HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Paenibacillus glucanolyticus (GCA_001633025.1)

Select a Genome:
BAKTA Annotations for GCA_001633025.1
Genome Selected: Paenibacillus glucanolyticus
ContigsBases CDSrRNA tmRNAtRNA
3 7039886 6478 24 1 76
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 13232 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 13232 [27 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
1 LWMH01000001.1 GCA001633025_01992 gene open 1999628-1999989 ssrA
2 LWMH01000001.1 GCA001633025_01992 tmRNA open 1999628-1999989 ssrA transfer-messenger RNA%2C SsrA
3 LWMH01000001.1 rep_origin open 1702116-1702588
4 LWMH01000001.1 GCA001633025_00776 gene open 706217-709144 rrl
5 LWMH01000001.1 GCA001633025_00777 gene open 709502-711057 rrs
6 LWMH01000001.1 GCA001633025_01011 gene open 965944-966060 rrf
7 LWMH01000001.1 GCA001633025_01012 gene open 966127-969057 rrl
8 LWMH01000001.1 GCA001633025_01015 gene open 969578-969694 rrf
9 LWMH01000001.1 GCA001633025_01016 gene open 969827-971382 rrs
10 LWMH01000001.1 GCA001633025_01107 gene open 1047761-1047877 rrf
11 LWMH01000001.1 GCA001633025_01108 gene open 1047944-1050989 rrl
12 LWMH01000001.1 GCA001633025_01110 gene open 1051422-1052977 rrs
13 LWMH01000001.1 GCA001633025_01715 gene open 1714402-1715957 rrs
14 LWMH01000001.1 GCA001633025_01716 gene open 1716323-1719250 rrl
15 LWMH01000001.1 GCA001633025_01717 gene open 1719400-1719516 rrf
16 LWMH01000001.1 GCA001633025_01785 gene open 1783865-1785420 rrs
17 LWMH01000001.1 GCA001633025_01786 gene open 1785787-1788830 rrl
18 LWMH01000001.1 GCA001633025_01787 gene open 1788897-1789013 rrf
19 LWMH01000001.1 GCA001633025_01835 gene open 1840764-1841030 Bacteria_large_SRP
20 LWMH01000001.1 GCA001633025_01836 gene open 1840878-1840977 Bacteria_small_SRP
21 LWMH01000001.1 GCA001633025_01842 gene open 1845277-1846832 rrs
22 LWMH01000001.1 GCA001633025_01843 gene open 1846965-1847081 rrf
23 LWMH01000001.1 GCA001633025_01846 gene open 1847600-1850527 rrl
24 LWMH01000001.1 GCA001633025_01939 gene open 1936814-1937062 bsrG
25 LWMH01000001.1 GCA001633025_02384 gene open 2461767-2461854 bsrC
26 LWMH01000001.1 GCA001633025_02579 gene open 2682911-2684466 rrs
27 LWMH01000001.1 GCA001633025_02580 gene open 2684833-2687878 rrl
28 LWMH01000001.1 GCA001633025_02581 gene open 2687945-2688061 rrf
29 LWMH01000001.1 GCA001633025_03160 gene open 3367590-3369145 rrs
30 LWMH01000001.1 GCA001633025_03161 gene open 3369511-3372556 rrl
31 LWMH01000001.1 GCA001633025_03162 gene open 3372689-3372805 rrf
32 LWMH01000001.1 GCA001633025_03391 gene open 3621303-3621707 RNaseP_bact_a
33 LWMH01000001.1 GCA001633025_04576 gene open 4855708-4856003 5_ureB_sRNA
34 LWMH01000001.1 GCA001633025_01835 ncRNA open 1840764-1841030 Bacterial large signal recognition particle RNA
35 LWMH01000001.1 GCA001633025_01836 ncRNA open 1840878-1840977 Bacterial small signal recognition particle RNA
36 LWMH01000001.1 GCA001633025_01939 ncRNA open 1936814-1937062 bsrG BsrG
37 LWMH01000001.1 GCA001633025_02384 ncRNA open 2461767-2461854 bsrC BsrC
38 LWMH01000001.1 GCA001633025_03391 ncRNA open 3621303-3621707 Bacterial RNase P class A
39 LWMH01000001.1 GCA001633025_04576 ncRNA open 4855708-4856003 5' ureB small RNA
40 LWMH01000001.1 regulatory_region open 96435-96568 c-di-AMP riboswitch aptamer (ydaO/yuaA leader)
41 LWMH01000001.1 regulatory_region open 134739-134872 c-di-AMP riboswitch aptamer (ydaO/yuaA leader)
42 LWMH01000001.1 regulatory_region open 524372-524707 T-box leader
43 LWMH01000001.1 regulatory_region open 555265-555385 epsC RNA
44 LWMH01000001.1 regulatory_region open 604650-604762 TPP riboswitch aptamer (THI element)
45 LWMH01000001.1 regulatory_region open 635763-635908 c-di-AMP riboswitch aptamer (ydaO/yuaA leader)
46 LWMH01000001.1 regulatory_region open 659860-660006 SAM riboswitch aptamer (S box leader)
47 LWMH01000001.1 regulatory_region open 678504-678745 T-box leader
48 LWMH01000001.1 regulatory_region open 764258-764437 Lysine riboswitch aptamer
49 LWMH01000001.1 regulatory_region open 887226-887372 c-di-AMP riboswitch aptamer (ydaO/yuaA leader)
50 LWMH01000001.1 regulatory_region open 955604-955802 glmS glucosamine-6-phosphate activated ribozyme aptamer
51 LWMH01000001.1 regulatory_region open 1015439-1015596 Ribosomal protein L10 leader
52 LWMH01000001.1 regulatory_region open 1274603-1274684 ZMP/ZTP riboswitch aptamer (pfl RNA motif)
53 LWMH01000001.1 regulatory_region open 1404218-1404319 Purine riboswitch aptamer
54 LWMH01000001.1 regulatory_region open 1528553-1528823 T-box leader
55 LWMH01000001.1 regulatory_region open 1733648-1733862 c-di-AMP riboswitch aptamer (ydaO/yuaA leader)
56 LWMH01000001.1 regulatory_region open 1806185-1806323 c-di-AMP riboswitch aptamer (ydaO/yuaA leader)
57 LWMH01000001.1 regulatory_region open 1807204-1807342 c-di-AMP riboswitch aptamer (ydaO/yuaA leader)
58 LWMH01000001.1 regulatory_region open 2183954-2184125 c-di-AMP riboswitch aptamer (ydaO/yuaA leader)
59 LWMH01000001.1 regulatory_region open 2184677-2184845 c-di-AMP riboswitch aptamer (ydaO/yuaA leader)
60 LWMH01000001.1 regulatory_region open 2373824-2373935 TPP riboswitch aptamer (THI element)
61 LWMH01000001.1 regulatory_region open 2438582-2438814 Cobalamin riboswitch aptamer
62 LWMH01000001.1 regulatory_region open 2491148-2491248 Purine riboswitch aptamer
63 LWMH01000001.1 regulatory_region open 2680862-2680960 Purine riboswitch aptamer
64 LWMH01000001.1 regulatory_region open 2725389-2725490 Purine riboswitch aptamer
65 LWMH01000001.1 regulatory_region open 2918960-2919063 TPP riboswitch aptamer (THI element)
66 LWMH01000001.1 regulatory_region open 3113330-3113498 FMN riboswitch aptamer (RFN element)
67 LWMH01000001.1 regulatory_region open 3238810-3238842 PreQ1 (pre queuosine) riboswitch aptamer
68 LWMH01000001.1 regulatory_region open 3307815-3308039 T-box leader
69 LWMH01000001.1 regulatory_region open 3333930-3334226 T-box leader
70 LWMH01000001.1 regulatory_region open 3553119-3553375 T-box leader
71 LWMH01000001.1 regulatory_region open 3679794-3680071 T-box leader
72 LWMH01000001.1 regulatory_region open 3690108-3690262 PyrR binding site
73 LWMH01000001.1 regulatory_region open 3788571-3788848 T-box leader
74 LWMH01000001.1 regulatory_region open 3954090-3954349 T-box leader
75 LWMH01000001.1 regulatory_region open 4022124-4022306 FMN riboswitch aptamer (RFN element)
