HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus oralis subsp. tigurinus (GCA_026782545.1)

Select a Genome:
BAKTA Annotations for GCA_026782545.1
Genome Selected: Streptococcus oralis subsp. tigurinus
ContigsBases CDSrRNA tmRNAtRNA
9 1867867 1779 3 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3721 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3721 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 JAKUWR010000003.1 GCA026782545_00483 gene open 148566-148886 padR
1002 JAKUWR010000003.1 GCA026782545_00484 gene open 148886-149461
1003 JAKUWR010000003.1 GCA026782545_00485 gene open 149496-150005
1004 JAKUWR010000003.1 GCA026782545_00486 gene open 150169-151203 hrcA
1005 JAKUWR010000003.1 GCA026782545_00487 gene open 151230-151745 grpE
1006 JAKUWR010000003.1 GCA026782545_00488 gene open 152012-153835 dnaK
1007 JAKUWR010000003.1 GCA026782545_00489 gene open 154353-155489 dnaJ
1008 JAKUWR010000003.1 GCA026782545_00490 gene open 155569-156222
1009 JAKUWR010000003.1 GCA026782545_00491 gene open 156289-156567
1010 JAKUWR010000003.1 GCA026782545_00492 gene open 156577-156987
1011 JAKUWR010000003.1 GCA026782545_00493 gene open 157055-157786 rbbA
1012 JAKUWR010000003.1 GCA026782545_00494 gene open 157783-158832 ecsB
1013 JAKUWR010000003.1 GCA026782545_00495 gene open 158880-159674 ccrZ
1014 JAKUWR010000003.1 GCA026782545_00496 gene open 159671-160306 trmB
1015 JAKUWR010000003.1 GCA026782545_00497 gene open 160385-160912 rimP
1016 JAKUWR010000003.1 GCA026782545_00498 gene open 160967-162091 nusA
1017 JAKUWR010000003.1 GCA026782545_00499 gene open 162113-162406 rnpM
1018 JAKUWR010000003.1 GCA026782545_00500 gene open 162399-162698 rpl7Ae
1019 JAKUWR010000003.1 GCA026782545_00501 gene open 162715-165498 infB
1020 JAKUWR010000003.1 GCA026782545_00502 gene open 165749-166099 rbfA
1021 JAKUWR010000003.1 GCA026782545_00503 gene open 166315-166497
1022 JAKUWR010000003.1 GCA026782545_00504 gene open 166711-166944
1023 JAKUWR010000003.1 GCA026782545_00505 gene open 166944-168278
1024 JAKUWR010000003.1 GCA026782545_00506 gene open 168288-168542
1025 JAKUWR010000003.1 GCA026782545_00507 gene open 168585-168890
1026 JAKUWR010000003.1 GCA026782545_00508 gene open 169108-169503
1027 JAKUWR010000003.1 GCA026782545_00509 gene open 169789-170376
1028 JAKUWR010000003.1 GCA026782545_00510 gene open 170354-170911
1029 JAKUWR010000003.1 GCA026782545_00511 gene open 170931-172913
1030 JAKUWR010000003.1 GCA026782545_00512 gene open 172906-173916
1031 JAKUWR010000003.1 GCA026782545_00513 gene open 173909-174985
1032 JAKUWR010000003.1 GCA026782545_00514 gene open 174969-175511 bgcI
1033 JAKUWR010000003.1 GCA026782545_00515 gene open 175504-178155
1034 JAKUWR010000003.1 GCA026782545_00516 gene open 178225-179184
1035 JAKUWR010000003.1 GCA026782545_00517 gene open 179181-180389
1036 JAKUWR010000003.1 GCA026782545_00518 gene open 180444-181664
1037 JAKUWR010000003.1 GCA026782545_00519 gene open 181735-183312
1038 JAKUWR010000003.1 GCA026782545_00520 gene open 183429-184034 rpoE
1039 JAKUWR010000003.1 GCA026782545_00521 gene open 184351-185958 pyrG
1040 JAKUWR010000003.1 GCA026782545_00522 gene open 186112-186411
1041 JAKUWR010000003.1 GCA026782545_00523 gene open 186408-186725 trxA
1042 JAKUWR010000003.1 GCA026782545_00524 gene open 186741-187367 ytpR
1043 JAKUWR010000003.1 GCA026782545_00525 gene open 187407-188168 ydfG
1044 JAKUWR010000003.1 GCA026782545_00526 gene open 188246-188641 ssb
1045 JAKUWR010000003.1 GCA026782545_00527 gene open 188950-189234 groES
1046 JAKUWR010000003.1 GCA026782545_00528 gene open 189250-190872 groL
1047 JAKUWR010000003.1 GCA026782545_00529 gene open 190998-191765 queH
1048 JAKUWR010000003.1 GCA026782545_00530 gene open 191836-192369 ygaC
1049 JAKUWR010000003.1 GCA026782545_00531 gene open 192457-193233 recX
1050 JAKUWR010000003.1 GCA026782545_00351 gene open 33-105 trnD
1051 JAKUWR010000003.1 GCA026782545_00352 gene open 130-202 trnK
1052 JAKUWR010000003.1 GCA026782545_00353 gene open 208-289 trnL
