HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Hoylesella shahii (GCA_003201715.1)

Select a Genome:
BAKTA Annotations for GCA_003201715.1
Genome Selected: Hoylesella shahii
ContigsBases CDSrRNA tmRNAtRNA
98 3511526 2803 2 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5720 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 5720 [12 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 QJJX01000015.1 GCA003201715_01498 gene open 74065-76104
3002 QJJX01000015.1 GCA003201715_01499 gene open 76381-76602
3003 QJJX01000015.1 GCA003201715_01500 gene open 76615-76809
3004 QJJX01000016.1 GCA003201715_01501 CDS open 398-772 _na     124_aa Lipoprotein
3005 QJJX01000016.1 GCA003201715_01502 CDS open 930-1472 _na     180_aa Carbonic anhydrase
3006 QJJX01000016.1 GCA003201715_01503 CDS open 1659-2345 _na     228_aa Putative nitroreductase
3007 QJJX01000016.1 GCA003201715_01504 CDS open 3013-3306 _na     97_aa Glutaredoxin-related protein
3008 QJJX01000016.1 GCA003201715_01505 CDS open 3322-3585 _na     87_aa Putative membrane protein YeaQ/YmgE (Transglycosylase-associated protein family)
3009 QJJX01000016.1 GCA003201715_01506 CDS open 3590-3880 _na     96_aa DUF1294 domain-containing protein
3010 QJJX01000016.1 GCA003201715_01507 CDS open 4241-8623 _na     1460_aa Outer membrane insertion signal domain protein
3011 QJJX01000016.1 GCA003201715_01508 CDS open 8657-11062 _na     801_aa OmpA-like domain-containing protein
3012 QJJX01000016.1 GCA003201715_01509 CDS open 11078-11647 _na     189_aa DUF3575 domain-containing protein
3013 QJJX01000016.1 GCA003201715_01510 CDS open 11664-13208 _na     514_aa DUF3575 domain-containing protein
3014 QJJX01000016.1 GCA003201715_01511 CDS open 13241-14686 _na     481_aa Tetratricopeptide repeat protein
3015 QJJX01000016.1 GCA003201715_01512 CDS open 15023-15598 _na     191_aa Late embryogeneis abundant protein
3016 QJJX01000016.1 GCA003201715_01513 CDS open 15673-15771 _na     32_aa hypothetical protein
3017 QJJX01000016.1 GCA003201715_01514 CDS open 16198-16806 _na     202_aa Phosphopantetheinyl transferase
3018 QJJX01000016.1 GCA003201715_01515 CDS open 16924-18243 _na     439_aa gldE Gliding motility-associated protein GldE
3019 QJJX01000016.1 GCA003201715_01516 CDS open 18259-18660 _na     133_aa Single-stranded DNA-binding protein
3020 QJJX01000016.1 GCA003201715_01517 CDS open 18689-19240 _na     183_aa Phage protein
3021 QJJX01000016.1 GCA003201715_01522 CDS open 20672-21286 _na     204_aa Periplasmic chaperone for outer membrane proteins Skp
3022 QJJX01000016.1 GCA003201715_01523 CDS open 21349-21579 _na     76_aa Secreted protein
3023 QJJX01000016.1 GCA003201715_01524 CDS open 21669-23126 _na     485_aa Xaa-His dipeptidase
3024 QJJX01000016.1 GCA003201715_01525 CDS open 23130-23525 _na     131_aa Lipoprotein
3025 QJJX01000016.1 GCA003201715_01526 CDS open 23629-23793 _na     54_aa hypothetical protein
3026 QJJX01000016.1 GCA003201715_01527 CDS open 23961-24080 _na     39_aa Transposase
3027 QJJX01000016.1 GCA003201715_01528 CDS open 24077-24235 _na     52_aa DUF4295 domain-containing protein
3028 QJJX01000016.1 GCA003201715_01529 CDS open 24256-24444 _na     62_aa rpmG 50S ribosomal protein L33
3029 QJJX01000016.1 GCA003201715_01530 CDS open 24450-24713 _na     87_aa rpmB 50S ribosomal protein L28
3030 QJJX01000016.1 GCA003201715_01531 CDS open 24822-24932 _na     36_aa hypothetical protein
3031 QJJX01000016.1 GCA003201715_01532 CDS open 25098-25607 _na     169_aa Nicotinamide-nucleotide amidase
3032 QJJX01000016.1 GCA003201715_01533 CDS open 25626-26660 _na     344_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
3033 QJJX01000016.1 GCA003201715_01534 CDS open 26670-27533 _na     287_aa map type I methionyl aminopeptidase
3034 QJJX01000016.1 GCA003201715_01535 CDS open 28048-28659 _na     203_aa DUF3256 domain-containing protein
3035 QJJX01000016.1 GCA003201715_01536 CDS open 28777-31089 _na     770_aa peptidoglycan glycosyltransferase
3036 QJJX01000016.1 GCA003201715_01537 CDS open 31210-32157 _na     315_aa pyrB aspartate carbamoyltransferase
3037 QJJX01000016.1 GCA003201715_01538 CDS open 32154-32615 _na     153_aa Aspartate carbamoyltransferase regulatory chain
3038 QJJX01000016.1 GCA003201715_01539 CDS open 32732-34012 _na     426_aa Serine hydroxymethyltransferase
3039 QJJX01000016.1 GCA003201715_01540 CDS open 35308-36537 _na     409_aa BaiN-like insert domain-containing protein
3040 QJJX01000016.1 GCA003201715_01541 CDS open 36821-37240 _na     139_aa putative protein (TIGR00369 family)
3041 QJJX01000016.1 GCA003201715_01542 CDS open 37221-38318 _na     365_aa isochorismate synthase
3042 QJJX01000016.1 GCA003201715_01543 CDS open 38517-40163 _na     548_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
3043 QJJX01000016.1 GCA003201715_01544 CDS open 40221-41045 _na     274_aa menB 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
3044 QJJX01000016.1 GCA003201715_01545 CDS open 41053-42093 _na     346_aa O-succinylbenzoate synthase
3045 QJJX01000016.1 GCA003201715_01546 CDS open 42072-43082 _na     336_aa O-succinylbenzoic acid--CoA ligase
3046 QJJX01000016.1 GCA003201715_01547 CDS open 43126-43818 _na     230_aa Outer membrane insertion signal domain protein
3047 QJJX01000016.1 GCA003201715_01548 CDS open 44127-44717 _na     196_aa DUF4468 domain-containing protein