76 LWMH01000001.1 regulatory_region open 4040850-4041080 T-box leader
77 LWMH01000001.1 regulatory_region open 4485314-4485574 T-box leader
78 LWMH01000001.1 regulatory_region open 4622551-4622814 T-box leader
79 LWMH01000001.1 regulatory_region open 4790959-4791075 Glycine riboswitch aptamer
80 LWMH01000001.1 regulatory_region open 4791076-4791177 Glycine riboswitch aptamer
81 LWMH01000001.1 regulatory_region open 4791366-4791487 Glycine riboswitch aptamer
82 LWMH01000001.1 regulatory_region open 4822700-4822799 Purine riboswitch aptamer
83 LWMH01000001.1 regulatory_region open 4973451-4973557 azaaromatic riboswitch aptamer (yjdF RNA)
84 LWMH01000001.1 GCA001633025_00776 rRNA open 706217-709144 rrl 23S ribosomal RNA
85 LWMH01000001.1 GCA001633025_00777 rRNA open 709502-711057 rrs 16S ribosomal RNA
86 LWMH01000001.1 GCA001633025_01011 rRNA open 965944-966060 rrf 5S ribosomal RNA
87 LWMH01000001.1 GCA001633025_01012 rRNA open 966127-969057 rrl 23S ribosomal RNA
88 LWMH01000001.1 GCA001633025_01015 rRNA open 969578-969694 rrf 5S ribosomal RNA
89 LWMH01000001.1 GCA001633025_01016 rRNA open 969827-971382 rrs 16S ribosomal RNA
90 LWMH01000001.1 GCA001633025_01107 rRNA open 1047761-1047877 rrf 5S ribosomal RNA
91 LWMH01000001.1 GCA001633025_01108 rRNA open 1047944-1050989 rrl 23S ribosomal RNA
92 LWMH01000001.1 GCA001633025_01110 rRNA open 1051422-1052977 rrs 16S ribosomal RNA
93 LWMH01000001.1 GCA001633025_01715 rRNA open 1714402-1715957 rrs 16S ribosomal RNA
94 LWMH01000001.1 GCA001633025_01716 rRNA open 1716323-1719250 rrl 23S ribosomal RNA
95 LWMH01000001.1 GCA001633025_01717 rRNA open 1719400-1719516 rrf 5S ribosomal RNA
96 LWMH01000001.1 GCA001633025_01785 rRNA open 1783865-1785420 rrs 16S ribosomal RNA
97 LWMH01000001.1 GCA001633025_01786 rRNA open 1785787-1788830 rrl 23S ribosomal RNA
98 LWMH01000001.1 GCA001633025_01787 rRNA open 1788897-1789013 rrf 5S ribosomal RNA
99 LWMH01000001.1 GCA001633025_01842 rRNA open 1845277-1846832 rrs 16S ribosomal RNA
100 LWMH01000001.1 GCA001633025_01843 rRNA open 1846965-1847081 rrf 5S ribosomal RNA
101 LWMH01000001.1 GCA001633025_01846 rRNA open 1847600-1850527 rrl 23S ribosomal RNA
102 LWMH01000001.1 GCA001633025_02579 rRNA open 2682911-2684466 rrs 16S ribosomal RNA
103 LWMH01000001.1 GCA001633025_02580 rRNA open 2684833-2687878 rrl 23S ribosomal RNA
104 LWMH01000001.1 GCA001633025_02581 rRNA open 2687945-2688061 rrf 5S ribosomal RNA
105 LWMH01000001.1 GCA001633025_03160 rRNA open 3367590-3369145 rrs 16S ribosomal RNA
106 LWMH01000001.1 GCA001633025_03161 rRNA open 3369511-3372556 rrl 23S ribosomal RNA
107 LWMH01000001.1 GCA001633025_03162 rRNA open 3372689-3372805 rrf 5S ribosomal RNA
108 LWMH01000001.1 repeat_region open 2928755-2930249 CRISPR array with 23 repeats of length 18%2C consensus sequence GGGTGCGTGGATTGAAAT and spacer length 48
109 LWMH01000001.1 repeat_region open 2942547-2943464 CRISPR array with 14 repeats of length 32%2C consensus sequence GTCGCACCCTTCGTGGGTGCGTGGATTGAAAT and spacer length 35
110 LWMH01000001.1 GCA001633025_00001 CDS open 200-2236 _na     678_aa Helix-turn-helix domain-containing protein
111 LWMH01000001.1 GCA001633025_00002 CDS open 2236-3867 _na     543_aa Integrase
112 LWMH01000001.1 GCA001633025_00003 CDS open 3864-4454 _na     196_aa Transposase
113 LWMH01000001.1 GCA001633025_00004 CDS open 4768-5223 _na     151_aa DUF4367 domain-containing protein
114 LWMH01000001.1 GCA001633025_00005 CDS open 5321-5644 _na     107_aa Transposase
115 LWMH01000001.1 GCA001633025_00006 CDS open 5587-6471 _na     294_aa IS3 family transposase
116 LWMH01000001.1 GCA001633025_00007 CDS open 6548-7069 _na     173_aa hypothetical protein
117 LWMH01000001.1 GCA001633025_00008 CDS open 7221-7565 _na     114_aa YolD-like family protein
118 LWMH01000001.1 GCA001633025_00009 CDS open 7562-8836 _na     424_aa DNA polymerase IV
119 LWMH01000001.1 GCA001633025_00010 CDS open 8984-9925 _na     313_aa DNA polymerase IV
120 LWMH01000001.1 GCA001633025_00011 CDS open 9913-10293 _na     126_aa Transposase IS4-like domain-containing protein
121 LWMH01000001.1 GCA001633025_00012 CDS open 10827-11345 _na     172_aa hypothetical protein
122 LWMH01000001.1 GCA001633025_00013 CDS open 11419-11688 _na     89_aa DivIVA domain-containing protein
123 LWMH01000001.1 GCA001633025_00014 CDS open 11832-12002 _na     56_aa hypothetical protein
124 LWMH01000001.1 GCA001633025_00015 CDS open 12571-12783 _na     70_aa Phage protein
125 LWMH01000001.1 GCA001633025_00016 CDS open 12979-13236 _na     85_aa DUF2188 domain-containing protein
126 LWMH01000001.1 GCA001633025_00017 CDS open 13339-13596 _na     85_aa hypothetical protein
127 LWMH01000001.1 GCA001633025_00018 CDS open 13664-13870 _na     68_aa hypothetical protein
128 LWMH01000001.1 GCA001633025_00019 CDS open 13899-14024 _na     41_aa hypothetical protein
129 LWMH01000001.1 GCA001633025_00020 CDS open 14046-14279 _na     77_aa hypothetical protein
130 LWMH01000001.1 GCA001633025_00021 CDS open 14336-14566 _na     76_aa hypothetical protein
131 LWMH01000001.1 GCA001633025_00022 CDS open 14612-14965 _na     117_aa hypothetical protein
132 LWMH01000001.1 GCA001633025_00023 CDS open 14993-15169 _na     58_aa hypothetical protein
133 LWMH01000001.1 GCA001633025_00024 CDS open 15460-15699 _na     79_aa hypothetical protein
134 LWMH01000001.1 GCA001633025_00025 CDS open 15895-16224 _na     109_aa hypothetical protein
135 LWMH01000001.1 GCA001633025_00026 CDS open 16764-18857 _na     697_aa hypothetical protein
136 LWMH01000001.1 GCA001633025_00027 CDS open 18857-19009 _na     50_aa hypothetical protein
137 LWMH01000001.1 GCA001633025_00028 CDS open 19129-19464 _na     111_aa Excalibur calcium-binding domain-containing protein
138 LWMH01000001.1 GCA001633025_00029 CDS open 19499-19609 _na     36_aa hypothetical protein
139 LWMH01000001.1 GCA001633025_00030 CDS open 19804-20706 _na     300_aa Peptidase
140 LWMH01000001.1 GCA001633025_00031 CDS open 21367-21537 _na     56_aa hypothetical protein
141 LWMH01000001.1 GCA001633025_00032 CDS open 21638-22177 _na     179_aa hypothetical protein
142 LWMH01000001.1 GCA001633025_00033 CDS open 22259-22636 _na     125_aa pilZ PilZ domain-containing protein
143 LWMH01000001.1 GCA001633025_00034 CDS open 23264-23452 _na     62_aa Phage capsid protein
144 LWMH01000001.1 GCA001633025_00035 CDS open 23712-23987 _na     91_aa hypothetical protein
