HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Saccharimonas sp. HMT-346 (GCA_007845545.1)

Select a Genome:
BAKTA Annotations for GCA_007845545.1
Genome Selected: Saccharimonas sp. HMT-346
ContigsBases CDSrRNA tmRNAtRNA
22 978051 956 3 0 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2020 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 2020 [5 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 SDRZ01000006.1 GCA007845545_00885 gene open 60949-61293
1502 SDRZ01000006.1 GCA007845545_00886 gene open 61316-62152
1503 SDRZ01000006.1 GCA007845545_00887 gene open 62220-62693
1504 SDRZ01000006.1 GCA007845545_00888 gene open 62686-62823 ccmD
1505 SDRZ01000006.1 GCA007845545_00889 gene open 62922-63263
1506 SDRZ01000006.1 GCA007845545_00890 gene open 63406-63642
1507 SDRZ01000006.1 GCA007845545_00891 gene open 63791-64165
1508 SDRZ01000006.1 GCA007845545_00892 gene open 64305-65255
1509 SDRZ01000006.1 GCA007845545_00893 gene open 65363-67879 pheT
1510 SDRZ01000006.1 GCA007845545_00894 gene open 67881-69296
1511 SDRZ01000006.1 GCA007845545_00895 gene open 69342-69431
1512 SDRZ01000006.1 GCA007845545_00820 gene open 4681-4754 trnC
1513 SDRZ01000006.1 GCA007845545_00821 gene open 4766-4850 trnL
1514 SDRZ01000006.1 GCA007845545_00828 gene open 11637-11713 trnA
1515 SDRZ01000006.1 GCA007845545_00829 gene open 11715-11791 trnV
1516 SDRZ01000006.1 GCA007845545_00830 gene open 11852-11927 trnA
1517 SDRZ01000006.1 GCA007845545_00840 gene open 22269-22343 trnG
1518 SDRZ01000006.1 GCA007845545_00845 gene open 26828-26903 trnG
1519 SDRZ01000006.1 GCA007845545_00858 gene open 39871-39946 trnF
1520 SDRZ01000006.1 GCA007845545_00873 gene open 52032-52106 trnQ
1521 SDRZ01000006.1 GCA007845545_00820 tRNA open 4681-4754 trnC tRNA-Cys(gca)
1522 SDRZ01000006.1 GCA007845545_00821 tRNA open 4766-4850 trnL tRNA-Leu(taa)
1523 SDRZ01000006.1 GCA007845545_00828 tRNA open 11637-11713 trnA tRNA-Ala(ggc)
1524 SDRZ01000006.1 GCA007845545_00829 tRNA open 11715-11791 trnV tRNA-Val(cac)
1525 SDRZ01000006.1 GCA007845545_00830 tRNA open 11852-11927 trnA tRNA-Ala(cgc)
1526 SDRZ01000006.1 GCA007845545_00840 tRNA open 22269-22343 trnG tRNA-Gly(ccc)
1527 SDRZ01000006.1 GCA007845545_00845 tRNA open 26828-26903 trnG tRNA-Gly(gcc)
1528 SDRZ01000006.1 GCA007845545_00858 tRNA open 39871-39946 trnF tRNA-Phe(gaa)
1529 SDRZ01000006.1 GCA007845545_00873 tRNA open 52032-52106 trnQ tRNA-Gln(ctg)
1530 SDRZ01000007.1 GCA007845545_00896 CDS open 1368-2627 _na     419_aa Polysaccharide biosynthesis protein
1531 SDRZ01000007.1 GCA007845545_00897 CDS open 2620-3477 _na     285_aa rfbD dTDP-4-dehydrorhamnose reductase
1532 SDRZ01000007.1 GCA007845545_00898 CDS open 3486-4469 _na     327_aa rfaJ Glycosyltransferase family 8 protein
1533 SDRZ01000007.1 GCA007845545_00899 CDS open 4486-5301 _na     271_aa wcaA Glycosyl transferase
1534 SDRZ01000007.1 GCA007845545_00900 CDS open 5291-5644 _na     117_aa DUF2304 domain-containing protein
1535 SDRZ01000007.1 GCA007845545_00901 CDS open 5641-6345 _na     234_aa wcaA Glycosyltransferase 2-like domain-containing protein
1536 SDRZ01000007.1 GCA007845545_00902 CDS open 6352-7206 _na     284_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
1537 SDRZ01000007.1 GCA007845545_00903 CDS open 7297-7506 _na     69_aa hypothetical protein
1538 SDRZ01000007.1 GCA007845545_00904 CDS open 7529-8263 _na     244_aa hypothetical protein
1539 SDRZ01000007.1 GCA007845545_00905 CDS open 8291-8578 _na     95_aa ydcF YdcF family protein
1540 SDRZ01000007.1 GCA007845545_00906 CDS open 8603-9445 _na     280_aa dTDP-4-dehydrorhamnose reductase
1541 SDRZ01000007.1 GCA007845545_00907 CDS open 9445-10014 _na     189_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
1542 SDRZ01000007.1 GCA007845545_00908 CDS open 10011-10559 _na     182_aa NUDIX hydrolase
1543 SDRZ01000007.1 GCA007845545_00909 CDS open 10562-11575 _na     337_aa rfbB dTDP-glucose 4%2C6-dehydratase
1544 SDRZ01000007.1 GCA007845545_00910 CDS open 11621-12052 _na     143_aa Phosphopantetheine adenylyltransferase
1545 SDRZ01000007.1 GCA007845545_00911 CDS open 12116-13132 _na     338_aa galE UDP-glucose 4-epimerase GalE
1546 SDRZ01000007.1 GCA007845545_00912 CDS open 13169-13699 _na     176_aa hypothetical protein
1547 SDRZ01000007.1 GCA007845545_00913 CDS open 13757-14278 _na     173_aa CHAP domain-containing protein
1548 SDRZ01000007.1 GCA007845545_00914 CDS open 14451-15569 _na     372_aa Glycosyltransferase family 4 protein
1549 SDRZ01000007.1 GCA007845545_00915 CDS open 15569-17005 _na     478_aa Sugar transferase
1550 SDRZ01000007.1 GCA007845545_00916 CDS open 17044-18378 _na     444_aa O-antigen ligase-related domain-containing protein
1551 SDRZ01000007.1 GCA007845545_00917 CDS open 18386-18811 _na     141_aa lexA LexA repressor DNA-binding domain-containing protein
1552 SDRZ01000007.1 GCA007845545_00918 CDS open 18792-20636 _na     614_aa Beta-lactamase class A catalytic domain-containing protein
1553 SDRZ01000007.1 GCA007845545_00920 CDS open 22337-23449 _na     370_aa Replication-associated protein G2P N-terminal domain-containing protein
1554 SDRZ01000007.1 GCA007845545_00921 CDS open 23415-23714 _na     99_aa SpoVG family protein
1555 SDRZ01000007.1 GCA007845545_00922 CDS open 23804-23980 _na     58_aa hypothetical protein