3048 QJJX01000016.1 GCA003201715_01549 CDS open 44813-45586 _na     257_aa pilF Tfp pilus assembly protein PilF
3049 QJJX01000016.1 GCA003201715_01550 CDS open 45843-47378 _na     511_aa rny ribonuclease Y
3050 QJJX01000016.1 GCA003201715_01551 CDS open 47493-47810 _na     105_aa zapA Cell division protein ZapA
3051 QJJX01000016.1 GCA003201715_01552 CDS open 47803-48111 _na     102_aa zapB Cell division protein ZapB
3052 QJJX01000016.1 GCA003201715_01553 CDS open 48305-48991 _na     228_aa Transposase
3053 QJJX01000016.1 GCA003201715_01554 CDS open 49765-51150 _na     461_aa glmM phosphoglucosamine mutase
3054 QJJX01000016.1 GCA003201715_01555 CDS open 51164-51811 _na     215_aa DUF4827 domain-containing protein
3055 QJJX01000016.1 GCA003201715_01556 CDS open 51826-51969 _na     47_aa hypothetical protein
3056 QJJX01000016.1 GCA003201715_01557 CDS open 52060-53097 _na     345_aa Phosphoesterase RecJ-like protein
3057 QJJX01000016.1 GCA003201715_01558 CDS open 53243-53632 _na     129_aa DUF1573 domain-containing protein
3058 QJJX01000016.1 GCA003201715_01559 CDS open 54051-56039 _na     662_aa pilF Tfp pilus assembly protein PilF
3059 QJJX01000016.1 GCA003201715_01560 CDS open 56105-56668 _na     187_aa def peptide deformylase
3060 QJJX01000016.1 GCA003201715_01561 CDS open 56665-57081 _na     138_aa ruvX Holliday junction resolvase RuvX
3061 QJJX01000016.1 GCA003201715_01562 CDS open 57089-57580 _na     163_aa Sporulation related protein
3062 QJJX01000016.1 GCA003201715_01563 CDS open 57631-57741 _na     36_aa hypothetical protein
3063 QJJX01000016.1 GCA003201715_01564 CDS open 57851-58072 _na     73_aa YtxH-like protein
3064 QJJX01000016.1 GCA003201715_01565 CDS open 58081-58428 _na     115_aa Putative superfamily III holin-X
3065 QJJX01000016.1 GCA003201715_01566 CDS open 58432-58713 _na     93_aa DUF3618 domain-containing protein
3066 QJJX01000016.1 GCA003201715_01567 CDS open 58963-59724 _na     253_aa Phosphoribosyl 1%2C2-cyclic phosphate phosphodiesterase
3067 QJJX01000016.1 GCA003201715_01568 CDS open 59721-60737 _na     338_aa murB UDP-N-acetylmuramate dehydrogenase
3068 QJJX01000016.1 GCA003201715_01569 CDS open 60751-61605 _na     284_aa DUF4348 domain-containing protein
3069 QJJX01000016.1 GCA003201715_01570 CDS open 61805-62842 _na     345_aa pheS phenylalanine--tRNA ligase subunit alpha
3070 QJJX01000016.1 GCA003201715_01571 CDS open 63352-64311 _na     319_aa DUF1266 domain-containing protein
3071 QJJX01000016.1 GCA003201715_01572 CDS open 64350-65081 _na     243_aa DUF1266 domain-containing protein
3072 QJJX01000016.1 GCA003201715_01573 CDS open 65107-65952 _na     281_aa Peptidase%2C M48 family
3073 QJJX01000016.1 GCA003201715_01574 CDS open 66132-66284 _na     50_aa hypothetical protein
3074 QJJX01000016.1 GCA003201715_01575 CDS open 66716-66844 _na     42_aa hypothetical protein
3075 QJJX01000016.1 GCA003201715_01576 CDS open 66961-67116 _na     51_aa hypothetical protein
3076 QJJX01000016.1 GCA003201715_01577 CDS open 67720-68532 _na     270_aa Carboxypeptidase-like protein
3077 QJJX01000016.1 GCA003201715_01578 CDS open 68959-70575 _na     538_aa ABC transporter%2C ATP-binding protein
3078 QJJX01000016.1 GCA003201715_01579 CDS open 70649-71251 _na     200_aa grpE Protein GrpE
3079 QJJX01000016.1 GCA003201715_01580 CDS open 71277-72449 _na     390_aa dnaJ molecular chaperone DnaJ
3080 QJJX01000016.1 GCA003201715_01581 CDS open 72449-73762 _na     437_aa tetrahydrofolate synthase
3081 QJJX01000016.1 GCA003201715_01582 CDS open 73968-75059 _na     363_aa Aldose 1-epimerase
3082 QJJX01000016.1 GCA003201715_01583 CDS open 75287-75442 _na     51_aa FHS family L-fucose permease-like MFS transporter
3083 QJJX01000016.1 GCA003201715_01501 gene open 398-772
3084 QJJX01000016.1 GCA003201715_01502 gene open 930-1472
3085 QJJX01000016.1 GCA003201715_01503 gene open 1659-2345
3086 QJJX01000016.1 GCA003201715_01504 gene open 3013-3306
3087 QJJX01000016.1 GCA003201715_01505 gene open 3322-3585
3088 QJJX01000016.1 GCA003201715_01506 gene open 3590-3880
3089 QJJX01000016.1 GCA003201715_01507 gene open 4241-8623
3090 QJJX01000016.1 GCA003201715_01508 gene open 8657-11062
3091 QJJX01000016.1 GCA003201715_01509 gene open 11078-11647
3092 QJJX01000016.1 GCA003201715_01510 gene open 11664-13208
3093 QJJX01000016.1 GCA003201715_01511 gene open 13241-14686
3094 QJJX01000016.1 GCA003201715_01512 gene open 15023-15598
3095 QJJX01000016.1 GCA003201715_01513 gene open 15673-15771
3096 QJJX01000016.1 GCA003201715_01514 gene open 16198-16806
3097 QJJX01000016.1 GCA003201715_01515 gene open 16924-18243 gldE
3098 QJJX01000016.1 GCA003201715_01516 gene open 18259-18660
3099 QJJX01000016.1 GCA003201715_01517 gene open 18689-19240
3100 QJJX01000016.1 GCA003201715_01522 gene open 20672-21286
3101 QJJX01000016.1 GCA003201715_01523 gene open 21349-21579
3102 QJJX01000016.1 GCA003201715_01524 gene open 21669-23126
3103 QJJX01000016.1 GCA003201715_01525 gene open 23130-23525
3104 QJJX01000016.1 GCA003201715_01526 gene open 23629-23793
3105 QJJX01000016.1 GCA003201715_01527 gene open 23961-24080
3106 QJJX01000016.1 GCA003201715_01528 gene open 24077-24235
3107 QJJX01000016.1 GCA003201715_01529 gene open 24256-24444 rpmG
3108 QJJX01000016.1 GCA003201715_01530 gene open 24450-24713 rpmB
3109 QJJX01000016.1 GCA003201715_01531 gene open 24822-24932
3110 QJJX01000016.1 GCA003201715_01532 gene open 25098-25607
3111 QJJX01000016.1 GCA003201715_01533 gene open 25626-26660 tsaD