145 LWMH01000001.1 GCA001633025_00036 CDS open 24010-25080 _na     356_aa xerS tyrosine recombinase XerS
146 LWMH01000001.1 GCA001633025_00037 CDS open 25372-25722 _na     116_aa hypothetical protein
147 LWMH01000001.1 GCA001633025_00038 CDS open 25768-26355 _na     195_aa hypothetical protein
148 LWMH01000001.1 GCA001633025_00039 CDS open 27687-28910 _na     407_aa SLH domain-containing protein
149 LWMH01000001.1 GCA001633025_00040 CDS open 29432-30283 _na     283_aa hypothetical protein
150 LWMH01000001.1 GCA001633025_00041 CDS open 30547-31461 _na     304_aa Restriction endonuclease type IV Mrr domain-containing protein
151 LWMH01000001.1 GCA001633025_00042 CDS open 31458-33461 _na     667_aa hypothetical protein
152 LWMH01000001.1 GCA001633025_00043 CDS open 33513-34841 _na     442_aa coiA Competence protein CoiA
153 LWMH01000001.1 GCA001633025_00044 CDS open 35120-36310 _na     396_aa hypothetical protein
154 LWMH01000001.1 GCA001633025_00045 CDS open 36565-36813 _na     82_aa hypothetical protein
155 LWMH01000001.1 GCA001633025_00046 CDS open 36831-37061 _na     76_aa Selenocysteine lyase
156 LWMH01000001.1 GCA001633025_00047 CDS open 37311-38246 _na     311_aa Peptidase S8/S53 domain-containing protein
157 LWMH01000001.1 GCA001633025_00049 CDS open 38482-38718 _na     78_aa Glutaredoxin domain-containing protein
158 LWMH01000001.1 GCA001633025_00050 CDS open 39484-39945 _na     153_aa hypothetical protein
159 LWMH01000001.1 GCA001633025_00051 CDS open 39964-40380 _na     138_aa blaR1 Peptidase M56 BlaR1
160 LWMH01000001.1 GCA001633025_00052 CDS open 40865-41494 _na     209_aa Copper amine oxidase-like N-terminal domain-containing protein
161 LWMH01000001.1 GCA001633025_00053 CDS open 41557-42408 _na     283_aa IS3 family transposase
162 LWMH01000001.1 GCA001633025_00054 CDS open 42369-42707 _na     112_aa Transposase
163 LWMH01000001.1 GCA001633025_00055 CDS open 42829-43947 _na     372_aa hypothetical protein
164 LWMH01000001.1 GCA001633025_00056 CDS open 44139-44333 _na     64_aa yvrJ YvrJ family protein
165 LWMH01000001.1 GCA001633025_00057 CDS open 45798-46403 _na     201_aa WxL domain-containing protein
166 LWMH01000001.1 GCA001633025_00058 CDS open 46489-49755 _na     1088_aa Copper amine oxidase-like N-terminal domain-containing protein
167 LWMH01000001.1 GCA001633025_00059 CDS open 49839-51332 _na     497_aa WxL Interacting Protein peptidoglycan binding domain-containing protein
168 LWMH01000001.1 GCA001633025_00060 CDS open 51731-51931 _na     66_aa hypothetical protein
169 LWMH01000001.1 GCA001633025_00061 CDS open 51969-53093 _na     374_aa Copper amine oxidase-like N-terminal domain-containing protein
170 LWMH01000001.1 GCA001633025_00062 CDS open 53239-53433 _na     64_aa hypothetical protein
171 LWMH01000001.1 GCA001633025_00063 CDS open 53510-54277 _na     255_aa hypothetical protein
172 LWMH01000001.1 GCA001633025_00064 CDS open 54378-54569 _na     63_aa yvrJ YvrJ family protein
173 LWMH01000001.1 GCA001633025_00065 CDS open 54742-55083 _na     113_aa RNA polymerase sigma factor 70 region 4 type 2 domain-containing protein
174 LWMH01000001.1 GCA001633025_00066 CDS open 55035-55262 _na     75_aa Helix-turn-helix conjugative transposon-like domain-containing protein
175 LWMH01000001.1 GCA001633025_00067 CDS open 55363-55623 _na     86_aa hypothetical protein
176 LWMH01000001.1 GCA001633025_00068 CDS open 55752-55910 _na     52_aa aspartyl-phosphate phosphatase Spo0E family protein
177 LWMH01000001.1 GCA001633025_00069 CDS open 55980-56162 _na     60_aa hypothetical protein
178 LWMH01000001.1 GCA001633025_00070 CDS open 56412-56750 _na     112_aa HTH cro/C1-type domain-containing protein
179 LWMH01000001.1 GCA001633025_00071 CDS open 57002-57559 _na     185_aa hypothetical protein
180 LWMH01000001.1 GCA001633025_00072 CDS open 57683-58729 _na     348_aa ADP-ribosylglycohydrolase
181 LWMH01000001.1 GCA001633025_00073 CDS open 58759-59358 _na     199_aa hypothetical protein
182 LWMH01000001.1 GCA001633025_00074 CDS open 60052-61323 _na     423_aa IS110 family transposase
183 LWMH01000001.1 GCA001633025_00075 CDS open 61420-61635 _na     71_aa hypothetical protein
184 LWMH01000001.1 GCA001633025_00076 CDS open 61815-63218 _na     467_aa Spermidine synthase
185 LWMH01000001.1 GCA001633025_00077 CDS open 63476-64300 _na     274_aa hypothetical protein
186 LWMH01000001.1 GCA001633025_00078 CDS open 64399-64866 _na     155_aa hypothetical protein
187 LWMH01000001.1 GCA001633025_00079 CDS open 64966-67998 _na     1010_aa Helicase
188 LWMH01000001.1 GCA001633025_00080 CDS open 68065-68904 _na     279_aa hypothetical protein
189 LWMH01000001.1 GCA001633025_00081 CDS open 69146-69361 _na     71_aa Spore protein
190 LWMH01000001.1 GCA001633025_00082 CDS open 69511-70386 _na     291_aa ATP-dependent DNA ligase family profile domain-containing protein
191 LWMH01000001.1 GCA001633025_00083 CDS open 70471-70860 _na     129_aa Permease
192 LWMH01000001.1 GCA001633025_00084 CDS open 70961-71404 _na     147_aa hypothetical protein
193 LWMH01000001.1 GCA001633025_00085 CDS open 71474-72502 _na     342_aa DUF262 domain-containing protein
194 LWMH01000001.1 GCA001633025_00086 CDS open 72957-73466 _na     169_aa HTH cro/C1-type domain-containing protein
195 LWMH01000001.1 GCA001633025_00087 CDS open 73577-74260 _na     227_aa DNA cytosine methyltransferase
196 LWMH01000001.1 GCA001633025_00088 CDS open 74547-75152 _na     201_aa SMODS and SLOG-associating 2TM effector domain-containing protein
197 LWMH01000001.1 GCA001633025_00089 CDS open 75168-76370 _na     400_aa Reverse transcriptase domain-containing protein
198 LWMH01000001.1 GCA001633025_00090 CDS open 76485-77678 _na     397_aa Transposase
199 LWMH01000001.1 GCA001633025_00091 CDS open 77804-77962 _na     52_aa Reverse transcriptase domain-containing protein
200 LWMH01000001.1 GCA001633025_00092 CDS open 78636-79853 _na     405_aa Protein kinase domain-containing protein
201 LWMH01000001.1 GCA001633025_00093 CDS open 80518-80655 _na     45_aa DUF951 domain-containing protein
202 LWMH01000001.1 GCA001633025_00094 CDS open 81155-81637 _na     160_aa Monooxygenase
203 LWMH01000001.1 GCA001633025_00095 CDS open 82185-83132 _na     315_aa zitB Zinc transporter ZitB
204 LWMH01000001.1 GCA001633025_00096 CDS open 83376-84461 _na     361_aa Copper resistance protein D domain-containing protein