1053 JAKUWR010000003.1 GCA026782545_00354 gene open 302-374 trnT
1054 JAKUWR010000003.1 GCA026782545_00355 gene open 397-468 trnG
1055 JAKUWR010000003.1 GCA026782545_00356 gene open 476-561 trnL
1056 JAKUWR010000003.1 GCA026782545_00357 gene open 573-646 trnR
1057 JAKUWR010000003.1 GCA026782545_00358 gene open 662-735 trnP
1058 JAKUWR010000003.1 GCA026782545_00410 gene open 52868-52938 trnC
1059 JAKUWR010000003.1 GCA026782545_00351 tRNA open 33-105 trnD tRNA-Asp(gtc)
1060 JAKUWR010000003.1 GCA026782545_00352 tRNA open 130-202 trnK tRNA-Lys(ttt)
1061 JAKUWR010000003.1 GCA026782545_00353 tRNA open 208-289 trnL tRNA-Leu(tag)
1062 JAKUWR010000003.1 GCA026782545_00354 tRNA open 302-374 trnT tRNA-Thr(tgt)
1063 JAKUWR010000003.1 GCA026782545_00355 tRNA open 397-468 trnG tRNA-Gly(gcc)
1064 JAKUWR010000003.1 GCA026782545_00356 tRNA open 476-561 trnL tRNA-Leu(taa)
1065 JAKUWR010000003.1 GCA026782545_00357 tRNA open 573-646 trnR tRNA-Arg(acg)
1066 JAKUWR010000003.1 GCA026782545_00358 tRNA open 662-735 trnP tRNA-Pro(tgg)
1067 JAKUWR010000003.1 GCA026782545_00410 tRNA open 52868-52938 trnC tRNA-Cys(gca)
1068 JAKUWR010000004.1 GCA026782545_01195 gene open 680590-680934 ssrA
1069 JAKUWR010000004.1 GCA026782545_01195 tmRNA open 680590-680934 ssrA transfer-messenger RNA%2C SsrA
1070 JAKUWR010000004.1 rep_origin open 12684-12841
1071 JAKUWR010000004.1 rep_origin open 13775-14419
1072 JAKUWR010000004.1 GCA026782545_00574 gene open 43373-43417 SpF51_sRNA
1073 JAKUWR010000004.1 GCA026782545_00660 gene open 137100-137166 Spd-sr37
1074 JAKUWR010000004.1 GCA026782545_00696 gene open 168033-168079 SpR10_sRNA
1075 JAKUWR010000004.1 GCA026782545_00769 gene open 225380-225471 csRNA
1076 JAKUWR010000004.1 GCA026782545_00779 gene open 233890-233986 csRNA
1077 JAKUWR010000004.1 GCA026782545_00784 gene open 239612-239699 csRNA
1078 JAKUWR010000004.1 GCA026782545_00787 gene open 241319-241409 csRNA
1079 JAKUWR010000004.1 GCA026782545_00889 gene open 370059-370440 RNaseP_bact_b
1080 JAKUWR010000004.1 GCA026782545_01041 gene open 529674-529813 SpF22_sRNA
1081 JAKUWR010000004.1 GCA026782545_01171 gene open 660387-660507 SpR19_sRNA
1082 JAKUWR010000004.1 GCA026782545_01212 gene open 698360-698455 SpF44_sRNA
1083 JAKUWR010000004.1 GCA026782545_01218 gene open 703502-703600 SpF43_sRNA
1084 JAKUWR010000004.1 GCA026782545_00574 ncRNA open 43373-43417 Streptococcus sRNA SpF51
1085 JAKUWR010000004.1 GCA026782545_00660 ncRNA open 137100-137166 Streptococcus sRNA Spd-sr37
1086 JAKUWR010000004.1 GCA026782545_00696 ncRNA open 168033-168079 Streptococcus sRNA SpR10
1087 JAKUWR010000004.1 GCA026782545_00769 ncRNA open 225380-225471 Cia-dependent small RNA csRNA1
1088 JAKUWR010000004.1 GCA026782545_00779 ncRNA open 233890-233986 Cia-dependent small RNA csRNA1
1089 JAKUWR010000004.1 GCA026782545_00784 ncRNA open 239612-239699 Cia-dependent small RNA csRNA1
1090 JAKUWR010000004.1 GCA026782545_00787 ncRNA open 241319-241409 Cia-dependent small RNA csRNA1
1091 JAKUWR010000004.1 GCA026782545_00889 ncRNA open 370059-370440 Bacterial RNase P class B
1092 JAKUWR010000004.1 GCA026782545_01041 ncRNA open 529674-529813 Streptococcus sRNA SpF22
1093 JAKUWR010000004.1 GCA026782545_01171 ncRNA open 660387-660507 Streptococcus sRNA SpR19
1094 JAKUWR010000004.1 GCA026782545_01212 ncRNA open 698360-698455 Streptococcus sRNA SpF44
1095 JAKUWR010000004.1 GCA026782545_01218 ncRNA open 703502-703600 Streptococcus sRNA SpF43
1096 JAKUWR010000004.1 regulatory_region open 177730-177844 FMN riboswitch aptamer (RFN element)
1097 JAKUWR010000004.1 regulatory_region open 187048-187198 M-box riboswitch aptamer (ykoK leader)
1098 JAKUWR010000004.1 regulatory_region open 223463-223535 L17 ribosomal protein downstream element
1099 JAKUWR010000004.1 regulatory_region open 228976-229074 azaaromatic riboswitch aptamer (yjdF RNA)
1100 JAKUWR010000004.1 regulatory_region open 262224-262281 Lacto-rpoB RNA