3112 QJJX01000016.1 GCA003201715_01534 gene open 26670-27533 map
3113 QJJX01000016.1 GCA003201715_01535 gene open 28048-28659
3114 QJJX01000016.1 GCA003201715_01536 gene open 28777-31089
3115 QJJX01000016.1 GCA003201715_01537 gene open 31210-32157 pyrB
3116 QJJX01000016.1 GCA003201715_01538 gene open 32154-32615
3117 QJJX01000016.1 GCA003201715_01539 gene open 32732-34012
3118 QJJX01000016.1 GCA003201715_01540 gene open 35308-36537
3119 QJJX01000016.1 GCA003201715_01541 gene open 36821-37240
3120 QJJX01000016.1 GCA003201715_01542 gene open 37221-38318
3121 QJJX01000016.1 GCA003201715_01543 gene open 38517-40163 menD
3122 QJJX01000016.1 GCA003201715_01544 gene open 40221-41045 menB
3123 QJJX01000016.1 GCA003201715_01545 gene open 41053-42093
3124 QJJX01000016.1 GCA003201715_01546 gene open 42072-43082
3125 QJJX01000016.1 GCA003201715_01547 gene open 43126-43818
3126 QJJX01000016.1 GCA003201715_01548 gene open 44127-44717
3127 QJJX01000016.1 GCA003201715_01549 gene open 44813-45586 pilF
3128 QJJX01000016.1 GCA003201715_01550 gene open 45843-47378 rny
3129 QJJX01000016.1 GCA003201715_01551 gene open 47493-47810 zapA
3130 QJJX01000016.1 GCA003201715_01552 gene open 47803-48111 zapB
3131 QJJX01000016.1 GCA003201715_01553 gene open 48305-48991
3132 QJJX01000016.1 GCA003201715_01554 gene open 49765-51150 glmM
3133 QJJX01000016.1 GCA003201715_01555 gene open 51164-51811
3134 QJJX01000016.1 GCA003201715_01556 gene open 51826-51969
3135 QJJX01000016.1 GCA003201715_01557 gene open 52060-53097
3136 QJJX01000016.1 GCA003201715_01558 gene open 53243-53632
3137 QJJX01000016.1 GCA003201715_01559 gene open 54051-56039 pilF
3138 QJJX01000016.1 GCA003201715_01560 gene open 56105-56668 def
3139 QJJX01000016.1 GCA003201715_01561 gene open 56665-57081 ruvX
3140 QJJX01000016.1 GCA003201715_01562 gene open 57089-57580
3141 QJJX01000016.1 GCA003201715_01563 gene open 57631-57741
3142 QJJX01000016.1 GCA003201715_01564 gene open 57851-58072
3143 QJJX01000016.1 GCA003201715_01565 gene open 58081-58428
3144 QJJX01000016.1 GCA003201715_01566 gene open 58432-58713
3145 QJJX01000016.1 GCA003201715_01567 gene open 58963-59724
3146 QJJX01000016.1 GCA003201715_01568 gene open 59721-60737 murB
3147 QJJX01000016.1 GCA003201715_01569 gene open 60751-61605
3148 QJJX01000016.1 GCA003201715_01570 gene open 61805-62842 pheS
3149 QJJX01000016.1 GCA003201715_01571 gene open 63352-64311
3150 QJJX01000016.1 GCA003201715_01572 gene open 64350-65081
3151 QJJX01000016.1 GCA003201715_01573 gene open 65107-65952
3152 QJJX01000016.1 GCA003201715_01574 gene open 66132-66284
3153 QJJX01000016.1 GCA003201715_01575 gene open 66716-66844
3154 QJJX01000016.1 GCA003201715_01576 gene open 66961-67116
3155 QJJX01000016.1 GCA003201715_01577 gene open 67720-68532
3156 QJJX01000016.1 GCA003201715_01578 gene open 68959-70575
3157 QJJX01000016.1 GCA003201715_01579 gene open 70649-71251 grpE
3158 QJJX01000016.1 GCA003201715_01580 gene open 71277-72449 dnaJ
3159 QJJX01000016.1 GCA003201715_01581 gene open 72449-73762
3160 QJJX01000016.1 GCA003201715_01582 gene open 73968-75059
3161 QJJX01000016.1 GCA003201715_01583 gene open 75287-75442
3162 QJJX01000016.1 GCA003201715_01518 gene open 19264-19336 trnG
3163 QJJX01000016.1 GCA003201715_01519 gene open 19359-19442 trnL
3164 QJJX01000016.1 GCA003201715_01520 gene open 19467-19548 trnL
3165 QJJX01000016.1 GCA003201715_01521 gene open 19575-19647 trnG
3166 QJJX01000016.1 GCA003201715_01518 tRNA open 19264-19336 trnG tRNA-Gly(gcc)
3167 QJJX01000016.1 GCA003201715_01519 tRNA open 19359-19442 trnL tRNA-Leu(gag)
3168 QJJX01000016.1 GCA003201715_01520 tRNA open 19467-19548 trnL tRNA-Leu(cag)
3169 QJJX01000016.1 GCA003201715_01521 tRNA open 19575-19647 trnG tRNA-Gly(gcc)
3170 QJJX01000017.1 GCA003201715_01585 CDS open 315-2936 _na     873_aa calcium-translocating P-type ATPase%2C PMCA-type
3171 QJJX01000017.1 GCA003201715_01586 CDS open 2941-3864 _na     307_aa bifunctional riboflavin kinase/FAD synthetase
3172 QJJX01000017.1 GCA003201715_01587 CDS open 3987-4793 _na     268_aa ydiL Membrane protease YdiL (CAAX protease family)
3173 QJJX01000017.1 GCA003201715_01588 CDS open 5235-5843 _na     202_aa ribonuclease HII
3174 QJJX01000017.1 GCA003201715_01589 CDS open 6005-6295 _na     96_aa hypothetical protein
3175 QJJX01000017.1 GCA003201715_01590 CDS open 6782-8092 _na     436_aa Cysteine desulfurase
3176 QJJX01000017.1 GCA003201715_01591 CDS open 8178-9521 _na     447_aa sufD Fe-S cluster assembly protein SufD
3177 QJJX01000017.1 GCA003201715_01592 CDS open 9534-10289 _na     251_aa sufC Fe-S cluster assembly ATPase SufC
3178 QJJX01000017.1 GCA003201715_01593 CDS open 10309-11070 _na     253_aa Outer membrane protein with beta-barrel domain
3179 QJJX01000017.1 GCA003201715_01594 CDS open 11107-12558 _na     483_aa sufB Fe-S cluster assembly protein SufB
3180 QJJX01000017.1 GCA003201715_01595 CDS open 12926-15913 _na     995_aa infB translation initiation factor IF-2
3181 QJJX01000017.1 GCA003201715_01596 CDS open 15985-17247 _na     420_aa nusA Transcription termination/antitermination protein NusA
3182 QJJX01000017.1 GCA003201715_01597 CDS open 17599-18063 _na     154_aa rimP ribosome assembly cofactor RimP
3183 QJJX01000017.1 GCA003201715_01598 CDS open 18500-19051 _na     183_aa Lipoprotein
3184 QJJX01000017.1 GCA003201715_01599 CDS open 20416-20961 _na     181_aa Lipocalin-like protein