205 LWMH01000001.1 GCA001633025_00097 CDS open 84458-85075 _na     205_aa copC CopC domain-containing protein
206 LWMH01000001.1 GCA001633025_00098 CDS open 85243-86103 _na     286_aa Peptidase M56 domain-containing protein
207 LWMH01000001.1 GCA001633025_00099 CDS open 86096-86521 _na     141_aa Transcriptional regulator
208 LWMH01000001.1 GCA001633025_00100 CDS open 86721-87464 _na     247_aa Pirin N-terminal domain-containing protein
209 LWMH01000001.1 GCA001633025_00101 CDS open 87651-87935 _na     94_aa qoxD cytochrome aa3 quinol oxidase subunit IV
210 LWMH01000001.1 GCA001633025_00102 CDS open 87938-88534 _na     198_aa qoxC cytochrome aa3 quinol oxidase subunit III
211 LWMH01000001.1 GCA001633025_00103 CDS open 88531-90480 _na     649_aa qoxB cytochrome aa3 quinol oxidase subunit I
212 LWMH01000001.1 GCA001633025_00104 CDS open 90505-91428 _na     307_aa qoxA cytochrome aa3 quinol oxidase subunit II
213 LWMH01000001.1 GCA001633025_00105 CDS open 91796-93961 _na     721_aa Cd(2+)-exporting ATPase
214 LWMH01000001.1 GCA001633025_00106 CDS open 94147-94521 _na     124_aa Transcriptional regulator
215 LWMH01000001.1 GCA001633025_00107 CDS open 94654-95691 _na     345_aa Oxidoreductase
216 LWMH01000001.1 GCA001633025_00108 CDS open 95955-96431 _na     158_aa Hydrolase
217 LWMH01000001.1 GCA001633025_00109 CDS open 96821-97726 _na     301_aa lgt prolipoprotein diacylglyceryl transferase
218 LWMH01000001.1 GCA001633025_00110 CDS open 97832-98119 _na     95_aa hypothetical protein
219 LWMH01000001.1 GCA001633025_00111 CDS open 98116-98547 _na     143_aa 2-oxoglutarate dehydrogenase
220 LWMH01000001.1 GCA001633025_00112 CDS open 98566-99249 _na     227_aa Dihydroneopterin aldolase
221 LWMH01000001.1 GCA001633025_00113 CDS open 99355-100068 _na     237_aa ccdA Cytochrome C biogenesis protein CcdA
222 LWMH01000001.1 GCA001633025_00114 CDS open 100113-100970 _na     285_aa Cytochrome C oxidase assembly protein
223 LWMH01000001.1 GCA001633025_00115 CDS open 101398-101628 _na     76_aa Cadmium efflux system accessory protein
224 LWMH01000001.1 GCA001633025_00116 CDS open 101712-103115 _na     467_aa lpdA dihydrolipoyl dehydrogenase
225 LWMH01000001.1 GCA001633025_00117 CDS open 103147-103782 _na     211_aa cadD Cadmium resistance protein CadD
226 LWMH01000001.1 GCA001633025_00118 CDS open 103808-104479 _na     223_aa Methyltransferase type 11
227 LWMH01000001.1 GCA001633025_00119 CDS open 104779-106935 _na     718_aa Cd(2+)-exporting ATPase
228 LWMH01000001.1 GCA001633025_00120 CDS open 106928-107296 _na     122_aa Transcriptional regulator
229 LWMH01000001.1 GCA001633025_00121 CDS open 107723-107929 _na     68_aa PEP-CTERM protein-sorting domain-containing protein
230 LWMH01000001.1 GCA001633025_00122 CDS open 107931-109334 _na     467_aa histidine kinase
231 LWMH01000001.1 GCA001633025_00123 CDS open 109331-110038 _na     235_aa DNA-binding response regulator
232 LWMH01000001.1 GCA001633025_00124 CDS open 110151-110417 _na     88_aa hypothetical protein
233 LWMH01000001.1 GCA001633025_00125 CDS open 110418-110642 _na     74_aa DUF2933 domain-containing protein
234 LWMH01000001.1 GCA001633025_00126 CDS open 110789-112492 _na     567_aa Copper oxidase
235 LWMH01000001.1 GCA001633025_00127 CDS open 112625-112855 _na     76_aa SHOCT domain-containing protein
236 LWMH01000001.1 GCA001633025_00128 CDS open 113062-113289 _na     75_aa Spore coat protein
237 LWMH01000001.1 GCA001633025_00129 CDS open 114050-114625 _na     191_aa DUF1541 domain-containing protein
238 LWMH01000001.1 GCA001633025_00130 CDS open 114770-116218 _na     482_aa efpA Putative MFS-type transporter EfpA
239 LWMH01000001.1 GCA001633025_00131 CDS open 116570-117352 _na     260_aa motB Flagellar motor protein MotB
240 LWMH01000001.1 GCA001633025_00132 CDS open 117511-118962 _na     483_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
241 LWMH01000001.1 GCA001633025_00133 CDS open 119185-119334 _na     49_aa hypothetical protein
242 LWMH01000001.1 GCA001633025_00134 CDS open 119731-120117 _na     128_aa Stage II sporulation protein P
243 LWMH01000001.1 GCA001633025_00135 CDS open 120153-121340 _na     395_aa Peptidase S11 D-alanyl-D-alanine carboxypeptidase A N-terminal domain-containing protein
244 LWMH01000001.1 GCA001633025_00136 CDS open 121413-121661 _na     82_aa hypothetical protein
245 LWMH01000001.1 GCA001633025_00137 CDS open 122426-122938 _na     170_aa Thiol:disulfide interchange protein
246 LWMH01000001.1 GCA001633025_00138 CDS open 122954-123667 _na     237_aa ccdA Cytochrome C biogenesis protein CcdA
247 LWMH01000001.1 GCA001633025_00139 CDS open 123783-125984 _na     733_aa Spermine synthase
248 LWMH01000001.1 GCA001633025_00140 CDS open 126594-126776 _na     60_aa hypothetical protein
249 LWMH01000001.1 GCA001633025_00141 CDS open 126798-127151 _na     117_aa Four-helix bundle copper-binding protein
250 LWMH01000001.1 GCA001633025_00142 CDS open 127343-127900 _na     185_aa NlpC/P60 family protein
251 LWMH01000001.1 GCA001633025_00143 CDS open 128018-128812 _na     264_aa lgt prolipoprotein diacylglyceryl transferase
252 LWMH01000001.1 GCA001633025_00144 CDS open 128863-129600 _na     245_aa Urease accessory protein UreH-like transmembrane domain-containing protein
253 LWMH01000001.1 GCA001633025_00145 CDS open 129673-130530 _na     285_aa Peptidase M56 domain-containing protein
254 LWMH01000001.1 GCA001633025_00146 CDS open 130527-130958 _na     143_aa Transcriptional regulator
255 LWMH01000001.1 GCA001633025_00147 CDS open 131029-131949 _na     306_aa Sortilin N-terminal domain-containing protein
256 LWMH01000001.1 GCA001633025_00148 CDS open 132107-133978 _na     623_aa asnB asparagine synthase (glutamine-hydrolyzing)
257 LWMH01000001.1 GCA001633025_00149 CDS open 134255-134734 _na     159_aa Hydrolase
258 LWMH01000001.1 GCA001633025_00150 CDS open 135233-135562 _na     109_aa Ferredoxin
259 LWMH01000001.1 GCA001633025_00151 CDS open 135906-138002 _na     698_aa P-type Cu(+) transporter
260 LWMH01000001.1 GCA001633025_00152 CDS open 138076-138552 _na     158_aa HTH marR-type domain-containing protein
261 LWMH01000001.1 GCA001633025_00153 CDS open 138584-139429 _na     281_aa Metallo-beta-lactamase domain-containing protein
262 LWMH01000001.1 GCA001633025_00154 CDS open 139598-139921 _na     107_aa Transposase
263 LWMH01000001.1 GCA001633025_00155 CDS open 139918-140784 _na     288_aa IS3 family transposase