1556 SDRZ01000007.1 GCA007845545_00923 CDS open 24139-25083 _na     314_aa hypothetical protein
1557 SDRZ01000007.1 GCA007845545_00924 CDS open 25134-25319 _na     61_aa Helix-turn-helix domain-containing protein
1558 SDRZ01000007.1 GCA007845545_00925 CDS open 25350-27086 _na     578_aa Site-specific DNA-methyltransferase
1559 SDRZ01000007.1 GCA007845545_00926 CDS open 27067-29904 _na     945_aa Type III deoxyribonuclease
1560 SDRZ01000007.1 GCA007845545_00927 CDS open 30290-30655 _na     121_aa DUF3644 domain-containing protein
1561 SDRZ01000007.1 GCA007845545_00928 CDS open 30870-32450 _na     526_aa LPXTG cell wall anchor domain-containing protein
1562 SDRZ01000007.1 GCA007845545_00929 CDS open 32527-33543 _na     338_aa Class F sortase
1563 SDRZ01000007.1 GCA007845545_00930 CDS open 33727-35862 _na     711_aa nrdD ribonucleoside triphosphate reductase
1564 SDRZ01000007.1 GCA007845545_00931 CDS open 35810-36553 _na     247_aa pflA anaerobic ribonucleoside-triphosphate reductase activating protein
1565 SDRZ01000007.1 GCA007845545_00932 CDS open 36538-37200 _na     220_aa fpr FAD-binding FR-type domain-containing protein
1566 SDRZ01000007.1 GCA007845545_00933 CDS open 37197-39731 _na     844_aa hypothetical protein
1567 SDRZ01000007.1 GCA007845545_00934 CDS open 39857-40330 _na     157_aa DUF4333 domain-containing protein
1568 SDRZ01000007.1 GCA007845545_00935 CDS open 40323-42473 _na     716_aa VWA domain-containing protein
1569 SDRZ01000007.1 GCA007845545_00936 CDS open 42522-43166 _na     214_aa radC DNA repair protein RadC
1570 SDRZ01000007.1 GCA007845545_00937 CDS open 43358-43645 _na     95_aa arsR ArsR family transcriptional regulator
1571 SDRZ01000007.1 GCA007845545_00938 CDS open 44040-45239 _na     399_aa hsdM site-specific DNA-methyltransferase (adenine-specific)
1572 SDRZ01000007.1 GCA007845545_00939 CDS open 45239-45547 _na     102_aa Cell filamentation protein Fic
1573 SDRZ01000007.1 GCA007845545_00940 CDS open 45550-46251 _na     233_aa hypothetical protein
1574 SDRZ01000007.1 GCA007845545_00941 CDS open 46248-47366 _na     372_aa Restriction endonuclease subunit S
1575 SDRZ01000007.1 GCA007845545_00942 CDS open 47363-48448 _na     361_aa DUF4263 domain-containing protein
1576 SDRZ01000007.1 GCA007845545_00943 CDS open 48504-49220 _na     238_aa DUF4424 domain-containing protein
1577 SDRZ01000007.1 GCA007845545_00944 CDS open 49314-50147 _na     277_aa Peptidase S24/S26A/S26B/S26C domain-containing protein
1578 SDRZ01000007.1 GCA007845545_00945 CDS open 50217-53348 _na     1043_aa Type I restriction enzyme endonuclease subunit
1579 SDRZ01000007.1 GCA007845545_00946 CDS open 53290-53988 _na     232_aa hypothetical protein
1580 SDRZ01000007.1 GCA007845545_00947 CDS open 54054-54680 _na     208_aa hypothetical protein
1581 SDRZ01000007.1 GCA007845545_00948 CDS open 54682-54912 _na     76_aa DUF167 domain-containing protein
1582 SDRZ01000007.1 GCA007845545_00949 CDS open 54950-56503 _na     517_aa NodB-like y domain-containing protein
1583 SDRZ01000007.1 GCA007845545_00950 CDS open 56803-57717 _na     304_aa corA Magnesium transporter CorA family protein
1584 SDRZ01000007.1 GCA007845545_00951 CDS open 57762-58406 _na     214_aa CHAP domain-containing protein
1585 SDRZ01000007.1 GCA007845545_00952 CDS open 58527-59087 _na     186_aa NUDIX hydrolase
1586 SDRZ01000007.1 GCA007845545_00953 CDS open 59170-59934 _na     254_aa rbbA ABC transporter ATP-binding protein
1587 SDRZ01000007.1 GCA007845545_00954 CDS open 59936-61054 _na     372_aa yadH Transport permease protein
1588 SDRZ01000007.1 GCA007845545_00955 CDS open 61193-61411 _na     72_aa hypothetical protein
1589 SDRZ01000007.1 GCA007845545_00956 CDS open 61657-62055 _na     132_aa Nucleotide pyrophosphohydrolase
1590 SDRZ01000007.1 GCA007845545_00957 CDS open 62052-62666 _na     204_aa Thioredoxin domain-containing protein
1591 SDRZ01000007.1 GCA007845545_00958 CDS open 62663-63547 _na     294_aa vanZ VanZ family protein
1592 SDRZ01000007.1 GCA007845545_00959 CDS open 63547-64263 _na     238_aa Thioredoxin-like fold domain-containing protein
1593 SDRZ01000007.1 GCA007845545_00960 CDS open 64260-64862 _na     200_aa Sulphur transport domain-containing protein
1594 SDRZ01000007.1 GCA007845545_00961 CDS open 64953-65720 _na     255_aa Restriction endonuclease
1595 SDRZ01000007.1 GCA007845545_00962 CDS open 65844-66386 _na     180_aa padR PadR family transcriptional regulator
1596 SDRZ01000007.1 GCA007845545_00963 CDS open 66367-67092 _na     241_aa ABC transporter ATP-binding protein
1597 SDRZ01000007.1 GCA007845545_00964 CDS open 67089-69314 _na     741_aa ABC transporter permease
1598 SDRZ01000007.1 GCA007845545_00965 CDS open 69458-70225 _na     255_aa Basic amino acid ABC transporter substrate-binding protein
1599 SDRZ01000007.1 GCA007845545_00966 CDS open 70222-70944 _na     240_aa Amino acid ABC transporter permease
1600 SDRZ01000007.1 GCA007845545_00967 CDS open 70928-71650 _na     240_aa Amino acid ABC transporter ATP-binding protein
1601 SDRZ01000007.1 GCA007845545_00968 CDS open 71687-72445 _na     252_aa hypothetical protein
1602 SDRZ01000007.1 GCA007845545_00969 CDS open 72503-72943 _na     146_aa Peptidase C39 domain-containing protein
1603 SDRZ01000007.1 GCA007845545_00970 CDS open 73005-73829 _na     274_aa GerMN domain-containing protein