1101 JAKUWR010000004.1 regulatory_region open 392482-392570 Glycine riboswitch aptamer
1102 JAKUWR010000004.1 regulatory_region open 584783-584887 PyrR binding site
1103 JAKUWR010000004.1 regulatory_region open 590037-590125 TPP riboswitch aptamer (THI element)
1104 JAKUWR010000004.1 regulatory_region open 592764-592852 TPP riboswitch aptamer (THI element)
1105 JAKUWR010000004.1 regulatory_region open 599193-599290 TPP riboswitch aptamer (THI element)
1106 JAKUWR010000004.1 regulatory_region open 705549-705681 PyrR binding site
1107 JAKUWR010000004.1 regulatory_region open 730978-731097 Ribosomal protein L21 leader
1108 JAKUWR010000004.1 regulatory_region open 751359-751490 Ribosomal protein L20 leader
1109 JAKUWR010000004.1 regulatory_region open 799237-799452 T-box leader
1110 JAKUWR010000004.1 repeat_region open 723687-724918 CRISPR array with 19 repeats of length 36%2C consensus sequence GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC and spacer length 29
1111 JAKUWR010000004.1 GCA026782545_00532 CDS open 74-2032 _na     652_aa ftsH ATP-dependent zinc metalloprotease FtsH
1112 JAKUWR010000004.1 GCA026782545_00533 CDS open 2048-2590 _na     180_aa hpt hypoxanthine phosphoribosyltransferase
1113 JAKUWR010000004.1 GCA026782545_00534 CDS open 2595-3872 _na     425_aa tRNA(Ile)-lysidine synthase
1114 JAKUWR010000004.1 GCA026782545_00535 CDS open 3869-5137 _na     422_aa beta-lactamase
1115 JAKUWR010000004.1 GCA026782545_00536 CDS open 5130-5252 _na     40_aa SP_0009 family protein
1116 JAKUWR010000004.1 GCA026782545_00537 CDS open 5257-5526 _na     89_aa putative septum formation initiator
1117 JAKUWR010000004.1 GCA026782545_00538 CDS open 5618-5884 _na     88_aa rqcP RQC P-site tRNA stabilizing factor
1118 JAKUWR010000004.1 GCA026782545_00539 CDS open 5942-9445 _na     1167_aa mfd transcription-repair coupling factor
1119 JAKUWR010000004.1 GCA026782545_00540 CDS open 9446-10015 _na     189_aa pth aminoacyl-tRNA hydrolase
1120 JAKUWR010000004.1 GCA026782545_00541 CDS open 10088-11203 _na     371_aa ychF redox-regulated ATPase YchF
1121 JAKUWR010000004.1 GCA026782545_00542 CDS open 11288-11482 _na     64_aa DUF951 domain-containing protein
1122 JAKUWR010000004.1 GCA026782545_00543 CDS open 11547-12683 _na     378_aa dnaN DNA polymerase III subunit beta
1123 JAKUWR010000004.1 GCA026782545_00544 CDS open 12842-14203 _na     453_aa dnaA chromosomal replication initiator protein DnaA
1124 JAKUWR010000004.1 GCA026782545_00545 CDS open 14420-15163 _na     247_aa Chromosome-partitioning protein Spo0J
1125 JAKUWR010000004.1 GCA026782545_00546 CDS open 15236-16426 _na     396_aa htrA Serine protease do-like htrA
1126 JAKUWR010000004.1 GCA026782545_00547 CDS open 16604-17083 _na     159_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
1127 JAKUWR010000004.1 GCA026782545_00549 CDS open 17366-17488 _na     40_aa comC competence-stimulating peptide ComC
1128 JAKUWR010000004.1 GCA026782545_00550 CDS open 17501-18820 _na     439_aa comD Sensor histidine kinase ComD
1129 JAKUWR010000004.1 GCA026782545_00551 CDS open 18817-19569 _na     250_aa lytT Accessory gene regulator protein A
1130 JAKUWR010000004.1 GCA026782545_00554 CDS open 19811-20353 _na     180_aa tetR TetR family transcriptional regulator
1131 JAKUWR010000004.1 GCA026782545_00555 CDS open 20481-23135 _na     884_aa ABC-2 type transporter transmembrane domain-containing protein
1132 JAKUWR010000004.1 GCA026782545_00556 CDS open 23157-25709 _na     850_aa yfhO Bacterial membrane protein YfhO
1133 JAKUWR010000004.1 GCA026782545_00557 CDS open 25771-27393 _na     540_aa uup ABC transporter ATP-binding protein
1134 JAKUWR010000004.1 GCA026782545_00558 CDS open 27589-28617 _na     342_aa trpS tryptophan--tRNA ligase
1135 JAKUWR010000004.1 GCA026782545_00559 CDS open 28777-30255 _na     492_aa guaB IMP dehydrogenase
1136 JAKUWR010000004.1 GCA026782545_00560 CDS open 30311-31402 _na     363_aa recF DNA replication/repair protein RecF