264 LWMH01000001.1 GCA001633025_00156 CDS open 140851-141090 _na     79_aa Glutaredoxin family protein
265 LWMH01000001.1 GCA001633025_00157 CDS open 141112-141315 _na     67_aa copZ Copper resistance protein CopZ
266 LWMH01000001.1 GCA001633025_00158 CDS open 141342-141959 _na     205_aa Nitrite reductase
267 LWMH01000001.1 GCA001633025_00159 CDS open 141987-144425 _na     812_aa copZ copper chaperone CopZ
268 LWMH01000001.1 GCA001633025_00160 CDS open 144459-144668 _na     69_aa copZ Copper resistance protein CopZ
269 LWMH01000001.1 GCA001633025_00161 CDS open 144887-145234 _na     115_aa csoR CsoR family transcriptional regulator
270 LWMH01000001.1 GCA001633025_00162 CDS open 145528-145779 _na     83_aa SHOCT domain-containing protein
271 LWMH01000001.1 GCA001633025_00163 CDS open 146054-147118 _na     354_aa Monooxygenase
272 LWMH01000001.1 GCA001633025_00164 CDS open 147139-148383 _na     414_aa Major facilitator superfamily (MFS) profile domain-containing protein
273 LWMH01000001.1 GCA001633025_00165 CDS open 148612-149007 _na     131_aa merR MerR family transcriptional regulator
274 LWMH01000001.1 GCA001633025_00166 CDS open 149291-149626 _na     111_aa hypothetical protein
275 LWMH01000001.1 GCA001633025_00167 CDS open 149812-150798 _na     328_aa Arsenic resistance protein
276 LWMH01000001.1 GCA001633025_00168 CDS open 150850-151314 _na     154_aa putative iron-sulfur cluster-binding metallochaperone
277 LWMH01000001.1 GCA001633025_00169 CDS open 151558-151992 _na     144_aa Tyrosine specific protein phosphatases domain-containing protein
278 LWMH01000001.1 GCA001633025_00170 CDS open 152019-152303 _na     94_aa Adhesin
279 LWMH01000001.1 GCA001633025_00171 CDS open 152340-152903 _na     187_aa Arsenical pump-driving ATPase
280 LWMH01000001.1 GCA001633025_00172 CDS open 152911-154107 _na     398_aa Arsenical pump-driving ATPase
281 LWMH01000001.1 GCA001633025_00173 CDS open 154128-154487 _na     119_aa arsD arsenite efflux transporter metallochaperone ArsD
282 LWMH01000001.1 GCA001633025_00174 CDS open 154551-154970 _na     139_aa arsC arsenate reductase (thioredoxin)
283 LWMH01000001.1 GCA001633025_00175 CDS open 154998-156293 _na     431_aa Arsenical pump membrane protein
284 LWMH01000001.1 GCA001633025_00176 CDS open 156414-156728 _na     104_aa Transcriptional regulator
285 LWMH01000001.1 GCA001633025_00177 CDS open 157142-159469 _na     775_aa gshB bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB
286 LWMH01000001.1 GCA001633025_00178 CDS open 159498-160841 _na     447_aa norM putative multidrug resistance protein NorM
287 LWMH01000001.1 GCA001633025_00179 CDS open 161001-161963 _na     320_aa trxB thioredoxin-disulfide reductase
288 LWMH01000001.1 GCA001633025_00180 CDS open 162033-163439 _na     468_aa Glutamate synthase
289 LWMH01000001.1 GCA001633025_00181 CDS open 163500-163814 _na     104_aa Arsenical resistance operon repressor
290 LWMH01000001.1 GCA001633025_00182 CDS open 164027-164476 _na     149_aa HTH marR-type domain-containing protein
291 LWMH01000001.1 GCA001633025_00183 CDS open 164506-164670 _na     54_aa hypothetical protein
292 LWMH01000001.1 GCA001633025_00184 CDS open 164702-165229 _na     175_aa arsN1 arsinothricin resistance N-acetyltransferase ArsN1 family A
293 LWMH01000001.1 GCA001633025_00185 CDS open 165763-166932 _na     389_aa Sodium:proton antiporter
294 LWMH01000001.1 GCA001633025_00186 CDS open 167435-167977 _na     180_aa Resolvase/invertase-type recombinase catalytic domain-containing protein
295 LWMH01000001.1 GCA001633025_00187 CDS open 168138-169601 _na     487_aa Sulfate permease
296 LWMH01000001.1 GCA001633025_00188 CDS open 169618-170037 _na     139_aa uspA UspA domain-containing protein
297 LWMH01000001.1 GCA001633025_00189 CDS open 170273-170833 _na     186_aa Cupin
298 LWMH01000001.1 GCA001633025_00190 CDS open 171041-171571 _na     176_aa Transposase
299 LWMH01000001.1 GCA001633025_00191 CDS open 171586-172395 _na     269_aa IS3 family transposase
300 LWMH01000001.1 GCA001633025_00192 CDS open 173679-173954 _na     91_aa hypothetical protein
301 LWMH01000001.1 GCA001633025_00193 CDS open 174162-174653 _na     163_aa hypothetical protein
302 LWMH01000001.1 GCA001633025_00194 CDS open 174719-174931 _na     70_aa hypothetical protein
303 LWMH01000001.1 GCA001633025_00195 CDS open 175361-175549 _na     62_aa hypothetical protein
304 LWMH01000001.1 GCA001633025_00196 CDS open 175766-178000 _na     744_aa SLH domain-containing protein
305 LWMH01000001.1 GCA001633025_00197 CDS open 177990-178457 _na     155_aa Disulfide oxidoreductase
306 LWMH01000001.1 GCA001633025_00198 CDS open 178444-179124 _na     226_aa Thioredoxin domain-containing protein
307 LWMH01000001.1 GCA001633025_00199 CDS open 179235-179840 _na     201_aa lexA transcriptional repressor LexA
308 LWMH01000001.1 GCA001633025_00200 CDS open 179888-180496 _na     202_aa hypothetical protein
309 LWMH01000001.1 GCA001633025_00201 CDS open 180498-180971 _na     157_aa hypothetical protein
310 LWMH01000001.1 GCA001633025_00202 CDS open 180985-181602 _na     205_aa hypothetical protein
311 LWMH01000001.1 GCA001633025_00203 CDS open 181700-181858 _na     52_aa aspartyl-phosphate phosphatase Spo0E family protein
312 LWMH01000001.1 GCA001633025_00204 CDS open 181894-182385 _na     163_aa Type IV secretion system pilin
313 LWMH01000001.1 GCA001633025_00205 CDS open 182410-182910 _na     166_aa hypothetical protein
314 LWMH01000001.1 GCA001633025_00206 CDS open 182923-184782 _na     619_aa NlpC/P60 domain-containing protein
315 LWMH01000001.1 GCA001633025_00207 CDS open 184849-187146 _na     765_aa Type IV secretion system protein
316 LWMH01000001.1 GCA001633025_00208 CDS open 187147-189258 _na     703_aa virB4 VirB4 family type IV secretion system protein
317 LWMH01000001.1 GCA001633025_00209 CDS open 189239-190123 _na     294_aa hypothetical protein
318 LWMH01000001.1 GCA001633025_00210 CDS open 190151-190462 _na     103_aa prgI PrgI family protein
319 LWMH01000001.1 GCA001633025_00211 CDS open 190526-190921 _na     131_aa TrbC/VIRB2 family protein
320 LWMH01000001.1 GCA001633025_00212 CDS open 191124-191519 _na     131_aa hypothetical protein
321 LWMH01000001.1 GCA001633025_00213 CDS open 191782-192585 _na     267_aa pilP Pilus assembly protein PilP
322 LWMH01000001.1 GCA001633025_00214 CDS open 192597-192848 _na     83_aa hypothetical protein