3185 QJJX01000017.1 GCA003201715_01600 CDS open 21184-22404 _na     406_aa pncB nicotinate phosphoribosyltransferase
3186 QJJX01000017.1 GCA003201715_01601 CDS open 22629-23315 _na     228_aa Phosphoglycolate phosphatase
3187 QJJX01000017.1 GCA003201715_01602 CDS open 23486-24241 _na     251_aa Succinate dehydrogenase/fumarate reductase iron-sulfur subunit
3188 QJJX01000017.1 GCA003201715_01603 CDS open 24303-26285 _na     660_aa sdhA Succinate dehydrogenase or fumarate reductase%2C flavoprotein subunit
3189 QJJX01000017.1 GCA003201715_01604 CDS open 26313-27002 _na     229_aa Succinate dehydrogenase cytochrome B subunit%2C b558 family
3190 QJJX01000017.1 GCA003201715_01605 CDS open 27801-31019 _na     1072_aa Tricorn protease-like protein
3191 QJJX01000017.1 GCA003201715_01606 CDS open 31291-32196 _na     301_aa yafY Putative DNA-binding transcriptional regulator YafY
3192 QJJX01000017.1 GCA003201715_01607 CDS open 33087-33206 _na     39_aa hypothetical protein
3193 QJJX01000017.1 GCA003201715_01608 CDS open 33486-33698 _na     70_aa hypothetical protein
3194 QJJX01000017.1 GCA003201715_01609 CDS open 34502-35380 _na     292_aa araC Transcriptional regulator%2C AraC family
3195 QJJX01000017.1 GCA003201715_01610 CDS open 35476-36531 _na     351_aa Alpha-L-rhamnosidase-like protein
3196 QJJX01000017.1 GCA003201715_01611 CDS open 37275-39248 _na     657_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
3197 QJJX01000017.1 GCA003201715_01612 CDS open 39659-39913 _na     84_aa rpsT 30S ribosomal protein S20
3198 QJJX01000017.1 GCA003201715_01614 CDS open 40170-40898 _na     242_aa recO DNA repair protein RecO
3199 QJJX01000017.1 GCA003201715_01615 CDS open 41198-42775 _na     525_aa Carboxyl-terminal processing protease
3200 QJJX01000017.1 GCA003201715_01616 CDS open 43009-45054 _na     681_aa DNA topoisomerase (ATP-hydrolyzing)
3201 QJJX01000017.1 GCA003201715_01617 CDS open 45103-46248 _na     381_aa N-acetyltransferase domain-containing protein
3202 QJJX01000017.1 GCA003201715_01618 CDS open 46713-48926 _na     737_aa rnr ribonuclease R
3203 QJJX01000017.1 GCA003201715_01619 CDS open 49098-49637 _na     179_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
3204 QJJX01000017.1 GCA003201715_01620 CDS open 50715-50942 _na     75_aa SusD-like starch-binding protein associating with outer membrane
3205 QJJX01000017.1 GCA003201715_01621 CDS open 51227-51556 _na     109_aa Carboxypeptidase-like protein
3206 QJJX01000017.1 GCA003201715_01622 CDS open 52328-52471 _na     47_aa hypothetical protein
3207 QJJX01000017.1 GCA003201715_01623 CDS open 52428-54782 _na     784_aa topA type I DNA topoisomerase
3208 QJJX01000017.1 GCA003201715_01624 CDS open 54828-55406 _na     192_aa shikimate kinase
3209 QJJX01000017.1 GCA003201715_01625 CDS open 55635-57527 _na     630_aa speA biosynthetic arginine decarboxylase
3210 QJJX01000017.1 GCA003201715_01626 CDS open 57484-57678 _na     64_aa hypothetical protein
3211 QJJX01000017.1 GCA003201715_01627 CDS open 57778-58377 _na     199_aa NUDIX domain-containing protein
3212 QJJX01000017.1 GCA003201715_01628 CDS open 58635-59462 _na     275_aa Acetyl esterase/lipase
3213 QJJX01000017.1 GCA003201715_01629 CDS open 59595-59741 _na     48_aa hypothetical protein
3214 QJJX01000017.1 GCA003201715_01630 CDS open 59920-60972 _na     350_aa Endonuclease/exonuclease/phosphatase family protein
3215 QJJX01000017.1 GCA003201715_01631 CDS open 61065-63098 _na     677_aa FAD dependent oxidoreductase
3216 QJJX01000017.1 GCA003201715_01632 CDS open 63436-65148 _na     570_aa susD SusD family protein
3217 QJJX01000017.1 GCA003201715_01633 CDS open 65163-68318 _na     1051_aa TonB-dependent receptor plug domain protein
3218 QJJX01000017.1 GCA003201715_01634 CDS open 68513-68830 _na     105_aa UPF0145 protein HMPREF1991_02321
3219 QJJX01000017.1 GCA003201715_01635 CDS open 69431-69862 _na     143_aa HSP20 family protein
3220 QJJX01000017.1 GCA003201715_01636 CDS open 71532-72119 _na     195_aa Outer membrane protein beta-barrel domain-containing protein
3221 QJJX01000017.1 GCA003201715_01637 CDS open 72638-73027 _na     129_aa DDE family transposase
3222 QJJX01000017.1 GCA003201715_01638 CDS open 73203-73292 _na     29_aa hypothetical protein
3223 QJJX01000017.1 GCA003201715_01639 CDS open 73460-73627 _na     55_aa hypothetical protein
3224 QJJX01000017.1 GCA003201715_01585 gene open 315-2936
3225 QJJX01000017.1 GCA003201715_01586 gene open 2941-3864
3226 QJJX01000017.1 GCA003201715_01587 gene open 3987-4793 ydiL
3227 QJJX01000017.1 GCA003201715_01588 gene open 5235-5843
3228 QJJX01000017.1 GCA003201715_01589 gene open 6005-6295
3229 QJJX01000017.1 GCA003201715_01590 gene open 6782-8092
3230 QJJX01000017.1 GCA003201715_01591 gene open 8178-9521 sufD
3231 QJJX01000017.1 GCA003201715_01592 gene open 9534-10289 sufC
3232 QJJX01000017.1 GCA003201715_01593 gene open 10309-11070
3233 QJJX01000017.1 GCA003201715_01594 gene open 11107-12558 sufB
3234 QJJX01000017.1 GCA003201715_01595 gene open 12926-15913 infB
3235 QJJX01000017.1 GCA003201715_01596 gene open 15985-17247 nusA
3236 QJJX01000017.1 GCA003201715_01597 gene open 17599-18063 rimP
3237 QJJX01000017.1 GCA003201715_01598 gene open 18500-19051
3238 QJJX01000017.1 GCA003201715_01599 gene open 20416-20961
3239 QJJX01000017.1 GCA003201715_01600 gene open 21184-22404 pncB
3240 QJJX01000017.1 GCA003201715_01601 gene open 22629-23315