1604 SDRZ01000007.1 GCA007845545_00971 CDS open 73823-74932 _na     369_aa DUF2974 domain-containing protein
1605 SDRZ01000007.1 GCA007845545_00972 CDS open 75033-77405 _na     790_aa Multifunctional fusion protein
1606 SDRZ01000007.1 GCA007845545_00973 CDS open 77433-78914 _na     493_aa Amino acid permease
1607 SDRZ01000007.1 GCA007845545_00974 CDS open 78978-79751 _na     257_aa N(G)%2CN(G)-dimethylarginine dimethylaminohydrolase
1608 SDRZ01000007.1 GCA007845545_00975 CDS open 79756-80700 _na     314_aa arcC carbamate kinase
1609 SDRZ01000007.1 GCA007845545_00976 CDS open 80859-81125 _na     88_aa Co-chaperonin GroES
1610 SDRZ01000007.1 GCA007845545_00977 CDS open 81135-82775 _na     546_aa 60 kDa chaperonin
1611 SDRZ01000007.1 GCA007845545_00978 CDS open 82974-84698 _na     574_aa mdlB ABC transporter ATP-binding protein
1612 SDRZ01000007.1 GCA007845545_00979 CDS open 84698-86695 _na     665_aa mdlB Multidrug ABC transporter ATP-binding protein
1613 SDRZ01000007.1 GCA007845545_00980 CDS open 86750-87577 _na     275_aa Carbon-nitrogen hydrolase family protein
1614 SDRZ01000007.1 GCA007845545_00981 CDS open 87593-88054 _na     153_aa YbhB/YbcL family Raf kinase inhibitor-like protein
1615 SDRZ01000007.1 GCA007845545_00982 CDS open 88375-89826 _na     483_aa Protein kinase domain-containing protein
1616 SDRZ01000007.1 GCA007845545_00983 CDS open 89823-90011 _na     62_aa hypothetical protein
1617 SDRZ01000007.1 GCA007845545_00984 CDS open 90262-90801 _na     179_aa Uracil-DNA glycosylase-like domain-containing protein
1618 SDRZ01000007.1 GCA007845545_00985 CDS open 90841-91461 _na     206_aa Class I SAM-dependent methyltransferase
1619 SDRZ01000007.1 GCA007845545_00986 CDS open 91548-92846 _na     432_aa ABC transporter permease
1620 SDRZ01000007.1 GCA007845545_00987 CDS open 92857-93555 _na     232_aa ABC transporter ATP-binding protein
1621 SDRZ01000007.1 GCA007845545_00988 CDS open 93545-93892 _na     115_aa padR PadR family transcriptional regulator
1622 SDRZ01000007.1 GCA007845545_00989 CDS open 93889-95163 _na     424_aa pspC PspC domain-containing protein
1623 SDRZ01000007.1 GCA007845545_00990 CDS open 95218-97929 _na     903_aa Glycosyltransferase
1624 SDRZ01000007.1 GCA007845545_00991 CDS open 97988-98245 _na     85_aa arsR ArsR family transcriptional regulator
1625 SDRZ01000007.1 GCA007845545_00992 CDS open 98279-98968 _na     229_aa Response regulator transcription factor
1626 SDRZ01000007.1 GCA007845545_00993 CDS open 98965-99978 _na     337_aa histidine kinase
1627 SDRZ01000007.1 GCA007845545_00994 CDS open 100049-100393 _na     114_aa hypothetical protein
1628 SDRZ01000007.1 GCA007845545_00995 CDS open 100390-101139 _na     249_aa Thioredoxin domain-containing protein
1629 SDRZ01000007.1 GCA007845545_00996 CDS open 101213-102238 _na     341_aa CBS domain-containing protein
1630 SDRZ01000007.1 GCA007845545_00997 CDS open 102295-103410 _na     371_aa dnaJ molecular chaperone DnaJ
1631 SDRZ01000007.1 GCA007845545_00998 CDS open 103464-103952 _na     162_aa hypothetical protein
1632 SDRZ01000007.1 GCA007845545_01000 CDS open 104144-105583 _na     479_aa ComEC family competence protein
1633 SDRZ01000007.1 GCA007845545_01001 CDS open 105643-106368 _na     241_aa YebC/PmpR family DNA-binding transcriptional regulator
1634 SDRZ01000007.1 GCA007845545_01002 CDS open 106437-108278 _na     613_aa Lamin tail domain-containing protein
1635 SDRZ01000007.1 GCA007845545_01003 CDS open 108290-108769 _na     159_aa ruvC crossover junction endodeoxyribonuclease RuvC
1636 SDRZ01000007.1 GCA007845545_01004 CDS open 108789-111311 _na     840_aa peptidoglycan glycosyltransferase
1637 SDRZ01000007.1 GCA007845545_01005 CDS open 111318-111896 _na     192_aa ruvA Holliday junction branch migration protein RuvA
1638 SDRZ01000007.1 GCA007845545_01006 CDS open 111951-113750 _na     599_aa DUF262 domain-containing protein
1639 SDRZ01000007.1 GCA007845545_00896 gene open 1368-2627
1640 SDRZ01000007.1 GCA007845545_00897 gene open 2620-3477 rfbD
1641 SDRZ01000007.1 GCA007845545_00898 gene open 3486-4469 rfaJ
1642 SDRZ01000007.1 GCA007845545_00899 gene open 4486-5301 wcaA
1643 SDRZ01000007.1 GCA007845545_00900 gene open 5291-5644
1644 SDRZ01000007.1 GCA007845545_00901 gene open 5641-6345 wcaA
1645 SDRZ01000007.1 GCA007845545_00902 gene open 6352-7206 rfbA
1646 SDRZ01000007.1 GCA007845545_00903 gene open 7297-7506
1647 SDRZ01000007.1 GCA007845545_00904 gene open 7529-8263
1648 SDRZ01000007.1 GCA007845545_00905 gene open 8291-8578 ydcF
1649 SDRZ01000007.1 GCA007845545_00906 gene open 8603-9445
1650 SDRZ01000007.1 GCA007845545_00907 gene open 9445-10014 rfbC
1651 SDRZ01000007.1 GCA007845545_00908 gene open 10011-10559
1652 SDRZ01000007.1 GCA007845545_00909 gene open 10562-11575 rfbB
1653 SDRZ01000007.1 GCA007845545_00910 gene open 11621-12052
1654 SDRZ01000007.1 GCA007845545_00911 gene open 12116-13132 galE
1655 SDRZ01000007.1 GCA007845545_00912 gene open 13169-13699
1656 SDRZ01000007.1 GCA007845545_00913 gene open 13757-14278
1657 SDRZ01000007.1 GCA007845545_00914 gene open 14451-15569
1658 SDRZ01000007.1 GCA007845545_00915 gene open 15569-17005
1659 SDRZ01000007.1 GCA007845545_00916 gene open 17044-18378
1660 SDRZ01000007.1 GCA007845545_00917 gene open 18386-18811 lexA