323 LWMH01000001.1 GCA001633025_00215 CDS open 193153-194316 _na     387_aa DNA polymerase III subunit beta
324 LWMH01000001.1 GCA001633025_00216 CDS open 194780-194944 _na     54_aa hypothetical protein
325 LWMH01000001.1 GCA001633025_00217 CDS open 195563-196546 _na     327_aa hypothetical protein
326 LWMH01000001.1 GCA001633025_00218 CDS open 197018-197518 _na     166_aa JAB domain-containing protein
327 LWMH01000001.1 GCA001633025_00219 CDS open 197518-199344 _na     608_aa THIF-type NAD/FAD binding fold domain-containing protein
328 LWMH01000001.1 GCA001633025_00220 CDS open 199341-200462 _na     373_aa Nucleotidyltransferase
329 LWMH01000001.1 GCA001633025_00221 CDS open 200481-202001 _na     506_aa SMODS-associated and fused to various effectors domain-containing protein
330 LWMH01000001.1 GCA001633025_00222 CDS open 202857-204437 _na     526_aa DUF2813 domain-containing protein
331 LWMH01000001.1 GCA001633025_00223 CDS open 204419-205534 _na     371_aa DNA helicase
332 LWMH01000001.1 GCA001633025_00224 CDS open 205678-205923 _na     81_aa hypothetical protein
333 LWMH01000001.1 GCA001633025_00225 CDS open 205929-207050 _na     373_aa hypothetical protein
334 LWMH01000001.1 GCA001633025_00226 CDS open 207047-207979 _na     310_aa ATP-grasp fold RimK-type domain-containing protein
335 LWMH01000001.1 GCA001633025_00227 CDS open 208574-209062 _na     162_aa MotA/TolQ/ExbB proton channel domain-containing protein
336 LWMH01000001.1 GCA001633025_00228 CDS open 209592-209777 _na     61_aa DUF951 domain-containing protein
337 LWMH01000001.1 GCA001633025_00229 CDS open 210071-210262 _na     63_aa hypothetical protein
338 LWMH01000001.1 GCA001633025_00230 CDS open 210283-212316 _na     677_aa tnsD Transposon Tn7 transposition protein TnsD C-terminal domain-containing protein
339 LWMH01000001.1 GCA001633025_00231 CDS open 212342-213940 _na     532_aa tnsD Transposon Tn7 transposition protein TnsD C-terminal domain-containing protein
340 LWMH01000001.1 GCA001633025_00232 CDS open 214204-214704 _na     166_aa hypothetical protein
341 LWMH01000001.1 GCA001633025_00233 CDS open 214643-215878 _na     411_aa ORC1/DEAH AAA+ ATPase domain-containing protein
342 LWMH01000001.1 GCA001633025_00234 CDS open 216093-218261 _na     722_aa Integrase catalytic domain-containing protein
343 LWMH01000001.1 GCA001633025_00235 CDS open 218275-219084 _na     269_aa Transposase
344 LWMH01000001.1 GCA001633025_00236 CDS open 219376-220170 _na     264_aa hypothetical protein
345 LWMH01000001.1 GCA001633025_00237 CDS open 220183-220509 _na     108_aa hypothetical protein
346 LWMH01000001.1 GCA001633025_00238 CDS open 220644-221888 _na     414_aa hypothetical protein
347 LWMH01000001.1 GCA001633025_00239 CDS open 221881-222543 _na     220_aa MAGE domain-containing protein
348 LWMH01000001.1 GCA001633025_00240 CDS open 222524-225376 _na     950_aa Rad50/SbcC-type AAA domain-containing protein
349 LWMH01000001.1 GCA001633025_00241 CDS open 225404-226807 _na     467_aa jetD Wadjet protein JetD C-terminal domain-containing protein
350 LWMH01000001.1 GCA001633025_00242 CDS open 227555-228238 _na     227_aa Abasic site processing protein
351 LWMH01000001.1 GCA001633025_00243 CDS open 228392-228640 _na     82_aa hypothetical protein
352 LWMH01000001.1 GCA001633025_00244 CDS open 228750-229169 _na     139_aa hypothetical protein
353 LWMH01000001.1 GCA001633025_00245 CDS open 229349-229699 _na     116_aa DUF3221 domain-containing protein
354 LWMH01000001.1 GCA001633025_00246 CDS open 229760-230755 _na     331_aa Peptidase S1A alpha-lytic prodomain domain-containing protein
355 LWMH01000001.1 GCA001633025_00247 CDS open 230914-231939 _na     341_aa Butirosin biosynthesis protein H N-terminal domain-containing protein
356 LWMH01000001.1 GCA001633025_00248 CDS open 231955-233433 _na     492_aa AMP-dependent synthetase
357 LWMH01000001.1 GCA001633025_00249 CDS open 234413-235051 _na     212_aa DUF4367 domain-containing protein
358 LWMH01000001.1 GCA001633025_00250 CDS open 235220-235858 _na     212_aa DUF4367 domain-containing protein
359 LWMH01000001.1 GCA001633025_00251 CDS open 235904-236392 _na     162_aa peptidoglycan-binding protein
360 LWMH01000001.1 GCA001633025_00252 CDS open 236662-236871 _na     69_aa hypothetical protein
361 LWMH01000001.1 GCA001633025_00253 CDS open 236854-237330 _na     158_aa SpoVT-AbrB domain-containing protein
362 LWMH01000001.1 GCA001633025_00254 CDS open 237564-238223 _na     219_aa Integrase catalytic domain-containing protein
363 LWMH01000001.1 GCA001633025_00255 CDS open 239522-240271 _na     249_aa DUF4046 domain-containing protein
364 LWMH01000001.1 GCA001633025_00256 CDS open 240705-242285 _na     526_aa gerA Spore gernimation protein GerA
365 LWMH01000001.1 GCA001633025_00257 CDS open 242233-243390 _na     385_aa Spore gernimation protein
366 LWMH01000001.1 GCA001633025_00258 CDS open 243380-244609 _na     409_aa gerC Spore gernimation protein GerC
367 LWMH01000001.1 GCA001633025_00259 CDS open 244627-244833 _na     68_aa HIG1 domain-containing protein
368 LWMH01000001.1 GCA001633025_00260 CDS open 245240-245464 _na     74_aa hypothetical protein
369 LWMH01000001.1 GCA001633025_00261 CDS open 245963-247108 _na     381_aa gerAC Spore germination GerAC-like C-terminal domain-containing protein
370 LWMH01000001.1 GCA001633025_00262 CDS open 247123-248670 _na     515_aa gerAA Spore germination protein
371 LWMH01000001.1 GCA001633025_00263 CDS open 248680-249753 _na     357_aa gerAB Germination protein GerKB
372 LWMH01000001.1 GCA001633025_00264 CDS open 250002-250286 _na     94_aa N-acetylmuramoyl-L-alanine amidase
373 LWMH01000001.1 GCA001633025_00265 CDS open 250342-250692 _na     116_aa N-acetylmuramoyl-L-alanine amidase
374 LWMH01000001.1 GCA001633025_00266 CDS open 251057-251509 _na     150_aa AsmA-like C-terminal domain-containing protein
375 LWMH01000001.1 GCA001633025_00267 CDS open 251764-252339 _na     191_aa spoIVCA Transposon Tn1546 resolvase
376 LWMH01000001.1 GCA001633025_00268 CDS open 252403-252573 _na     56_aa hypothetical protein
377 LWMH01000001.1 GCA001633025_00269 CDS open 252683-253009 _na     108_aa Transposase
378 LWMH01000001.1 GCA001633025_00270 CDS open 253027-253938 _na     303_aa IS3 family transposase
379 LWMH01000001.1 GCA001633025_00271 CDS open 253972-254130 _na     52_aa hypothetical protein