3241 QJJX01000017.1 GCA003201715_01602 gene open 23486-24241
3242 QJJX01000017.1 GCA003201715_01603 gene open 24303-26285 sdhA
3243 QJJX01000017.1 GCA003201715_01604 gene open 26313-27002
3244 QJJX01000017.1 GCA003201715_01605 gene open 27801-31019
3245 QJJX01000017.1 GCA003201715_01606 gene open 31291-32196 yafY
3246 QJJX01000017.1 GCA003201715_01607 gene open 33087-33206
3247 QJJX01000017.1 GCA003201715_01608 gene open 33486-33698
3248 QJJX01000017.1 GCA003201715_01609 gene open 34502-35380 araC
3249 QJJX01000017.1 GCA003201715_01610 gene open 35476-36531
3250 QJJX01000017.1 GCA003201715_01611 gene open 37275-39248 gyrB
3251 QJJX01000017.1 GCA003201715_01612 gene open 39659-39913 rpsT
3252 QJJX01000017.1 GCA003201715_01614 gene open 40170-40898 recO
3253 QJJX01000017.1 GCA003201715_01615 gene open 41198-42775
3254 QJJX01000017.1 GCA003201715_01616 gene open 43009-45054
3255 QJJX01000017.1 GCA003201715_01617 gene open 45103-46248
3256 QJJX01000017.1 GCA003201715_01618 gene open 46713-48926 rnr
3257 QJJX01000017.1 GCA003201715_01619 gene open 49098-49637
3258 QJJX01000017.1 GCA003201715_01620 gene open 50715-50942
3259 QJJX01000017.1 GCA003201715_01621 gene open 51227-51556
3260 QJJX01000017.1 GCA003201715_01622 gene open 52328-52471
3261 QJJX01000017.1 GCA003201715_01623 gene open 52428-54782 topA
3262 QJJX01000017.1 GCA003201715_01624 gene open 54828-55406
3263 QJJX01000017.1 GCA003201715_01625 gene open 55635-57527 speA
3264 QJJX01000017.1 GCA003201715_01626 gene open 57484-57678
3265 QJJX01000017.1 GCA003201715_01627 gene open 57778-58377
3266 QJJX01000017.1 GCA003201715_01628 gene open 58635-59462
3267 QJJX01000017.1 GCA003201715_01629 gene open 59595-59741
3268 QJJX01000017.1 GCA003201715_01630 gene open 59920-60972
3269 QJJX01000017.1 GCA003201715_01631 gene open 61065-63098
3270 QJJX01000017.1 GCA003201715_01632 gene open 63436-65148 susD
3271 QJJX01000017.1 GCA003201715_01633 gene open 65163-68318
3272 QJJX01000017.1 GCA003201715_01634 gene open 68513-68830
3273 QJJX01000017.1 GCA003201715_01635 gene open 69431-69862
3274 QJJX01000017.1 GCA003201715_01636 gene open 71532-72119
3275 QJJX01000017.1 GCA003201715_01637 gene open 72638-73027
3276 QJJX01000017.1 GCA003201715_01638 gene open 73203-73292
3277 QJJX01000017.1 GCA003201715_01639 gene open 73460-73627
3278 QJJX01000017.1 GCA003201715_01584 gene open 63-136 trnI
3279 QJJX01000017.1 GCA003201715_01613 gene open 39937-40008 trnE
3280 QJJX01000017.1 GCA003201715_01584 tRNA open 63-136 trnI tRNA-Ile2(cat)
3281 QJJX01000017.1 GCA003201715_01613 tRNA open 39937-40008 trnE tRNA-Glu(ttc)
3282 QJJX01000018.1 GCA003201715_01640 gene open 134-246 rrf
3283 QJJX01000018.1 GCA003201715_01640 rRNA open 134-246 rrf 5S ribosomal RNA
3284 QJJX01000018.1 GCA003201715_01641 CDS open 963-1322 _na     119_aa Immunity protein 10
3285 QJJX01000018.1 GCA003201715_01642 CDS open 1502-2092 _na     196_aa Immunity protein 43 domain-containing protein
3286 QJJX01000018.1 GCA003201715_01643 CDS open 3200-4492 _na     430_aa Glucose-1-phosphatase
3287 QJJX01000018.1 GCA003201715_01644 CDS open 5252-5512 _na     86_aa Secreted protein
3288 QJJX01000018.1 GCA003201715_01645 CDS open 5800-6657 _na     285_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
3289 QJJX01000018.1 GCA003201715_01646 CDS open 6677-7669 _na     330_aa nadA quinolinate synthase NadA
3290 QJJX01000018.1 GCA003201715_01647 CDS open 7740-9329 _na     529_aa nadB L-aspartate oxidase
3291 QJJX01000018.1 GCA003201715_01648 CDS open 9853-10566 _na     237_aa ABC-2 type transport system ATP-binding protein
3292 QJJX01000018.1 GCA003201715_01649 CDS open 10566-12272 _na     568_aa ABC transporter permease
3293 QJJX01000018.1 GCA003201715_01650 CDS open 12517-13539 _na     340_aa branched-chain amino acid aminotransferase
3294 QJJX01000018.1 GCA003201715_01651 CDS open 13673-14443 _na     256_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
3295 QJJX01000018.1 GCA003201715_01652 CDS open 14985-15527 _na     180_aa rbr rubrerythrin
3296 QJJX01000018.1 GCA003201715_01653 CDS open 15842-17977 _na     711_aa S1 motif domain-containing protein
3297 QJJX01000018.1 GCA003201715_01654 CDS open 17982-18407 _na     141_aa DUF4251 domain-containing protein
3298 QJJX01000018.1 GCA003201715_01655 CDS open 18639-26312 _na     2557_aa sprA cell surface protein SprA
3299 QJJX01000018.1 GCA003201715_01656 CDS open 26358-26975 _na     205_aa ruvA Holliday junction branch migration protein RuvA
3300 QJJX01000018.1 GCA003201715_01657 CDS open 27405-28643 _na     412_aa RNA-directed DNA polymerase
3301 QJJX01000018.1 GCA003201715_01658 CDS open 29751-29945 _na     64_aa xseB exodeoxyribonuclease VII small subunit
3302 QJJX01000018.1 GCA003201715_01659 CDS open 30205-31587 _na     460_aa xseA exodeoxyribonuclease VII large subunit
3303 QJJX01000018.1 GCA003201715_01660 CDS open 31922-32821 _na     299_aa diaminopimelate dehydrogenase
3304 QJJX01000018.1 GCA003201715_01661 CDS open 33051-34064 _na     337_aa rhuM Virulence RhuM family protein
3305 QJJX01000018.1 GCA003201715_01662 CDS open 34468-36177 _na     569_aa Acyl-CoA dehydrogenase protein
3306 QJJX01000018.1 GCA003201715_01663 CDS open 36244-36609 _na     121_aa S23 ribosomal protein
3307 QJJX01000018.1 GCA003201715_01664 CDS open 36653-37723 _na     356_aa Electron transfer flavoprotein subunit alpha