1661 SDRZ01000007.1 GCA007845545_00918 gene open 18792-20636
1662 SDRZ01000007.1 GCA007845545_00920 gene open 22337-23449
1663 SDRZ01000007.1 GCA007845545_00921 gene open 23415-23714
1664 SDRZ01000007.1 GCA007845545_00922 gene open 23804-23980
1665 SDRZ01000007.1 GCA007845545_00923 gene open 24139-25083
1666 SDRZ01000007.1 GCA007845545_00924 gene open 25134-25319
1667 SDRZ01000007.1 GCA007845545_00925 gene open 25350-27086
1668 SDRZ01000007.1 GCA007845545_00926 gene open 27067-29904
1669 SDRZ01000007.1 GCA007845545_00927 gene open 30290-30655
1670 SDRZ01000007.1 GCA007845545_00928 gene open 30870-32450
1671 SDRZ01000007.1 GCA007845545_00929 gene open 32527-33543
1672 SDRZ01000007.1 GCA007845545_00930 gene open 33727-35862 nrdD
1673 SDRZ01000007.1 GCA007845545_00931 gene open 35810-36553 pflA
1674 SDRZ01000007.1 GCA007845545_00932 gene open 36538-37200 fpr
1675 SDRZ01000007.1 GCA007845545_00933 gene open 37197-39731
1676 SDRZ01000007.1 GCA007845545_00934 gene open 39857-40330
1677 SDRZ01000007.1 GCA007845545_00935 gene open 40323-42473
1678 SDRZ01000007.1 GCA007845545_00936 gene open 42522-43166 radC
1679 SDRZ01000007.1 GCA007845545_00937 gene open 43358-43645 arsR
1680 SDRZ01000007.1 GCA007845545_00938 gene open 44040-45239 hsdM
1681 SDRZ01000007.1 GCA007845545_00939 gene open 45239-45547
1682 SDRZ01000007.1 GCA007845545_00940 gene open 45550-46251
1683 SDRZ01000007.1 GCA007845545_00941 gene open 46248-47366
1684 SDRZ01000007.1 GCA007845545_00942 gene open 47363-48448
1685 SDRZ01000007.1 GCA007845545_00943 gene open 48504-49220
1686 SDRZ01000007.1 GCA007845545_00944 gene open 49314-50147
1687 SDRZ01000007.1 GCA007845545_00945 gene open 50217-53348
1688 SDRZ01000007.1 GCA007845545_00946 gene open 53290-53988
1689 SDRZ01000007.1 GCA007845545_00947 gene open 54054-54680
1690 SDRZ01000007.1 GCA007845545_00948 gene open 54682-54912
1691 SDRZ01000007.1 GCA007845545_00949 gene open 54950-56503
1692 SDRZ01000007.1 GCA007845545_00950 gene open 56803-57717 corA
1693 SDRZ01000007.1 GCA007845545_00951 gene open 57762-58406
1694 SDRZ01000007.1 GCA007845545_00952 gene open 58527-59087
1695 SDRZ01000007.1 GCA007845545_00953 gene open 59170-59934 rbbA
1696 SDRZ01000007.1 GCA007845545_00954 gene open 59936-61054 yadH
1697 SDRZ01000007.1 GCA007845545_00955 gene open 61193-61411
1698 SDRZ01000007.1 GCA007845545_00956 gene open 61657-62055
1699 SDRZ01000007.1 GCA007845545_00957 gene open 62052-62666
1700 SDRZ01000007.1 GCA007845545_00958 gene open 62663-63547 vanZ
1701 SDRZ01000007.1 GCA007845545_00959 gene open 63547-64263
1702 SDRZ01000007.1 GCA007845545_00960 gene open 64260-64862
1703 SDRZ01000007.1 GCA007845545_00961 gene open 64953-65720
1704 SDRZ01000007.1 GCA007845545_00962 gene open 65844-66386 padR
1705 SDRZ01000007.1 GCA007845545_00963 gene open 66367-67092
1706 SDRZ01000007.1 GCA007845545_00964 gene open 67089-69314
1707 SDRZ01000007.1 GCA007845545_00965 gene open 69458-70225
1708 SDRZ01000007.1 GCA007845545_00966 gene open 70222-70944
1709 SDRZ01000007.1 GCA007845545_00967 gene open 70928-71650
1710 SDRZ01000007.1 GCA007845545_00968 gene open 71687-72445
1711 SDRZ01000007.1 GCA007845545_00969 gene open 72503-72943
1712 SDRZ01000007.1 GCA007845545_00970 gene open 73005-73829
1713 SDRZ01000007.1 GCA007845545_00971 gene open 73823-74932
1714 SDRZ01000007.1 GCA007845545_00972 gene open 75033-77405
1715 SDRZ01000007.1 GCA007845545_00973 gene open 77433-78914
1716 SDRZ01000007.1 GCA007845545_00974 gene open 78978-79751
1717 SDRZ01000007.1 GCA007845545_00975 gene open 79756-80700 arcC
1718 SDRZ01000007.1 GCA007845545_00976 gene open 80859-81125
1719 SDRZ01000007.1 GCA007845545_00977 gene open 81135-82775
1720 SDRZ01000007.1 GCA007845545_00978 gene open 82974-84698 mdlB
1721 SDRZ01000007.1 GCA007845545_00979 gene open 84698-86695 mdlB
1722 SDRZ01000007.1 GCA007845545_00980 gene open 86750-87577
1723 SDRZ01000007.1 GCA007845545_00981 gene open 87593-88054
1724 SDRZ01000007.1 GCA007845545_00982 gene open 88375-89826
1725 SDRZ01000007.1 GCA007845545_00983 gene open 89823-90011
1726 SDRZ01000007.1 GCA007845545_00984 gene open 90262-90801
1727 SDRZ01000007.1 GCA007845545_00985 gene open 90841-91461
1728 SDRZ01000007.1 GCA007845545_00986 gene open 91548-92846
1729 SDRZ01000007.1 GCA007845545_00987 gene open 92857-93555
1730 SDRZ01000007.1 GCA007845545_00988 gene open 93545-93892 padR
1731 SDRZ01000007.1 GCA007845545_00989 gene open 93889-95163 pspC
1732 SDRZ01000007.1 GCA007845545_00990 gene open 95218-97929
1733 SDRZ01000007.1 GCA007845545_00991 gene open 97988-98245 arsR
1734 SDRZ01000007.1 GCA007845545_00992 gene open 98279-98968
1735 SDRZ01000007.1 GCA007845545_00993 gene open 98965-99978
1736 SDRZ01000007.1 GCA007845545_00994 gene open 100049-100393
1737 SDRZ01000007.1 GCA007845545_00995 gene open 100390-101139
1738 SDRZ01000007.1 GCA007845545_00996 gene open 101213-102238
1739 SDRZ01000007.1 GCA007845545_00997 gene open 102295-103410 dnaJ
1740 SDRZ01000007.1 GCA007845545_00998 gene open 103464-103952
1741 SDRZ01000007.1 GCA007845545_01000 gene open 104144-105583
1742 SDRZ01000007.1 GCA007845545_01001 gene open 105643-106368
1743 SDRZ01000007.1 GCA007845545_01002 gene open 106437-108278
1744 SDRZ01000007.1 GCA007845545_01003 gene open 108290-108769 ruvC
1745 SDRZ01000007.1 GCA007845545_01004 gene open 108789-111311