1137 JAKUWR010000004.1 GCA026782545_00561 CDS open 31405-31773 _na     122_aa yaaA S4 domain protein YaaA
1138 JAKUWR010000004.1 GCA026782545_00562 CDS open 31934-33184 _na     416_aa yfmF EF-P 5-aminopentanol modification-associated protein YfmF
1139 JAKUWR010000004.1 GCA026782545_00563 CDS open 33181-34464 _na     427_aa yfmH EF-P 5-aminopentanol modification-associated protein YfmH
1140 JAKUWR010000004.1 GCA026782545_00564 CDS open 34500-35321 _na     273_aa rodZ cytoskeleton protein RodZ
1141 JAKUWR010000004.1 GCA026782545_00565 CDS open 35332-35877 _na     181_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
1142 JAKUWR010000004.1 GCA026782545_00566 CDS open 35874-36701 _na     275_aa energy-coupling factor ABC transporter ATP-binding protein
1143 JAKUWR010000004.1 GCA026782545_00567 CDS open 36686-37525 _na     279_aa energy-coupling factor transporter ATPase
1144 JAKUWR010000004.1 GCA026782545_00568 CDS open 37518-38312 _na     264_aa ecfT Energy-coupling factor transporter transmembrane protein EcfT
1145 JAKUWR010000004.1 GCA026782545_00569 CDS open 38373-39188 _na     271_aa mreC rod shape-determining protein MreC
1146 JAKUWR010000004.1 GCA026782545_00570 CDS open 39191-39685 _na     164_aa mreD rod shape-determining protein MreD
1147 JAKUWR010000004.1 GCA026782545_00571 CDS open 39779-41008 _na     409_aa pcsB peptidoglycan hydrolase PcsB
1148 JAKUWR010000004.1 GCA026782545_00572 CDS open 41233-42012 _na     259_aa rpsB 30S ribosomal protein S2
1149 JAKUWR010000004.1 GCA026782545_00573 CDS open 42091-43131 _na     346_aa tsf translation elongation factor Ts
1150 JAKUWR010000004.1 GCA026782545_00575 CDS open 43411-44337 _na     308_aa cysK cysteine synthase A
1151 JAKUWR010000004.1 GCA026782545_00576 CDS open 44434-44877 _na     147_aa Bacterial Pleckstrin-like y domain-containing protein
1152 JAKUWR010000004.1 GCA026782545_00577 CDS open 44893-45528 _na     211_aa yIH1 Xaa-Pro dipeptidase
1153 JAKUWR010000004.1 GCA026782545_00578 CDS open 45585-46883 _na     432_aa recG ATP-dependent DNA helicase RecG
1154 JAKUWR010000004.1 GCA026782545_00579 CDS open 46880-47542 _na     220_aa putative amidophosphoribosyltransferases%2C involved in transformation
1155 JAKUWR010000004.1 GCA026782545_00580 CDS open 47622-48170 _na     182_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
1156 JAKUWR010000004.1 GCA026782545_00581 CDS open 48418-49626 _na     402_aa Acyl-CoA dehydrogenase
1157 JAKUWR010000004.1 GCA026782545_00582 CDS open 49710-50555 _na     281_aa 3-hydroxyacyl-CoA dehydrogenase%2C NAD binding domain protein
1158 JAKUWR010000004.1 GCA026782545_00583 CDS open 50574-51752 _na     392_aa acetyl-CoA C-acetyltransferase
1159 JAKUWR010000004.1 GCA026782545_00584 CDS open 52073-52852 _na     259_aa Enoyl-CoA hydratase/isomerase family protein
1160 JAKUWR010000004.1 GCA026782545_00585 CDS open 52868-53590 _na     240_aa CoA transferase
1161 JAKUWR010000004.1 GCA026782545_00586 CDS open 53592-54245 _na     217_aa Acetate CoA-transferase subunit beta
1162 JAKUWR010000004.1 GCA026782545_00587 CDS open 54455-55348 _na     297_aa lysR LysR family transcriptional regulator
1163 JAKUWR010000004.1 GCA026782545_00588 CDS open 55364-56476 _na     370_aa Acyl-CoA dehydrogenase%2C C-terminal domain protein
1164 JAKUWR010000004.1 GCA026782545_00589 CDS open 56480-57397 _na     305_aa ytnP Putative quorum-quenching lactonase YtnP
1165 JAKUWR010000004.1 GCA026782545_00590 CDS open 57504-58442 _na     312_aa Putative enoyl-[acyl-carrier-protein] reductase II
1166 JAKUWR010000004.1 GCA026782545_00591 CDS open 58618-60591 _na     657_aa Cyclic-di-AMP phosphodiesterase
1167 JAKUWR010000004.1 GCA026782545_00592 CDS open 60588-61040 _na     150_aa rplI 50S ribosomal protein L9
1168 JAKUWR010000004.1 GCA026782545_00593 CDS open 61084-62436 _na     450_aa dnaB replicative DNA helicase
1169 JAKUWR010000004.1 GCA026782545_00594 CDS open 62438-62713 _na     91_aa CAAX amino protease family protein