3308 QJJX01000018.1 GCA003201715_01665 CDS open 37738-38607 _na     289_aa Electron transfer flavoprotein
3309 QJJX01000018.1 GCA003201715_01666 CDS open 38846-40726 _na     626_aa beta-N-acetylhexosaminidase
3310 QJJX01000018.1 GCA003201715_01667 CDS open 40965-41081 _na     38_aa hypothetical protein
3311 QJJX01000018.1 GCA003201715_01668 CDS open 41233-41856 _na     207_aa Peptidyl-prolyl cis-trans isomerase
3312 QJJX01000018.1 GCA003201715_01669 CDS open 41859-43400 _na     513_aa glycine--tRNA ligase
3313 QJJX01000018.1 GCA003201715_01670 CDS open 43678-44268 _na     196_aa Opacity protein-like surface antigen
3314 QJJX01000018.1 GCA003201715_01671 CDS open 44785-44907 _na     40_aa hypothetical protein
3315 QJJX01000018.1 GCA003201715_01672 CDS open 45112-47853 _na     913_aa DNA gyrase/topoisomerase IV subunit A
3316 QJJX01000018.1 GCA003201715_01673 CDS open 47843-48757 _na     304_aa DUF3316 domain-containing protein
3317 QJJX01000018.1 GCA003201715_01674 CDS open 48754-49773 _na     339_aa Tricorn protease-like protein
3318 QJJX01000018.1 GCA003201715_01675 CDS open 49929-50060 _na     43_aa hypothetical protein
3319 QJJX01000018.1 GCA003201715_01676 CDS open 50157-50360 _na     67_aa hypothetical protein
3320 QJJX01000018.1 GCA003201715_01677 CDS open 50329-50511 _na     60_aa Secreted protein
3321 QJJX01000018.1 GCA003201715_01678 CDS open 50592-51245 _na     217_aa Outer membrane protein with beta-barrel domain
3322 QJJX01000018.1 GCA003201715_01679 CDS open 51951-52676 _na     241_aa MIP family channel protein
3323 QJJX01000018.1 GCA003201715_01680 CDS open 53000-53515 _na     171_aa Lipocalin-like protein
3324 QJJX01000018.1 GCA003201715_01682 CDS open 54209-55375 _na     388_aa histidine kinase
3325 QJJX01000018.1 GCA003201715_01683 CDS open 57165-57869 _na     234_aa Lipoprotein
3326 QJJX01000018.1 GCA003201715_01684 CDS open 57937-59424 _na     495_aa Multidrug-efflux transporter
3327 QJJX01000018.1 GCA003201715_01685 CDS open 61143-61868 _na     241_aa Outer membrane protein beta-barrel domain-containing protein
3328 QJJX01000018.1 GCA003201715_01686 CDS open 61981-63063 _na     360_aa Outer membrane protein with beta-barrel domain
3329 QJJX01000018.1 GCA003201715_01687 CDS open 63060-64883 _na     607_aa Secretion system C-terminal sorting domain-containing protein
3330 QJJX01000018.1 GCA003201715_01688 CDS open 65824-66609 _na     261_aa hypothetical protein
3331 QJJX01000018.1 GCA003201715_01689 CDS open 69820-70773 _na     317_aa hypothetical protein
3332 QJJX01000018.1 GCA003201715_01641 gene open 963-1322
3333 QJJX01000018.1 GCA003201715_01642 gene open 1502-2092
3334 QJJX01000018.1 GCA003201715_01643 gene open 3200-4492
3335 QJJX01000018.1 GCA003201715_01644 gene open 5252-5512
3336 QJJX01000018.1 GCA003201715_01645 gene open 5800-6657 nadC
3337 QJJX01000018.1 GCA003201715_01646 gene open 6677-7669 nadA
3338 QJJX01000018.1 GCA003201715_01647 gene open 7740-9329 nadB
3339 QJJX01000018.1 GCA003201715_01648 gene open 9853-10566
3340 QJJX01000018.1 GCA003201715_01649 gene open 10566-12272
3341 QJJX01000018.1 GCA003201715_01650 gene open 12517-13539
3342 QJJX01000018.1 GCA003201715_01651 gene open 13673-14443 trmB
3343 QJJX01000018.1 GCA003201715_01652 gene open 14985-15527 rbr
3344 QJJX01000018.1 GCA003201715_01653 gene open 15842-17977
3345 QJJX01000018.1 GCA003201715_01654 gene open 17982-18407
3346 QJJX01000018.1 GCA003201715_01655 gene open 18639-26312 sprA
3347 QJJX01000018.1 GCA003201715_01656 gene open 26358-26975 ruvA
3348 QJJX01000018.1 GCA003201715_01657 gene open 27405-28643
3349 QJJX01000018.1 GCA003201715_01658 gene open 29751-29945 xseB
3350 QJJX01000018.1 GCA003201715_01659 gene open 30205-31587 xseA
3351 QJJX01000018.1 GCA003201715_01660 gene open 31922-32821
3352 QJJX01000018.1 GCA003201715_01661 gene open 33051-34064 rhuM
3353 QJJX01000018.1 GCA003201715_01662 gene open 34468-36177
3354 QJJX01000018.1 GCA003201715_01663 gene open 36244-36609
3355 QJJX01000018.1 GCA003201715_01664 gene open 36653-37723
3356 QJJX01000018.1 GCA003201715_01665 gene open 37738-38607
3357 QJJX01000018.1 GCA003201715_01666 gene open 38846-40726
3358 QJJX01000018.1 GCA003201715_01667 gene open 40965-41081
3359 QJJX01000018.1 GCA003201715_01668 gene open 41233-41856
3360 QJJX01000018.1 GCA003201715_01669 gene open 41859-43400
3361 QJJX01000018.1 GCA003201715_01670 gene open 43678-44268
3362 QJJX01000018.1 GCA003201715_01671 gene open 44785-44907
3363 QJJX01000018.1 GCA003201715_01672 gene open 45112-47853
3364 QJJX01000018.1 GCA003201715_01673 gene open 47843-48757
3365 QJJX01000018.1 GCA003201715_01674 gene open 48754-49773
3366 QJJX01000018.1 GCA003201715_01675 gene open 49929-50060
3367 QJJX01000018.1 GCA003201715_01676 gene open 50157-50360
3368 QJJX01000018.1 GCA003201715_01677 gene open 50329-50511
3369 QJJX01000018.1 GCA003201715_01678 gene open 50592-51245
3370 QJJX01000018.1 GCA003201715_01679 gene open 51951-52676
3371 QJJX01000018.1 GCA003201715_01680 gene open 53000-53515
3372 QJJX01000018.1 GCA003201715_01682 gene open 54209-55375
3373 QJJX01000018.1 GCA003201715_01683 gene open 57165-57869
3374 QJJX01000018.1 GCA003201715_01684 gene open 57937-59424
3375 QJJX01000018.1 GCA003201715_01685 gene open 61143-61868
3376 QJJX01000018.1 GCA003201715_01686 gene open 61981-63063
3377 QJJX01000018.1 GCA003201715_01687 gene open 63060-64883
3378 QJJX01000018.1 GCA003201715_01688 gene open 65824-66609