1746 SDRZ01000007.1 GCA007845545_01005 gene open 111318-111896 ruvA
1747 SDRZ01000007.1 GCA007845545_01006 gene open 111951-113750
1748 SDRZ01000007.1 GCA007845545_00919 gene open 20698-20772 trnN
1749 SDRZ01000007.1 GCA007845545_00999 gene open 104008-104084 trnK
1750 SDRZ01000007.1 GCA007845545_00919 tRNA open 20698-20772 trnN tRNA-Asn(gtt)
1751 SDRZ01000007.1 GCA007845545_00999 tRNA open 104008-104084 trnK tRNA-Lys(ttt)
1752 SDRZ01000008.1 GCA007845545_00001 CDS open 639-1559 _na     306_aa NAD(P)/FAD-dependent oxidoreductase
1753 SDRZ01000008.1 GCA007845545_00003 CDS open 1718-2194 _na     158_aa Septum formation initiator family protein
1754 SDRZ01000008.1 GCA007845545_00004 CDS open 2250-7382 _na     1710_aa Right handed beta helix domain-containing protein
1755 SDRZ01000008.1 GCA007845545_00006 CDS open 7739-7945 _na     68_aa 50S ribosomal protein L33
1756 SDRZ01000008.1 GCA007845545_00007 CDS open 8038-8664 _na     208_aa hypothetical protein
1757 SDRZ01000008.1 GCA007845545_00008 CDS open 8728-9981 _na     417_aa UDP-N-acetylmuramate--L-alanine ligase
1758 SDRZ01000008.1 GCA007845545_00009 CDS open 9986-10327 _na     113_aa NTP pyrophosphohydrolase MazG-like domain-containing protein
1759 SDRZ01000008.1 GCA007845545_00010 CDS open 10377-10682 _na     101_aa hypothetical protein
1760 SDRZ01000008.1 GCA007845545_00011 CDS open 10792-11535 _na     247_aa trmB Transcription regulator TrmB N-terminal domain-containing protein
1761 SDRZ01000008.1 GCA007845545_00012 CDS open 11565-12227 _na     220_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
1762 SDRZ01000008.1 GCA007845545_00013 CDS open 12227-12637 _na     136_aa Transmembrane protein
1763 SDRZ01000008.1 GCA007845545_00014 CDS open 12630-13178 _na     182_aa DUF4142 domain-containing protein
1764 SDRZ01000008.1 GCA007845545_00015 CDS open 13272-13892 _na     206_aa HD domain-containing protein
1765 SDRZ01000008.1 GCA007845545_00016 CDS open 13914-14453 _na     179_aa CYTH domain-containing protein
1766 SDRZ01000008.1 GCA007845545_00017 CDS open 14464-15813 _na     449_aa Class A beta-lactamase-related serine hydrolase
1767 SDRZ01000008.1 GCA007845545_00018 CDS open 15838-16266 _na     142_aa NUDIX hydrolase
1768 SDRZ01000008.1 GCA007845545_00019 CDS open 16263-18152 _na     629_aa aspS aspartate--tRNA ligase
1769 SDRZ01000008.1 GCA007845545_00020 CDS open 18198-19982 _na     594_aa Type II/IV secretion system protein
1770 SDRZ01000008.1 GCA007845545_00021 CDS open 19982-21208 _na     408_aa Type II secretion system F family protein
1771 SDRZ01000008.1 GCA007845545_00022 CDS open 21244-22302 _na     352_aa pilM Pilus assembly protein PilM
1772 SDRZ01000008.1 GCA007845545_00023 CDS open 22299-22865 _na     188_aa pilN PilN domain-containing protein
1773 SDRZ01000008.1 GCA007845545_00024 CDS open 22862-23470 _na     202_aa pilO Type 4a pilus biogenesis protein PilO
1774 SDRZ01000008.1 GCA007845545_00025 CDS open 23470-23745 _na     91_aa hypothetical protein
1775 SDRZ01000008.1 GCA007845545_00026 CDS open 23749-24324 _na     191_aa PRC-barrel domain-containing protein
1776 SDRZ01000008.1 GCA007845545_00027 CDS open 24321-24995 _na     224_aa recX Regulatory protein RecX
1777 SDRZ01000008.1 GCA007845545_00028 CDS open 25130-26179 _na     349_aa recA recombinase RecA
1778 SDRZ01000008.1 GCA007845545_00029 CDS open 26214-26645 _na     143_aa Prepilin-type N-terminal cleavage/methylation domain-containing protein
1779 SDRZ01000008.1 GCA007845545_00030 CDS open 26650-27426 _na     258_aa DUF304 domain-containing protein
1780 SDRZ01000008.1 GCA007845545_00031 CDS open 27459-28175 _na     238_aa hypothetical protein
1781 SDRZ01000008.1 GCA007845545_00001 gene open 639-1559
1782 SDRZ01000008.1 GCA007845545_00003 gene open 1718-2194
1783 SDRZ01000008.1 GCA007845545_00004 gene open 2250-7382
1784 SDRZ01000008.1 GCA007845545_00006 gene open 7739-7945
1785 SDRZ01000008.1 GCA007845545_00007 gene open 8038-8664
1786 SDRZ01000008.1 GCA007845545_00008 gene open 8728-9981
1787 SDRZ01000008.1 GCA007845545_00009 gene open 9986-10327
1788 SDRZ01000008.1 GCA007845545_00010 gene open 10377-10682
1789 SDRZ01000008.1 GCA007845545_00011 gene open 10792-11535 trmB
1790 SDRZ01000008.1 GCA007845545_00012 gene open 11565-12227 trmB
1791 SDRZ01000008.1 GCA007845545_00013 gene open 12227-12637
1792 SDRZ01000008.1 GCA007845545_00014 gene open 12630-13178
1793 SDRZ01000008.1 GCA007845545_00015 gene open 13272-13892
1794 SDRZ01000008.1 GCA007845545_00016 gene open 13914-14453
1795 SDRZ01000008.1 GCA007845545_00017 gene open 14464-15813
1796 SDRZ01000008.1 GCA007845545_00018 gene open 15838-16266
1797 SDRZ01000008.1 GCA007845545_00019 gene open 16263-18152 aspS
1798 SDRZ01000008.1 GCA007845545_00020 gene open 18198-19982
1799 SDRZ01000008.1 GCA007845545_00021 gene open 19982-21208
1800 SDRZ01000008.1 GCA007845545_00022 gene open 21244-22302 pilM
1801 SDRZ01000008.1 GCA007845545_00023 gene open 22299-22865 pilN
1802 SDRZ01000008.1 GCA007845545_00024 gene open 22862-23470 pilO
1803 SDRZ01000008.1 GCA007845545_00025 gene open 23470-23745
1804 SDRZ01000008.1 GCA007845545_00026 gene open 23749-24324
1805 SDRZ01000008.1 GCA007845545_00027 gene open 24321-24995 recX
1806 SDRZ01000008.1 GCA007845545_00028 gene open 25130-26179 recA