1170 JAKUWR010000004.1 GCA026782545_00595 CDS open 62804-63913 _na     369_aa N-acetylmuramoyl-L-alanine amidase
1171 JAKUWR010000004.1 GCA026782545_00596 CDS open 63962-66631 _na     889_aa DNA polymerase I
1172 JAKUWR010000004.1 GCA026782545_00597 CDS open 66908-67198 _na     96_aa yqgV Thiamine-binding protein domain-containing protein
1173 JAKUWR010000004.1 GCA026782545_00598 CDS open 67161-67919 _na     252_aa tauC ABC transmembrane type-1 domain-containing protein
1174 JAKUWR010000004.1 GCA026782545_00599 CDS open 67956-68963 _na     335_aa tauA SsuA/THI5-like domain-containing protein
1175 JAKUWR010000004.1 GCA026782545_00600 CDS open 68963-69691 _na     242_aa tauB ABC transporter domain-containing protein
1176 JAKUWR010000004.1 GCA026782545_00601 CDS open 69810-70268 _na     152_aa ctsR Transcriptional regulator CtsR
1177 JAKUWR010000004.1 GCA026782545_00602 CDS open 70270-72702 _na     810_aa clpA ATP-dependent Clp protease%2C ATP-binding subunit
1178 JAKUWR010000004.1 GCA026782545_00603 CDS open 72955-73608 _na     217_aa bgrR response regulator transcription factor BgrR
1179 JAKUWR010000004.1 GCA026782545_00604 CDS open 73605-74216 _na     203_aa histidine kinase
1180 JAKUWR010000004.1 GCA026782545_00605 CDS open 74226-74945 _na     239_aa HAMP domain-containing sensor histidine kinase
1181 JAKUWR010000004.1 GCA026782545_00606 CDS open 75054-75581 _na     175_aa Isoprenylcysteine carboxyl methyltransferase (ICMT) family protein
1182 JAKUWR010000004.1 GCA026782545_00607 CDS open 78392-79090 _na     232_aa LPXTG cell wall anchor domain-containing protein
1183 JAKUWR010000004.1 GCA026782545_00608 CDS open 79409-80467 _na     352_aa nadR Bifunctional NadR protein
1184 JAKUWR010000004.1 GCA026782545_00609 CDS open 80477-81256 _na     259_aa pnuC nicotinamide riboside transporter PnuC
1185 JAKUWR010000004.1 GCA026782545_00610 CDS open 81258-82031 _na     257_aa Nudix hydrolase domain-containing protein
1186 JAKUWR010000004.1 GCA026782545_00611 CDS open 82304-82987 _na     227_aa fliK Flagellar hook-length control protein FliK
1187 JAKUWR010000004.1 GCA026782545_00612 CDS open 83114-83800 _na     228_aa DUF1275 domain-containing protein
1188 JAKUWR010000004.1 GCA026782545_00613 CDS open 83856-84836 _na     326_aa dusB tRNA dihydrouridine synthase DusB
1189 JAKUWR010000004.1 GCA026782545_00614 CDS open 84823-85695 _na     290_aa hslO Hsp33 family molecular chaperone HslO
1190 JAKUWR010000004.1 GCA026782545_00615 CDS open 85982-86113 _na     43_aa D-alanyl-lipoteichoic acid biosynthesis protein
1191 JAKUWR010000004.1 GCA026782545_00616 CDS open 86134-87684 _na     516_aa dltA D-alanine--poly(phosphoribitol) ligase subunit DltA
1192 JAKUWR010000004.1 GCA026782545_00617 CDS open 87681-88925 _na     414_aa dltB D-alanyl-lipoteichoic acid biosynthesis protein DltB
1193 JAKUWR010000004.1 GCA026782545_00618 CDS open 88939-89178 _na     79_aa dltC D-alanine--poly(phosphoribitol) ligase subunit DltC
1194 JAKUWR010000004.1 GCA026782545_00619 CDS open 89171-90439 _na     422_aa dltD D-alanyl-lipoteichoic acid biosynthesis protein DltD
1195 JAKUWR010000004.1 GCA026782545_00620 CDS open 90582-92645 _na     687_aa nt5e cell surface ecto-5'-nucleotidase Nt5e
1196 JAKUWR010000004.1 GCA026782545_00621 CDS open 92794-93234 _na     146_aa adcR zinc-dependent transcriptional regulator AdcR
1197 JAKUWR010000004.1 GCA026782545_00622 CDS open 93234-93938 _na     234_aa adcC Zinc transport system ATP-binding protein AdcC
1198 JAKUWR010000004.1 GCA026782545_00623 CDS open 93931-94737 _na     268_aa znuB ABC transporter membrane-spanning permease-Zinc (Zn2+) transport
1199 JAKUWR010000004.1 GCA026782545_00624 CDS open 94747-96252 _na     501_aa adcA zinc ABC transporter substrate-binding lipoprotein AdcA
1200 JAKUWR010000004.1 GCA026782545_00625 CDS open 96783-98462 _na     559_aa F5/8 type C domain-containing protein
1201 JAKUWR010000004.1 GCA026782545_00626 CDS open 98499-100586 _na     695_aa Sugar hydrolase