3379 QJJX01000018.1 GCA003201715_01689 gene open 69820-70773
3380 QJJX01000018.1 GCA003201715_01681 gene open 53892-53973 trnL
3381 QJJX01000018.1 GCA003201715_01681 tRNA open 53892-53973 trnL tRNA-Leu(tag)
3382 QJJX01000019.1 GCA003201715_01690 CDS open 293-1597 _na     434_aa Ricin-type beta-trefoil lectin protein
3383 QJJX01000019.1 GCA003201715_01691 CDS open 1692-4892 _na     1066_aa Enhancin-like peptidase M60 family
3384 QJJX01000019.1 GCA003201715_01692 CDS open 5143-8943 _na     1266_aa Alpha-glucosidase (Family GH31 glycosyl hydrolase)
3385 QJJX01000019.1 GCA003201715_01693 CDS open 9622-13650 _na     1342_aa beta-galactosidase
3386 QJJX01000019.1 GCA003201715_01694 CDS open 14189-15502 _na     437_aa Thioredoxin domain-containing protein
3387 QJJX01000019.1 GCA003201715_01695 CDS open 15561-15791 _na     76_aa hypothetical protein
3388 QJJX01000019.1 GCA003201715_01696 CDS open 16752-16943 _na     63_aa hypothetical protein
3389 QJJX01000019.1 GCA003201715_01697 CDS open 17144-18064 _na     306_aa Phage tail component protein
3390 QJJX01000019.1 GCA003201715_01698 CDS open 18212-19852 _na     546_aa diphosphate--fructose-6-phosphate 1-phosphotransferase
3391 QJJX01000019.1 GCA003201715_01699 CDS open 19955-20140 _na     61_aa hypothetical protein
3392 QJJX01000019.1 GCA003201715_01700 CDS open 20175-20444 _na     89_aa rteC RteC protein
3393 QJJX01000019.1 GCA003201715_01701 CDS open 20626-21180 _na     184_aa Acyltransferase-like protein
3394 QJJX01000019.1 GCA003201715_01702 CDS open 21189-23819 _na     876_aa Fibronectin type-III domain-containing protein
3395 QJJX01000019.1 GCA003201715_01703 CDS open 23832-24149 _na     105_aa hypothetical protein
3396 QJJX01000019.1 GCA003201715_01704 CDS open 24246-26258 _na     670_aa ygiQ YgiQ family radical SAM protein
3397 QJJX01000019.1 GCA003201715_01705 CDS open 26333-27103 _na     256_aa UPF0246 protein EJ73_01698
3398 QJJX01000019.1 GCA003201715_01706 CDS open 27242-28285 _na     347_aa TIGR00374 family protein
3399 QJJX01000019.1 GCA003201715_01707 CDS open 28341-29798 _na     485_aa Dipeptidase D
3400 QJJX01000019.1 GCA003201715_01708 CDS open 29806-30447 _na     213_aa Pyruvate formate lyase activating enzyme
3401 QJJX01000019.1 GCA003201715_01710 CDS open 30853-30993 _na     46_aa hypothetical protein
3402 QJJX01000019.1 GCA003201715_01711 CDS open 32019-34598 _na     859_aa Carboxypeptidase-like protein
3403 QJJX01000019.1 GCA003201715_01712 CDS open 34773-35516 _na     247_aa Putative hydrolase of the HAD superfamily
3404 QJJX01000019.1 GCA003201715_01713 CDS open 35533-36474 _na     313_aa Phosphatidylglycerophosphate synthase
3405 QJJX01000019.1 GCA003201715_01714 CDS open 36467-37291 _na     274_aa Glutathione synthase/RimK-type ligase-like ATP-grasp enzyme
3406 QJJX01000019.1 GCA003201715_01715 CDS open 37266-38006 _na     246_aa MobA-like NTP transferase protein
3407 QJJX01000019.1 GCA003201715_01716 CDS open 38205-38447 _na     80_aa hypothetical protein
3408 QJJX01000019.1 GCA003201715_01717 CDS open 38539-40110 _na     523_aa FAD binding domain-containing protein
3409 QJJX01000019.1 GCA003201715_01718 CDS open 40298-41197 _na     299_aa F0F1 ATP synthase subunit gamma
3410 QJJX01000019.1 GCA003201715_01719 CDS open 41348-42928 _na     526_aa atpA F0F1 ATP synthase subunit alpha
3411 QJJX01000019.1 GCA003201715_01720 CDS open 42930-43469 _na     179_aa F0F1 ATP synthase subunit delta
3412 QJJX01000019.1 GCA003201715_01721 CDS open 43477-43992 _na     171_aa atpF F0F1 ATP synthase subunit B
3413 QJJX01000019.1 GCA003201715_01722 CDS open 44002-44244 _na     80_aa atpE ATP synthase F0 subunit C
3414 QJJX01000019.1 GCA003201715_01723 CDS open 44430-45485 _na     351_aa atpB F0F1 ATP synthase subunit A
3415 QJJX01000019.1 GCA003201715_01724 CDS open 45519-45929 _na     136_aa ATP synthase I subunit
3416 QJJX01000019.1 GCA003201715_01725 CDS open 45937-46179 _na     80_aa atpC ATP synthase F1 subunit epsilon
3417 QJJX01000019.1 GCA003201715_01726 CDS open 46201-47730 _na     509_aa atpD F0F1 ATP synthase subunit beta
3418 QJJX01000019.1 GCA003201715_01727 CDS open 47859-48836 _na     325_aa pfkA 6-phosphofructokinase
3419 QJJX01000019.1 GCA003201715_01728 CDS open 48850-49029 _na     59_aa hypothetical protein
3420 QJJX01000019.1 GCA003201715_01729 CDS open 49163-50551 _na     462_aa Na+/H+ antiporter NhaD/arsenite permease-like protein
3421 QJJX01000019.1 GCA003201715_01730 CDS open 52197-53861 _na     554_aa Long-chain acyl-CoA synthetase
3422 QJJX01000019.1 GCA003201715_01731 CDS open 53958-55622 _na     554_aa AMP-binding enzyme
3423 QJJX01000019.1 GCA003201715_01732 CDS open 55971-57533 _na     520_aa WG repeat protein
3424 QJJX01000019.1 GCA003201715_01733 CDS open 57709-58659 _na     316_aa PorV/PorQ family protein
3425 QJJX01000019.1 GCA003201715_01734 CDS open 58671-61427 _na     918_aa Putative secreted protein (Por secretion system target)
3426 QJJX01000019.1 GCA003201715_01735 CDS open 61445-63049 _na     534_aa All-beta putative protein
3427 QJJX01000019.1 GCA003201715_01736 CDS open 63084-64703 _na     539_aa All-beta putative protein
3428 QJJX01000019.1 GCA003201715_01737 CDS open 65974-66117 _na     47_aa hypothetical protein
3429 QJJX01000019.1 GCA003201715_01738 CDS open 66242-66418 _na     58_aa hypothetical protein
3430 QJJX01000019.1 GCA003201715_01739 CDS open 66539-68473 _na     644_aa TonB-dependent SusC/RagA subfamily outer membrane receptor