380 LWMH01000001.1 GCA001633025_00272 CDS open 254208-254441 _na     77_aa merR MerR family transcriptional regulator
381 LWMH01000001.1 GCA001633025_00273 CDS open 254590-255432 _na     280_aa IS3 family transposase
382 LWMH01000001.1 GCA001633025_00274 CDS open 255492-255923 _na     143_aa Putative transposase for insertion sequence element IS3 family
383 LWMH01000001.1 GCA001633025_00275 CDS open 256205-257182 _na     325_aa Type VII secretion system protein EssD-like domain-containing protein
384 LWMH01000001.1 GCA001633025_00276 CDS open 257368-258843 _na     491_aa Amidase
385 LWMH01000001.1 GCA001633025_00277 CDS open 259133-260398 _na     421_aa IS110 family transposase
386 LWMH01000001.1 GCA001633025_00278 CDS open 260726-261046 _na     106_aa hypothetical protein
387 LWMH01000001.1 GCA001633025_00279 CDS open 261465-262391 _na     308_aa Phosphoadenosine phosphosulphate reductase domain-containing protein
388 LWMH01000001.1 GCA001633025_00280 CDS open 262406-262657 _na     83_aa hypothetical protein
389 LWMH01000001.1 GCA001633025_00281 CDS open 262736-263362 _na     208_aa hypothetical protein
390 LWMH01000001.1 GCA001633025_00282 CDS open 263626-265170 _na     514_aa DNA (cytosine-5-)-methyltransferase
391 LWMH01000001.1 GCA001633025_00283 CDS open 265446-265913 _na     155_aa Lipoprotein
392 LWMH01000001.1 GCA001633025_00284 CDS open 265960-266397 _na     145_aa hypothetical protein
393 LWMH01000001.1 GCA001633025_00285 CDS open 266578-275859 _na     3093_aa S-layer protein
394 LWMH01000001.1 GCA001633025_00286 CDS open 276499-277932 _na     477_aa DNA (cytosine-5-)-methyltransferase
395 LWMH01000001.1 GCA001633025_00287 CDS open 277960-279384 _na     474_aa DNA (cytosine-5-)-methyltransferase
396 LWMH01000001.1 GCA001633025_00288 CDS open 279539-280057 _na     172_aa hypothetical protein
397 LWMH01000001.1 GCA001633025_00289 CDS open 280075-280314 _na     79_aa hypothetical protein
398 LWMH01000001.1 GCA001633025_00290 CDS open 280502-280954 _na     150_aa hypothetical protein
399 LWMH01000001.1 GCA001633025_00291 CDS open 281047-281235 _na     62_aa hypothetical protein
400 LWMH01000001.1 GCA001633025_00292 CDS open 281965-282312 _na     115_aa Condensation domain-containing protein
401 LWMH01000001.1 GCA001633025_00293 CDS open 282760-283314 _na     184_aa hypothetical protein
402 LWMH01000001.1 GCA001633025_00294 CDS open 283311-283703 _na     130_aa hypothetical protein
403 LWMH01000001.1 GCA001633025_00295 CDS open 284125-284511 _na     128_aa 5'-3' exonuclease domain-containing protein
404 LWMH01000001.1 GCA001633025_00296 CDS open 284566-285525 _na     319_aa 5'-3' exonuclease domain-containing protein
405 LWMH01000001.1 GCA001633025_00297 CDS open 285792-286850 _na     352_aa hypothetical protein
406 LWMH01000001.1 GCA001633025_00298 CDS open 286973-287074 _na     33_aa hypothetical protein
407 LWMH01000001.1 GCA001633025_00299 CDS open 287151-287339 _na     62_aa hypothetical protein
408 LWMH01000001.1 GCA001633025_00300 CDS open 287357-288610 _na     417_aa hypothetical protein
409 LWMH01000001.1 GCA001633025_00301 CDS open 288710-290023 _na     437_aa Zinc finger CHC2-type domain-containing protein
410 LWMH01000001.1 GCA001633025_00302 CDS open 290428-291573 _na     381_aa Replication-relaxation
411 LWMH01000001.1 GCA001633025_00303 CDS open 291577-292488 _na     303_aa S1 motif domain-containing protein
412 LWMH01000001.1 GCA001633025_00304 CDS open 292653-295637 _na     994_aa traM TraD/TraG TraM recognition site domain-containing protein
413 LWMH01000001.1 GCA001633025_00305 CDS open 296012-296296 _na     94_aa hypothetical protein
414 LWMH01000001.1 GCA001633025_00306 CDS open 296420-296881 _na     153_aa hypothetical protein
415 LWMH01000001.1 GCA001633025_00307 CDS open 296926-297627 _na     233_aa hypothetical protein
416 LWMH01000001.1 GCA001633025_00308 CDS open 298373-299920 _na     515_aa hypothetical protein
417 LWMH01000001.1 GCA001633025_00309 CDS open 300522-301769 _na     415_aa Replication initiator protein A
418 LWMH01000001.1 GCA001633025_00310 CDS open 301943-302284 _na     113_aa hypothetical protein
419 LWMH01000001.1 GCA001633025_00311 CDS open 302654-302926 _na     90_aa hypothetical protein
420 LWMH01000001.1 GCA001633025_00312 CDS open 303222-303497 _na     91_aa hypothetical protein
421 LWMH01000001.1 GCA001633025_00313 CDS open 303916-304317 _na     133_aa DUF3221 domain-containing protein
422 LWMH01000001.1 GCA001633025_00314 CDS open 304463-304834 _na     123_aa DUF4257 domain-containing protein
423 LWMH01000001.1 GCA001633025_00315 CDS open 304922-305071 _na     49_aa hypothetical protein
424 LWMH01000001.1 GCA001633025_00316 CDS open 305201-305512 _na     103_aa hypothetical protein
425 LWMH01000001.1 GCA001633025_00317 CDS open 305585-305857 _na     90_aa hypothetical protein
426 LWMH01000001.1 GCA001633025_00318 CDS open 305954-306847 _na     297_aa hypothetical protein
427 LWMH01000001.1 GCA001633025_00319 CDS open 307376-307564 _na     62_aa WYL domain-containing protein
428 LWMH01000001.1 GCA001633025_00320 CDS open 307824-308201 _na     125_aa hypothetical protein
429 LWMH01000001.1 GCA001633025_00321 CDS open 308514-308795 _na     93_aa Transposase
430 LWMH01000001.1 GCA001633025_00322 CDS open 308837-309631 _na     264_aa IS3 family transposase
431 LWMH01000001.1 GCA001633025_00323 CDS open 309756-311111 _na     451_aa hypothetical protein
432 LWMH01000001.1 GCA001633025_00324 CDS open 311597-311986 _na     129_aa hypothetical protein
433 LWMH01000001.1 GCA001633025_00325 CDS open 312036-312272 _na     78_aa hypothetical protein
434 LWMH01000001.1 GCA001633025_00326 CDS open 312326-313012 _na     228_aa hypothetical protein
435 LWMH01000001.1 GCA001633025_00327 CDS open 313532-314005 _na     157_aa hypothetical protein
436 LWMH01000001.1 GCA001633025_00328 CDS open 314002-314349 _na     115_aa hypothetical protein
437 LWMH01000001.1 GCA001633025_00329 CDS open 314797-314982 _na     61_aa hypothetical protein
438 LWMH01000001.1 GCA001633025_00330 CDS open 315004-315270 _na     88_aa hypothetical protein
439 LWMH01000001.1 GCA001633025_00331 CDS open 315728-316360 _na     210_aa Phospholipase A2 domain-containing protein
440 LWMH01000001.1 GCA001633025_00332 CDS open 316948-317190 _na     80_aa DUF2508 domain-containing protein
441 LWMH01000001.1 GCA001633025_00333 CDS open 317454-318008 _na     184_aa RNA polymerase sigma-70 region 4 domain-containing protein