1202 JAKUWR010000004.1 GCA026782545_00627 CDS open 100757-102037 _na     426_aa Twin-arginine translocation pathway signal
1203 JAKUWR010000004.1 GCA026782545_00628 CDS open 102135-104780 _na     881_aa mngB Alpha-mannosidase
1204 JAKUWR010000004.1 GCA026782545_00629 CDS open 104877-105746 _na     289_aa Beta-glucoside kinase
1205 JAKUWR010000004.1 GCA026782545_00630 CDS open 105740-107620 _na     626_aa Glycosyl hydrolase-related protein
1206 JAKUWR010000004.1 GCA026782545_00631 CDS open 107978-108907 _na     309_aa lplB ABC transporter permease
1207 JAKUWR010000004.1 GCA026782545_00632 CDS open 108921-109844 _na     307_aa ugpE ABC transmembrane type-1 domain-containing protein
1208 JAKUWR010000004.1 GCA026782545_00633 CDS open 109952-111436 _na     494_aa ugpB Carbohydrate ABC transporter substrate-binding protein
1209 JAKUWR010000004.1 GCA026782545_00634 CDS open 111597-112286 _na     229_aa CAAX protease self-immunity
1210 JAKUWR010000004.1 GCA026782545_00635 CDS open 112355-112651 _na     98_aa Enterocin A Immunity
1211 JAKUWR010000004.1 GCA026782545_00636 CDS open 112783-113769 _na     328_aa trhO rhodanese-related sulfurtransferase
1212 JAKUWR010000004.1 GCA026782545_00637 CDS open 113891-114751 _na     286_aa tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase
1213 JAKUWR010000004.1 GCA026782545_00638 CDS open 114906-115829 _na     307_aa comR ComR tetratricopeptide domain-containing protein
1214 JAKUWR010000004.1 GCA026782545_00639 CDS open 115924-116145 _na     73_aa hypothetical protein
1215 JAKUWR010000004.1 GCA026782545_00640 CDS open 116177-117040 _na     287_aa ABC transporter family protein
1216 JAKUWR010000004.1 GCA026782545_00641 CDS open 117064-117756 _na     230_aa ABC transporter permease
1217 JAKUWR010000004.1 GCA026782545_00642 CDS open 117768-118346 _na     192_aa Adhesin domain-containing protein
1218 JAKUWR010000004.1 GCA026782545_00643 CDS open 118339-118638 _na     99_aa Peptidase%2C C39 domain protein
1219 JAKUWR010000004.1 GCA026782545_00644 CDS open 118723-119685 _na     320_aa Response regulator (Homolog to RR11 Spn)
1220 JAKUWR010000004.1 GCA026782545_00645 CDS open 119748-120677 _na     309_aa DUF4097 domain-containing protein
1221 JAKUWR010000004.1 GCA026782545_00646 CDS open 120670-121263 _na     197_aa DUF1700 domain-containing protein
1222 JAKUWR010000004.1 GCA026782545_00647 CDS open 121250-121576 _na     108_aa padR Transcription regulator PadR N-terminal domain-containing protein
1223 JAKUWR010000004.1 GCA026782545_00648 CDS open 121732-124569 _na     945_aa clpB ClpB protein
1224 JAKUWR010000004.1 GCA026782545_00649 CDS open 124773-125939 _na     388_aa Major facilitator superfamily (MFS) profile domain-containing protein
1225 JAKUWR010000004.1 GCA026782545_00650 CDS open 126161-126991 _na     276_aa Glycosyltransferase%2C group 2 family protein
1226 JAKUWR010000004.1 GCA026782545_00651 CDS open 127067-128917 _na     616_aa flaA1 Nucleoside-diphosphate sugar isomerase
1227 JAKUWR010000004.1 GCA026782545_00652 CDS open 129013-129642 _na     209_aa HAD hydrolase%2C family IA%2C variant 1
1228 JAKUWR010000004.1 GCA026782545_00653 CDS open 129664-130536 _na     290_aa sdaAA L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha
1229 JAKUWR010000004.1 GCA026782545_00654 CDS open 130545-131216 _na     223_aa sdaAB L-serine ammonia-lyase%2C iron-sulfur-dependent subunit beta
1230 JAKUWR010000004.1 GCA026782545_00655 CDS open 131458-132063 _na     201_aa lytE Putative peptidoglycan endopeptidase LytE
1231 JAKUWR010000004.1 GCA026782545_00656 CDS open 132342-133148 _na     268_aa Amino acid ABC transporter ATP-binding protein
1232 JAKUWR010000004.1 GCA026782545_00657 CDS open 133164-134360 _na     398_aa argininosuccinate synthase
1233 JAKUWR010000004.1 GCA026782545_00658 CDS open 134388-135779 _na     463_aa argH argininosuccinate lyase
1234 JAKUWR010000004.1 GCA026782545_00659 CDS open 135941-137062 _na     373_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