3431 QJJX01000019.1 GCA003201715_01690 gene open 293-1597
3432 QJJX01000019.1 GCA003201715_01691 gene open 1692-4892
3433 QJJX01000019.1 GCA003201715_01692 gene open 5143-8943
3434 QJJX01000019.1 GCA003201715_01693 gene open 9622-13650
3435 QJJX01000019.1 GCA003201715_01694 gene open 14189-15502
3436 QJJX01000019.1 GCA003201715_01695 gene open 15561-15791
3437 QJJX01000019.1 GCA003201715_01696 gene open 16752-16943
3438 QJJX01000019.1 GCA003201715_01697 gene open 17144-18064
3439 QJJX01000019.1 GCA003201715_01698 gene open 18212-19852
3440 QJJX01000019.1 GCA003201715_01699 gene open 19955-20140
3441 QJJX01000019.1 GCA003201715_01700 gene open 20175-20444 rteC
3442 QJJX01000019.1 GCA003201715_01701 gene open 20626-21180
3443 QJJX01000019.1 GCA003201715_01702 gene open 21189-23819
3444 QJJX01000019.1 GCA003201715_01703 gene open 23832-24149
3445 QJJX01000019.1 GCA003201715_01704 gene open 24246-26258 ygiQ
3446 QJJX01000019.1 GCA003201715_01705 gene open 26333-27103
3447 QJJX01000019.1 GCA003201715_01706 gene open 27242-28285
3448 QJJX01000019.1 GCA003201715_01707 gene open 28341-29798
3449 QJJX01000019.1 GCA003201715_01708 gene open 29806-30447
3450 QJJX01000019.1 GCA003201715_01710 gene open 30853-30993
3451 QJJX01000019.1 GCA003201715_01711 gene open 32019-34598
3452 QJJX01000019.1 GCA003201715_01712 gene open 34773-35516
3453 QJJX01000019.1 GCA003201715_01713 gene open 35533-36474
3454 QJJX01000019.1 GCA003201715_01714 gene open 36467-37291
3455 QJJX01000019.1 GCA003201715_01715 gene open 37266-38006
3456 QJJX01000019.1 GCA003201715_01716 gene open 38205-38447
3457 QJJX01000019.1 GCA003201715_01717 gene open 38539-40110
3458 QJJX01000019.1 GCA003201715_01718 gene open 40298-41197
3459 QJJX01000019.1 GCA003201715_01719 gene open 41348-42928 atpA
3460 QJJX01000019.1 GCA003201715_01720 gene open 42930-43469
3461 QJJX01000019.1 GCA003201715_01721 gene open 43477-43992 atpF
3462 QJJX01000019.1 GCA003201715_01722 gene open 44002-44244 atpE
3463 QJJX01000019.1 GCA003201715_01723 gene open 44430-45485 atpB
3464 QJJX01000019.1 GCA003201715_01724 gene open 45519-45929
3465 QJJX01000019.1 GCA003201715_01725 gene open 45937-46179 atpC
3466 QJJX01000019.1 GCA003201715_01726 gene open 46201-47730 atpD
3467 QJJX01000019.1 GCA003201715_01727 gene open 47859-48836 pfkA
3468 QJJX01000019.1 GCA003201715_01728 gene open 48850-49029
3469 QJJX01000019.1 GCA003201715_01729 gene open 49163-50551
3470 QJJX01000019.1 GCA003201715_01730 gene open 52197-53861
3471 QJJX01000019.1 GCA003201715_01731 gene open 53958-55622
3472 QJJX01000019.1 GCA003201715_01732 gene open 55971-57533
3473 QJJX01000019.1 GCA003201715_01733 gene open 57709-58659
3474 QJJX01000019.1 GCA003201715_01734 gene open 58671-61427
3475 QJJX01000019.1 GCA003201715_01735 gene open 61445-63049
3476 QJJX01000019.1 GCA003201715_01736 gene open 63084-64703
3477 QJJX01000019.1 GCA003201715_01737 gene open 65974-66117
3478 QJJX01000019.1 GCA003201715_01738 gene open 66242-66418
3479 QJJX01000019.1 GCA003201715_01739 gene open 66539-68473
3480 QJJX01000019.1 GCA003201715_01709 gene open 30629-30699 trnQ
3481 QJJX01000019.1 GCA003201715_01709 tRNA open 30629-30699 trnQ tRNA-Gln(ctg)
3482 QJJX01000020.1 repeat_region open 3303-4739 CRISPR array with 20 repeats of length 37%2C consensus sequence GTCTTAATCCTTGTTTTAATGGAAGATGCACTAGTAC and spacer length 36
3483 QJJX01000020.1 GCA003201715_01740 CDS open 351-1331 _na     326_aa cas1 CRISPR-associated endonuclease Cas1
3484 QJJX01000020.1 GCA003201715_01741 CDS open 1328-2347 _na     339_aa CRISPR-associated primase-polymerase type B
3485 QJJX01000020.1 GCA003201715_01742 CDS open 2357-2836 _na     159_aa cas2 CRISPR-associated endonuclease Cas2
3486 QJJX01000020.1 GCA003201715_01743 CDS open 4810-5052 _na     80_aa hypothetical protein
3487 QJJX01000020.1 GCA003201715_01744 CDS open 5986-9726 _na     1246_aa N-acetylmuramoyl-L-alanine amidase
3488 QJJX01000020.1 GCA003201715_01745 CDS open 9723-10643 _na     306_aa WD40 repeat protein
3489 QJJX01000020.1 GCA003201715_01746 CDS open 11576-12058 _na     160_aa Carboxypeptidase-like protein
3490 QJJX01000020.1 GCA003201715_01747 CDS open 12190-14520 _na     776_aa beta-N-acetylhexosaminidase
3491 QJJX01000020.1 GCA003201715_01748 CDS open 14813-15613 _na     266_aa trmH RNA methyltransferase%2C TrmH family
3492 QJJX01000020.1 GCA003201715_01749 CDS open 15805-16311 _na     168_aa DUF6155 domain-containing protein
3493 QJJX01000020.1 GCA003201715_01750 CDS open 16405-16950 _na     181_aa yfcE phosphodiesterase
3494 QJJX01000020.1 GCA003201715_01751 CDS open 18017-18811 _na     264_aa Polysaccharide biosynthesis/export protein
3495 QJJX01000020.1 GCA003201715_01752 CDS open 18894-20789 _na     631_aa Class II glutamine amidotransferase
3496 QJJX01000020.1 GCA003201715_01753 CDS open 20796-21875 _na     359_aa carbamoyl phosphate synthase small subunit
3497 QJJX01000020.1 GCA003201715_01754 CDS open 21891-25121 _na     1076_aa carB carbamoyl-phosphate synthase large subunit
3498 QJJX01000020.1 GCA003201715_01755 CDS open 26468-28114 _na     548_aa Hemin receptor
3499 QJJX01000020.1 GCA003201715_01756 CDS open 28160-29161 _na     333_aa Heterogeneous nuclear ribonucleoprotein A2
3500 QJJX01000020.1 GCA003201715_01757 CDS open 29373-30242 _na     289_aa prmA 50S ribosomal protein L11 methyltransferase