1807 SDRZ01000008.1 GCA007845545_00029 gene open 26214-26645
1808 SDRZ01000008.1 GCA007845545_00030 gene open 26650-27426
1809 SDRZ01000008.1 GCA007845545_00031 gene open 27459-28175
1810 SDRZ01000008.1 GCA007845545_00002 gene open 1611-1688 trnfM
1811 SDRZ01000008.1 GCA007845545_00005 gene open 7493-7568 trnI
1812 SDRZ01000008.1 GCA007845545_00002 tRNA open 1611-1688 trnfM tRNA-fMet(cat)
1813 SDRZ01000008.1 GCA007845545_00005 tRNA open 7493-7568 trnI tRNA-Ile2(cat)
1814 SDRZ01000009.1 repeat_region open 17472-20480 CRISPR array with 46 repeats of length 36%2C consensus sequence GTTTTACAGTAGTGTTATATTGAAAGGCACTGAAAC and spacer length 29
1815 SDRZ01000009.1 GCA007845545_00032 CDS open 223-864 _na     213_aa NYN domain-containing protein
1816 SDRZ01000009.1 GCA007845545_00033 CDS open 1106-1204 _na     32_aa hypothetical protein
1817 SDRZ01000009.1 GCA007845545_00034 CDS open 1378-2451 _na     357_aa DUF4868 domain-containing protein
1818 SDRZ01000009.1 GCA007845545_00035 CDS open 2806-3684 _na     292_aa dprA DNA-processing protein DprA
1819 SDRZ01000009.1 GCA007845545_00036 CDS open 3800-4156 _na     118_aa hypothetical protein
1820 SDRZ01000009.1 GCA007845545_00037 CDS open 4236-6548 _na     770_aa topA type I DNA topoisomerase
1821 SDRZ01000009.1 GCA007845545_00038 CDS open 7024-9954 _na     976_aa type IV secretory system conjugative DNA transfer family protein
1822 SDRZ01000009.1 GCA007845545_00039 CDS open 10058-10489 _na     143_aa Hsp20/alpha crystallin family protein
1823 SDRZ01000009.1 GCA007845545_00040 CDS open 10640-10990 _na     116_aa hypothetical protein
1824 SDRZ01000009.1 GCA007845545_00041 CDS open 11468-13198 _na     576_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1825 SDRZ01000009.1 GCA007845545_00042 CDS open 13387-15531 _na     714_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1826 SDRZ01000009.1 GCA007845545_00043 CDS open 15534-16412 _na     292_aa cas1 type II CRISPR-associated endonuclease Cas1
1827 SDRZ01000009.1 GCA007845545_00044 CDS open 16431-16736 _na     101_aa cas2 CRISPR-associated endonuclease Cas2
1828 SDRZ01000009.1 GCA007845545_00045 CDS open 16733-17422 _na     229_aa csn2 type II-A CRISPR-associated protein Csn2
1829 SDRZ01000009.1 GCA007845545_00046 CDS open 21245-21640 _na     131_aa manC Cupin
1830 SDRZ01000009.1 GCA007845545_00032 gene open 223-864
1831 SDRZ01000009.1 GCA007845545_00033 gene open 1106-1204
1832 SDRZ01000009.1 GCA007845545_00034 gene open 1378-2451
1833 SDRZ01000009.1 GCA007845545_00035 gene open 2806-3684 dprA
1834 SDRZ01000009.1 GCA007845545_00036 gene open 3800-4156
1835 SDRZ01000009.1 GCA007845545_00037 gene open 4236-6548 topA
1836 SDRZ01000009.1 GCA007845545_00038 gene open 7024-9954
1837 SDRZ01000009.1 GCA007845545_00039 gene open 10058-10489
1838 SDRZ01000009.1 GCA007845545_00040 gene open 10640-10990
1839 SDRZ01000009.1 GCA007845545_00041 gene open 11468-13198 cas9
1840 SDRZ01000009.1 GCA007845545_00042 gene open 13387-15531 cas9
1841 SDRZ01000009.1 GCA007845545_00043 gene open 15534-16412 cas1
1842 SDRZ01000009.1 GCA007845545_00044 gene open 16431-16736 cas2
1843 SDRZ01000009.1 GCA007845545_00045 gene open 16733-17422 csn2
1844 SDRZ01000009.1 GCA007845545_00046 gene open 21245-21640 manC
1845 SDRZ01000010.1 GCA007845545_00047 CDS open 95-370 _na     91_aa hypothetical protein
1846 SDRZ01000010.1 GCA007845545_00048 CDS open 414-1352 _na     312_aa tRNA-dihydrouridine synthase
1847 SDRZ01000010.1 GCA007845545_00049 CDS open 1462-1938 _na     158_aa NUDIX domain-containing protein
1848 SDRZ01000010.1 GCA007845545_00050 CDS open 2035-3111 _na     358_aa HD domain-containing protein
1849 SDRZ01000010.1 GCA007845545_00051 CDS open 3142-4152 _na     336_aa Methyltransferase
1850 SDRZ01000010.1 GCA007845545_00052 CDS open 4124-5281 _na     385_aa draI DraI
1851 SDRZ01000010.1 GCA007845545_00054 CDS open 5593-6858 _na     421_aa Sortase
1852 SDRZ01000010.1 GCA007845545_00055 CDS open 6897-8315 _na     472_aa PEGA domain-containing protein
1853 SDRZ01000010.1 GCA007845545_00056 CDS open 8532-9221 _na     229_aa Aspartoacylase
1854 SDRZ01000010.1 GCA007845545_00057 CDS open 9319-10740 _na     473_aa DUF4367 domain-containing protein
1855 SDRZ01000010.1 GCA007845545_00058 CDS open 10802-12202 _na     466_aa der ribosome biogenesis GTPase Der
1856 SDRZ01000010.1 GCA007845545_00059 CDS open 12720-12887 _na     55_aa hypothetical protein
1857 SDRZ01000010.1 GCA007845545_00047 gene open 95-370
1858 SDRZ01000010.1 GCA007845545_00048 gene open 414-1352
1859 SDRZ01000010.1 GCA007845545_00049 gene open 1462-1938
1860 SDRZ01000010.1 GCA007845545_00050 gene open 2035-3111
1861 SDRZ01000010.1 GCA007845545_00051 gene open 3142-4152
1862 SDRZ01000010.1 GCA007845545_00052 gene open 4124-5281 draI
1863 SDRZ01000010.1 GCA007845545_00054 gene open 5593-6858
1864 SDRZ01000010.1 GCA007845545_00055 gene open 6897-8315
1865 SDRZ01000010.1 GCA007845545_00056 gene open 8532-9221
1866 SDRZ01000010.1 GCA007845545_00057 gene open 9319-10740
1867 SDRZ01000010.1 GCA007845545_00058 gene open 10802-12202 der
1868 SDRZ01000010.1 GCA007845545_00059 gene open 12720-12887
1869 SDRZ01000010.1 GCA007845545_00053 gene open 5373-5459 trnL
1870 SDRZ01000010.1 GCA007845545_00053 tRNA open 5373-5459 trnL tRNA-Leu(taa)
1871 SDRZ01000011.1 GCA007845545_00060 CDS open 181-798 _na     205_aa recX Regulatory protein RecX