442 LWMH01000001.1 GCA001633025_00334 CDS open 318014-318304 _na     96_aa Helix-turn-helix conjugative transposon-like domain-containing protein
443 LWMH01000001.1 GCA001633025_00335 CDS open 318371-318505 _na     44_aa hypothetical protein
444 LWMH01000001.1 GCA001633025_00336 CDS open 319683-320903 _na     406_aa Initiator Rep protein WH1 domain-containing protein
445 LWMH01000001.1 GCA001633025_00337 CDS open 321328-321933 _na     201_aa hypothetical protein
446 LWMH01000001.1 GCA001633025_00338 CDS open 321979-322542 _na     187_aa Anaerobic ribonucleoside-triphosphate reductase-activating protein
447 LWMH01000001.1 GCA001633025_00339 CDS open 322546-322755 _na     69_aa DUF2997 domain-containing protein
448 LWMH01000001.1 GCA001633025_00340 CDS open 322759-323133 _na     124_aa DUF1257 domain-containing protein
449 LWMH01000001.1 GCA001633025_00341 CDS open 323182-324837 _na     551_aa putative AAA domain-containing protein ycf46
450 LWMH01000001.1 GCA001633025_00342 CDS open 325143-325805 _na     220_aa dsbB Disulfide bond formation protein DsbB
451 LWMH01000001.1 GCA001633025_00343 CDS open 325991-326320 _na     109_aa PH domain-containing protein
452 LWMH01000001.1 GCA001633025_00344 CDS open 326359-327246 _na     295_aa hypothetical protein
453 LWMH01000001.1 GCA001633025_00345 CDS open 327359-328096 _na     245_aa Cell filamentation protein Fic
454 LWMH01000001.1 GCA001633025_00346 CDS open 328169-328345 _na     58_aa hypothetical protein
455 LWMH01000001.1 GCA001633025_00347 CDS open 328351-329574 _na     407_aa Phosphoadenosine phosphosulphate reductase domain-containing protein
456 LWMH01000001.1 GCA001633025_00348 CDS open 329812-330663 _na     283_aa DNA methylase adenine-specific domain-containing protein
457 LWMH01000001.1 GCA001633025_00349 CDS open 330851-331126 _na     91_aa hypothetical protein
458 LWMH01000001.1 GCA001633025_00350 CDS open 331382-331687 _na     101_aa hypothetical protein
459 LWMH01000001.1 GCA001633025_00351 CDS open 332095-332373 _na     92_aa hypothetical protein
460 LWMH01000001.1 GCA001633025_00352 CDS open 332483-332821 _na     112_aa hypothetical protein
461 LWMH01000001.1 GCA001633025_00353 CDS open 333037-333330 _na     97_aa hypothetical protein
462 LWMH01000001.1 GCA001633025_00354 CDS open 333384-333929 _na     181_aa hypothetical protein
463 LWMH01000001.1 GCA001633025_00355 CDS open 333976-335046 _na     356_aa Large polyvalent protein associated domain-containing protein
464 LWMH01000001.1 GCA001633025_00356 CDS open 335400-335573 _na     57_aa hypothetical protein
465 LWMH01000001.1 GCA001633025_00357 CDS open 335577-336137 _na     186_aa GNAT family N-acetyltransferase
466 LWMH01000001.1 GCA001633025_00358 CDS open 336207-337043 _na     278_aa hypothetical protein
467 LWMH01000001.1 GCA001633025_00359 CDS open 337511-337849 _na     112_aa DUF3221 domain-containing protein
468 LWMH01000001.1 GCA001633025_00360 CDS open 337889-339175 _na     428_aa Peptidase S1 domain-containing protein
469 LWMH01000001.1 GCA001633025_00361 CDS open 339593-340036 _na     147_aa GTP pyrophosphokinase
470 LWMH01000001.1 GCA001633025_00362 CDS open 340151-340384 _na     77_aa ASCH domain-containing protein
471 LWMH01000001.1 GCA001633025_00363 CDS open 340544-341464 _na     306_aa DNA methylase N-4/N-6 domain-containing protein
472 LWMH01000001.1 GCA001633025_00364 CDS open 341777-343780 _na     667_aa NERD domain-containing protein
473 LWMH01000001.1 GCA001633025_00365 CDS open 344303-344851 _na     182_aa Isoprenylcysteine carboxyl methyltransferase
474 LWMH01000001.1 GCA001633025_00366 CDS open 345033-345452 _na     139_aa hypothetical protein
475 LWMH01000001.1 GCA001633025_00367 CDS open 345568-345846 _na     92_aa hypothetical protein
476 LWMH01000001.1 GCA001633025_00368 CDS open 346198-346443 _na     81_aa hypothetical protein
477 LWMH01000001.1 GCA001633025_00369 CDS open 346558-346911 _na     117_aa pilZ PilZ domain-containing protein
478 LWMH01000001.1 GCA001633025_00370 CDS open 347121-347525 _na     134_aa GIY-YIG domain-containing protein
479 LWMH01000001.1 GCA001633025_00371 CDS open 347662-347964 _na     100_aa hypothetical protein
480 LWMH01000001.1 GCA001633025_00372 CDS open 347961-348443 _na     160_aa hypothetical protein
481 LWMH01000001.1 GCA001633025_00373 CDS open 348542-349030 _na     162_aa hypothetical protein
482 LWMH01000001.1 GCA001633025_00374 CDS open 349109-349396 _na     95_aa hypothetical protein
483 LWMH01000001.1 GCA001633025_00375 CDS open 349690-350106 _na     138_aa hypothetical protein
484 LWMH01000001.1 GCA001633025_00376 CDS open 350128-351411 _na     427_aa RES domain-containing protein
485 LWMH01000001.1 GCA001633025_00377 CDS open 352395-352547 _na     50_aa hypothetical protein
486 LWMH01000001.1 GCA001633025_00378 CDS open 352622-352726 _na     34_aa hypothetical protein
487 LWMH01000001.1 GCA001633025_00379 CDS open 353620-354621 _na     333_aa ClpX-type ZB domain-containing protein
488 LWMH01000001.1 GCA001633025_00380 CDS open 354870-354992 _na     40_aa hypothetical protein
489 LWMH01000001.1 GCA001633025_00381 CDS open 355069-355800 _na     243_aa hypothetical protein
490 LWMH01000001.1 GCA001633025_00382 CDS open 355823-356098 _na     91_aa hypothetical protein
491 LWMH01000001.1 GCA001633025_00383 CDS open 356176-357537 _na     453_aa Replication-relaxation
492 LWMH01000001.1 GCA001633025_00384 CDS open 358710-359207 _na     165_aa hypothetical protein
493 LWMH01000001.1 GCA001633025_00385 CDS open 359265-360473 _na     402_aa Actin-like protein N-terminal domain-containing protein
494 LWMH01000001.1 GCA001633025_00386 CDS open 361187-361894 _na     235_aa HTH merR-type domain-containing protein
495 LWMH01000001.1 GCA001633025_00387 CDS open 362079-362303 _na     74_aa HTH cro/C1-type domain-containing protein
496 LWMH01000001.1 GCA001633025_00388 CDS open 362300-363736 _na     478_aa CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein
497 LWMH01000001.1 GCA001633025_00389 CDS open 363753-364838 _na     361_aa SAF domain-containing protein
498 LWMH01000001.1 GCA001633025_00390 CDS open 364858-365535 _na     225_aa hypothetical protein
499 LWMH01000001.1 GCA001633025_00391 CDS open 365538-366371 _na     277_aa AAA domain-containing protein
500 LWMH01000001.1 GCA001633025_00392 CDS open 366372-368258 _na     628_aa tadA Flp pilus assembly complex ATPase component TadA