01000016.1 GCA000741775_02230 gene open 288265-289545
4484 JGZR01000016.1 GCA000741775_02231 gene open 289681-294816
4485 JGZR01000016.1 GCA000741775_02232 gene open 295155-295694 abiEi
4486 JGZR01000016.1 GCA000741775_02233 gene open 295687-296550
4487 JGZR01000016.1 GCA000741775_02234 gene open 296716-297420 nrdG
4488 JGZR01000016.1 GCA000741775_02235 gene open 297885-300284 nrdD
4489 JGZR01000016.1 GCA000741775_02236 gene open 300600-301940 xseA
4490 JGZR01000016.1 GCA000741775_02237 gene open 301995-302330 xseB
4491 JGZR01000016.1 GCA000741775_02238 gene open 302820-303857
4492 JGZR01000016.1 GCA000741775_02239 gene open 303946-304131
4493 JGZR01000016.1 GCA000741775_02240 gene open 304312-304944 tetR
4494 JGZR01000016.1 GCA000741775_02241 gene open 305478-306359
4495 JGZR01000016.1 GCA000741775_02242 gene open 306373-307995
4496 JGZR01000016.1 GCA000741775_02244 gene open 308714-308803
4497 JGZR01000016.1 GCA000741775_02245 gene open 308879-309058
4498 JGZR01000016.1 GCA000741775_02246 gene open 314626-314871
4499 JGZR01000016.1 GCA000741775_02037 gene open 46588-46672 trnS
4500 JGZR01000016.1 GCA000741775_02076 gene open 99987-100062 trnA