1872 SDRZ01000011.1 GCA007845545_00061 CDS open 812-1849 _na     345_aa recA recombinase RecA
1873 SDRZ01000011.1 GCA007845545_00062 CDS open 1901-2290 _na     129_aa Gcp-like domain-containing protein
1874 SDRZ01000011.1 GCA007845545_00063 CDS open 2472-3959 _na     495_aa rny ribonuclease Y
1875 SDRZ01000011.1 GCA007845545_00064 CDS open 4044-4574 _na     176_aa NUDIX hydrolase
1876 SDRZ01000011.1 GCA007845545_00067 CDS open 4880-5017 _na     45_aa hypothetical protein
1877 SDRZ01000011.1 GCA007845545_00068 CDS open 5138-6052 _na     304_aa tRNA(Ile)-lysidine synthase
1878 SDRZ01000011.1 GCA007845545_00069 CDS open 6133-7338 _na     401_aa ATP-binding protein
1879 SDRZ01000011.1 GCA007845545_00070 CDS open 7427-8119 _na     230_aa ABC transporter ATP-binding protein
1880 SDRZ01000011.1 GCA007845545_00071 CDS open 8116-10071 _na     651_aa FtsX-like permease family protein
1881 SDRZ01000011.1 GCA007845545_00072 CDS open 10102-12000 _na     632_aa ftsH ATP-dependent zinc metalloprotease FtsH
1882 SDRZ01000011.1 GCA007845545_00073 CDS open 12241-12429 _na     62_aa hypothetical protein
1883 SDRZ01000011.1 GCA007845545_00060 gene open 181-798 recX
1884 SDRZ01000011.1 GCA007845545_00061 gene open 812-1849 recA
1885 SDRZ01000011.1 GCA007845545_00062 gene open 1901-2290
1886 SDRZ01000011.1 GCA007845545_00063 gene open 2472-3959 rny
1887 SDRZ01000011.1 GCA007845545_00064 gene open 4044-4574
1888 SDRZ01000011.1 GCA007845545_00067 gene open 4880-5017
1889 SDRZ01000011.1 GCA007845545_00068 gene open 5138-6052
1890 SDRZ01000011.1 GCA007845545_00069 gene open 6133-7338
1891 SDRZ01000011.1 GCA007845545_00070 gene open 7427-8119
1892 SDRZ01000011.1 GCA007845545_00071 gene open 8116-10071
1893 SDRZ01000011.1 GCA007845545_00072 gene open 10102-12000 ftsH
1894 SDRZ01000011.1 GCA007845545_00073 gene open 12241-12429
1895 SDRZ01000011.1 GCA007845545_00065 gene open 4650-4726 trnM
1896 SDRZ01000011.1 GCA007845545_00066 gene open 4746-4823 trnfM
1897 SDRZ01000011.1 GCA007845545_00065 tRNA open 4650-4726 trnM tRNA-Met(cat)
1898 SDRZ01000011.1 GCA007845545_00066 tRNA open 4746-4823 trnfM tRNA-fMet(cat)
1899 SDRZ01000012.1 GCA007845545_00266 CDS open 242-1066 _na     274_aa hypothetical protein
1900 SDRZ01000012.1 GCA007845545_00267 CDS open 1243-2883 _na     546_aa HD domain-containing protein
1901 SDRZ01000012.1 GCA007845545_00268 CDS open 2940-4091 _na     383_aa DUF2974 domain-containing protein
1902 SDRZ01000012.1 GCA007845545_00269 CDS open 4249-4521 _na     90_aa hypothetical protein
1903 SDRZ01000012.1 GCA007845545_00270 CDS open 4518-5762 _na     414_aa umuC UmuC domain-containing protein
1904 SDRZ01000012.1 GCA007845545_00271 CDS open 5811-6491 _na     226_aa hdeD HdeD family acid-resistance protein
1905 SDRZ01000012.1 GCA007845545_00272 CDS open 6493-7311 _na     272_aa Undecaprenyl-diphosphatase
1906 SDRZ01000012.1 GCA007845545_00266 gene open 242-1066
1907 SDRZ01000012.1 GCA007845545_00267 gene open 1243-2883
1908 SDRZ01000012.1 GCA007845545_00268 gene open 2940-4091
1909 SDRZ01000012.1 GCA007845545_00269 gene open 4249-4521
1910 SDRZ01000012.1 GCA007845545_00270 gene open 4518-5762 umuC
1911 SDRZ01000012.1 GCA007845545_00271 gene open 5811-6491 hdeD
1912 SDRZ01000012.1 GCA007845545_00272 gene open 6493-7311
1913 SDRZ01000013.1 GCA007845545_00273 CDS open 2-487 _na     161_aa hypothetical protein
1914 SDRZ01000013.1 GCA007845545_00274 CDS open 491-2128 _na     545_aa murJ murein biosynthesis integral membrane protein MurJ
1915 SDRZ01000013.1 GCA007845545_00275 CDS open 2130-3203 _na     357_aa GTP-binding protein
1916 SDRZ01000013.1 GCA007845545_00276 CDS open 3214-3822 _na     202_aa Bacteriophage T5 Orf172 DNA-binding domain-containing protein
1917 SDRZ01000013.1 GCA007845545_00277 CDS open 3851-4489 _na     212_aa psbP PsbP C-terminal domain-containing protein
1918 SDRZ01000013.1 GCA007845545_00278 CDS open 4509-4628 _na     39_aa hypothetical protein
1919 SDRZ01000013.1 GCA007845545_00279 CDS open 4625-4978 _na     117_aa hypothetical protein
1920 SDRZ01000013.1 GCA007845545_00280 CDS open 5435-5914 _na     159_aa hypothetical protein
1921 SDRZ01000013.1 GCA007845545_00281 CDS open 6173-6856 _na     227_aa ATPase F1/V1/A1 complex alpha/beta subunit N-terminal domain-containing protein
1922 SDRZ01000013.1 GCA007845545_00282 CDS open 7049-8434 _na     461_aa hypothetical protein
1923 SDRZ01000013.1 GCA007845545_00273 gene open 2-487
1924 SDRZ01000013.1 GCA007845545_00274 gene open 491-2128 murJ
1925 SDRZ01000013.1 GCA007845545_00275 gene open 2130-3203
1926 SDRZ01000013.1 GCA007845545_00276 gene open 3214-3822
1927 SDRZ01000013.1 GCA007845545_00277 gene open 3851-4489 psbP
1928 SDRZ01000013.1 GCA007845545_00278 gene open 4509-4628
1929 SDRZ01000013.1 GCA007845545_00279 gene open 4625-4978
1930 SDRZ01000013.1 GCA007845545_00280 gene open 5435-5914
1931 SDRZ01000013.1 GCA007845545_00281 gene open 6173-6856
1932 SDRZ01000013.1 GCA007845545_00282 gene open 7049-8434
1933 SDRZ01000014.1 GCA007845545_00283 CDS open 95-874 _na     259_aa hypothetical protein
1934 SDRZ01000014.1 GCA007845545_00284 CDS open 885-1964 _na     359_aa UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase
1935 SDRZ01000014.1 GCA007845545_00285 CDS open 2736-3545 _na     269_aa Type 1 glutamine amidotransferase