1235 JAKUWR010000004.1 GCA026782545_00661 CDS open 137203-137658 _na     151_aa yjhB Nudix hydrolase domain-containing protein
1236 JAKUWR010000004.1 GCA026782545_00662 CDS open 137667-139580 _na     637_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
1237 JAKUWR010000004.1 GCA026782545_00663 CDS open 139723-141402 _na     559_aa rnjA ribonuclease J1
1238 JAKUWR010000004.1 GCA026782545_00664 CDS open 141404-141637 _na     77_aa rpoY DNA-directed RNA polymerase subunit epsilon
1239 JAKUWR010000004.1 GCA026782545_00665 CDS open 142042-142227 _na     61_aa hypothetical protein
1240 JAKUWR010000004.1 GCA026782545_00666 CDS open 142638-142853 _na     71_aa DUF1146 domain-containing protein
1241 JAKUWR010000004.1 GCA026782545_00667 CDS open 143185-143868 _na     227_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
1242 JAKUWR010000004.1 GCA026782545_00668 CDS open 143865-144302 _na     145_aa rimI ribosomal protein S18-alanine N-acetyltransferase
1243 JAKUWR010000004.1 GCA026782545_00669 CDS open 144292-145302 _na     336_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
1244 JAKUWR010000004.1 GCA026782545_00670 CDS open 145406-145714 _na     102_aa Transcriptional regulator
1245 JAKUWR010000004.1 GCA026782545_00671 CDS open 145757-146269 _na     170_aa Transcriptional activator%2C Rgg/GadR/MutR family domain protein
1246 JAKUWR010000004.1 GCA026782545_00672 CDS open 146435-146578 _na     47_aa Conserved domain protein
1247 JAKUWR010000004.1 GCA026782545_00673 CDS open 146597-147271 _na     224_aa CAAX amino terminal protease self-immunity
1248 JAKUWR010000004.1 GCA026782545_00674 CDS open 147283-147948 _na     221_aa CPBP family intramembrane metalloprotease
1249 JAKUWR010000004.1 GCA026782545_00675 CDS open 148019-149032 _na     337_aa Transporter%2C major facilitator family protein
1250 JAKUWR010000004.1 GCA026782545_00676 CDS open 149073-149246 _na     57_aa Macrolide-efflux protein
1251 JAKUWR010000004.1 GCA026782545_00677 CDS open 149405-150100 _na     231_aa azlC AzlC protein
1252 JAKUWR010000004.1 GCA026782545_00678 CDS open 150090-150413 _na     107_aa Branched-chain amino acid permease
1253 JAKUWR010000004.1 GCA026782545_00679 CDS open 150517-151347 _na     276_aa hisJ ABC transporter substrate-binding protein-amino acid transport
1254 JAKUWR010000004.1 GCA026782545_00680 CDS open 151501-152355 _na     284_aa nlpA Lipoprotein
1255 JAKUWR010000004.1 GCA026782545_00681 CDS open 152454-153827 _na     457_aa argE Deacylase
1256 JAKUWR010000004.1 GCA026782545_00682 CDS open 153820-154881 _na     353_aa metN Methionine import ATP-binding protein MetN
1257 JAKUWR010000004.1 GCA026782545_00683 CDS open 154883-155575 _na     230_aa metP ABC transmembrane type-1 domain-containing protein
1258 JAKUWR010000004.1 GCA026782545_00684 CDS open 155736-156890 _na     384_aa dltB D-alanyl-lipoteichoic acid biosynthesis protein DltB
1259 JAKUWR010000004.1 GCA026782545_00685 CDS open 156938-158110 _na     390_aa dltD D-alanyl-lipoteichoic acid biosynthesis protein DltD
1260 JAKUWR010000004.1 GCA026782545_00686 CDS open 158285-158854 _na     189_aa TIGR02185 family protein
1261 JAKUWR010000004.1 GCA026782545_00687 CDS open 158988-159602 _na     204_aa PF04854 family protein
1262 JAKUWR010000004.1 GCA026782545_00688 CDS open 159568-161250 _na     560_aa Histidine kinase
1263 JAKUWR010000004.1 GCA026782545_00689 CDS open 161262-162548 _na     428_aa araC DNA-binding response regulator%2C AraC family
1264 JAKUWR010000004.1 GCA026782545_00690 CDS open 162607-163140 _na     177_aa ABC transporter permease
1265 JAKUWR010000004.1 GCA026782545_00691 CDS open 163218-163688 _na     156_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
1266 JAKUWR010000004.1 GCA026782545_00692 CDS open 163769-165031 _na     420_aa mntH Nramp family divalent metal transporter
1267 JAKUWR010000004.1 GCA026782545_00693 CDS open 165229-165474 _na     81_aa marR MarR family transcriptional regulator