1936 SDRZ01000014.1 GCA007845545_00286 CDS open 3858-4001 _na     47_aa hypothetical protein
1937 SDRZ01000014.1 GCA007845545_00287 CDS open 4608-4871 _na     87_aa hypothetical protein
1938 SDRZ01000014.1 GCA007845545_00288 CDS open 4882-5457 _na     191_aa hypothetical protein
1939 SDRZ01000014.1 GCA007845545_00289 CDS open 5476-6399 _na     307_aa FtsQ-type POTRA domain-containing protein
1940 SDRZ01000014.1 GCA007845545_00290 CDS open 6413-7747 _na     444_aa hypothetical protein
1941 SDRZ01000014.1 GCA007845545_00283 gene open 95-874
1942 SDRZ01000014.1 GCA007845545_00284 gene open 885-1964
1943 SDRZ01000014.1 GCA007845545_00285 gene open 2736-3545
1944 SDRZ01000014.1 GCA007845545_00286 gene open 3858-4001
1945 SDRZ01000014.1 GCA007845545_00287 gene open 4608-4871
1946 SDRZ01000014.1 GCA007845545_00288 gene open 4882-5457
1947 SDRZ01000014.1 GCA007845545_00289 gene open 5476-6399
1948 SDRZ01000014.1 GCA007845545_00290 gene open 6413-7747
1949 SDRZ01000015.1 GCA007845545_00445 CDS open 36-263 _na     75_aa Small ribosomal subunit protein bS21
1950 SDRZ01000015.1 GCA007845545_00446 CDS open 267-719 _na     150_aa GatB/YqeY
1951 SDRZ01000015.1 GCA007845545_00447 CDS open 735-1280 _na     181_aa Adenylate kinase
1952 SDRZ01000015.1 GCA007845545_00448 CDS open 1265-2035 _na     256_aa map type I methionyl aminopeptidase
1953 SDRZ01000015.1 GCA007845545_00449 CDS open 2069-3295 _na     408_aa ftsA cell division protein FtsA
1954 SDRZ01000015.1 GCA007845545_00450 CDS open 3344-4546 _na     400_aa ftsZ cell division protein FtsZ
1955 SDRZ01000015.1 GCA007845545_00451 CDS open 4547-4999 _na     150_aa nrdR transcriptional regulator NrdR
1956 SDRZ01000015.1 GCA007845545_00452 CDS open 4999-5256 _na     85_aa Thioredoxin-like fold domain-containing protein
1957 SDRZ01000015.1 GCA007845545_00453 CDS open 5249-5857 _na     202_aa Vitamin K epoxide reductase family protein
1958 SDRZ01000015.1 GCA007845545_00445 gene open 36-263
1959 SDRZ01000015.1 GCA007845545_00446 gene open 267-719
1960 SDRZ01000015.1 GCA007845545_00447 gene open 735-1280
1961 SDRZ01000015.1 GCA007845545_00448 gene open 1265-2035 map
1962 SDRZ01000015.1 GCA007845545_00449 gene open 2069-3295 ftsA
1963 SDRZ01000015.1 GCA007845545_00450 gene open 3344-4546 ftsZ
1964 SDRZ01000015.1 GCA007845545_00451 gene open 4547-4999 nrdR
1965 SDRZ01000015.1 GCA007845545_00452 gene open 4999-5256
1966 SDRZ01000015.1 GCA007845545_00453 gene open 5249-5857
1967 SDRZ01000016.1 GCA007845545_00454 CDS open 18-347 _na     109_aa valine--tRNA ligase
1968 SDRZ01000016.1 GCA007845545_00455 CDS open 366-764 _na     132_aa HIT family protein
1969 SDRZ01000016.1 GCA007845545_00456 CDS open 815-1231 _na     138_aa Pentapeptide repeat-containing protein
1970 SDRZ01000016.1 GCA007845545_00457 CDS open 1314-1520 _na     68_aa hypothetical protein
1971 SDRZ01000016.1 GCA007845545_00458 CDS open 1660-2865 _na     401_aa D-alanyl-D-alanine carboxypeptidase
1972 SDRZ01000016.1 GCA007845545_00459 CDS open 2919-3773 _na     284_aa JAB domain-containing protein
1973 SDRZ01000016.1 GCA007845545_00460 CDS open 3902-4186 _na     94_aa yafQ Type II toxin-antitoxin system YafQ family toxin
1974 SDRZ01000016.1 GCA007845545_00461 CDS open 4183-4464 _na     93_aa Type II toxin-antitoxin system RelB/DinJ family antitoxin
1975 SDRZ01000016.1 GCA007845545_00463 CDS open 5459-5767 _na     102_aa cdiI CdiI immunity protein domain-containing protein
1976 SDRZ01000016.1 GCA007845545_00454 gene open 18-347
1977 SDRZ01000016.1 GCA007845545_00455 gene open 366-764
1978 SDRZ01000016.1 GCA007845545_00456 gene open 815-1231
1979 SDRZ01000016.1 GCA007845545_00457 gene open 1314-1520
1980 SDRZ01000016.1 GCA007845545_00458 gene open 1660-2865
1981 SDRZ01000016.1 GCA007845545_00459 gene open 2919-3773
1982 SDRZ01000016.1 GCA007845545_00460 gene open 3902-4186 yafQ
1983 SDRZ01000016.1 GCA007845545_00461 gene open 4183-4464
1984 SDRZ01000016.1 GCA007845545_00463 gene open 5459-5767 cdiI
1985 SDRZ01000016.1 GCA007845545_00462 gene open 4630-4717 trnS
1986 SDRZ01000016.1 GCA007845545_00462 tRNA open 4630-4717 trnS tRNA-Ser(tga)
1987 SDRZ01000017.1 GCA007845545_00590 CDS open 50-3028 _na     992_aa hypothetical protein
1988 SDRZ01000017.1 GCA007845545_00590 gene open 50-3028
1989 SDRZ01000018.1 GCA007845545_00699 CDS open 194-1015 _na     273_aa hypothetical protein
1990 SDRZ01000018.1 GCA007845545_00700 CDS open 1021-1410 _na     129_aa TMhelix containing protein
1991 SDRZ01000018.1 GCA007845545_00701 CDS open 1410-2780 _na     456_aa DUF4214 domain-containing protein
1992 SDRZ01000018.1 GCA007845545_00702 CDS open 2823-3083 _na     86_aa hypothetical protein
1993 SDRZ01000018.1 GCA007845545_00703 CDS open 3211-3531 _na     106_aa DUF3310 domain-containing protein
1994 SDRZ01000018.1 GCA007845545_00699 gene open 194-1015
1995 SDRZ01000018.1 GCA007845545_00700 gene open 1021-1410
1996 SDRZ01000018.1 GCA007845545_00701 gene open 1410-2780
1997 SDRZ01000018.1 GCA007845545_00702 gene open 2823-3083
1998 SDRZ01000018.1 GCA007845545_00703 gene open 3211-3531
1999 SDRZ01000019.1 GCA007845545_00704 CDS open 1-882 _na     293_aa hisG ATP phosphoribosyltransferase
2000 SDRZ01000019.1 GCA007845545_00705 CDS open 892-1209 _na     105_aa Phosphoribosyl-ATP pyrophosphatase