1268 JAKUWR010000004.1 GCA026782545_00694 CDS open 165732-167423 _na     563_aa argS arginine--tRNA ligase
1269 JAKUWR010000004.1 GCA026782545_00695 CDS open 167579-168025 _na     148_aa argR arginine repressor
1270 JAKUWR010000004.1 GCA026782545_00697 CDS open 168076-170610 _na     844_aa mutS DNA mismatch repair protein MutS
1271 JAKUWR010000004.1 GCA026782545_00698 CDS open 170652-171110 _na     152_aa Gram-positive signal peptide protein%2C YSIRK family
1272 JAKUWR010000004.1 GCA026782545_00699 CDS open 171107-171547 _na     146_aa lytTR HTH LytTR-type domain-containing protein
1273 JAKUWR010000004.1 GCA026782545_00700 CDS open 171755-173704 _na     649_aa mutL DNA mismatch repair endonuclease MutL
1274 JAKUWR010000004.1 GCA026782545_00701 CDS open 174183-174650 _na     155_aa ribE 6%2C7-dimethyl-8-ribityllumazine synthase
1275 JAKUWR010000004.1 GCA026782545_00702 CDS open 174651-175856 _na     401_aa ribA bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II
1276 JAKUWR010000004.1 GCA026782545_00703 CDS open 175876-176511 _na     211_aa ribE riboflavin synthase
1277 JAKUWR010000004.1 GCA026782545_00704 CDS open 176496-177596 _na     366_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
1278 JAKUWR010000004.1 GCA026782545_00705 CDS open 178001-178594 _na     197_aa ruvA Holliday junction branch migration protein RuvA
1279 JAKUWR010000004.1 GCA026782545_00706 CDS open 178604-179167 _na     187_aa DNA-3-methyladenine glycosylase I
1280 JAKUWR010000004.1 GCA026782545_00707 CDS open 179251-179514 _na     87_aa Integral membrane protein
1281 JAKUWR010000004.1 GCA026782545_00708 CDS open 179620-180654 _na     344_aa ldcA Muramoyltetrapeptide carboxypeptidase
1282 JAKUWR010000004.1 GCA026782545_00709 CDS open 180975-181322 _na     115_aa tfoX TfoX N-terminal domain-containing protein
1283 JAKUWR010000004.1 GCA026782545_00710 CDS open 181338-182015 _na     225_aa Integral membrane protein
1284 JAKUWR010000004.1 GCA026782545_00711 CDS open 182027-182971 _na     314_aa HTH cro/C1-type domain-containing protein
1285 JAKUWR010000004.1 GCA026782545_00712 CDS open 183076-185940 _na     954_aa uvrA excinuclease ABC subunit UvrA
1286 JAKUWR010000004.1 GCA026782545_00713 CDS open 185933-186994 _na     353_aa pepP Aminopeptidase P
1287 JAKUWR010000004.1 GCA026782545_00714 CDS open 187394-190054 _na     886_aa mgtA magnesium-translocating P-type ATPase
1288 JAKUWR010000004.1 GCA026782545_00715 CDS open 190189-190587 _na     132_aa spx transcriptional regulator Spx
1289 JAKUWR010000004.1 GCA026782545_00716 CDS open 190654-191223 _na     189_aa SP-0191-like C-terminal domain-containing protein
1290 JAKUWR010000004.1 GCA026782545_00717 CDS open 191310-191576 _na     88_aa ireB IreB family regulatory phosphoprotein
1291 JAKUWR010000004.1 GCA026782545_00718 CDS open 191580-191999 _na     139_aa ruvX Holliday junction resolvase RuvX
1292 JAKUWR010000004.1 GCA026782545_00719 CDS open 192015-192320 _na     101_aa yrzB UPF0473 protein SPH_0311
1293 JAKUWR010000004.1 GCA026782545_00720 CDS open 192529-193779 _na     416_aa Dihydrofolate synthetase
1294 JAKUWR010000004.1 GCA026782545_00721 CDS open 193867-194325 _na     152_aa SP_0198 family lipoprotein
1295 JAKUWR010000004.1 GCA026782545_00722 CDS open 194511-195662 _na     383_aa eutG Alcohol dehydrogenase%2C iron-containing
1296 JAKUWR010000004.1 GCA026782545_00723 CDS open 195690-197018 _na     442_aa 4'-demethylrebeccamycin synthase
1297 JAKUWR010000004.1 GCA026782545_00724 CDS open 197022-198002 _na     326_aa NAD dependent epimerase/dehydratase family protein
1298 JAKUWR010000004.1 GCA026782545_00725 CDS open 197977-198792 _na     271_aa Metal dependent hydrolase
1299 JAKUWR010000004.1 GCA026782545_00726 CDS open 198770-200032 _na     420_aa F390 synthetase-related protein
1300 JAKUWR010000004.1 GCA026782545_00727 CDS open 200047-200991 _na     314_aa 3-Oxoacyl-[acyl-carrier-(ACP)] synthase III C terminal family protein
1301 JAKUWR010000004.1 GCA026782545_00728 CDS open 201127-202659 _na     510_aa cls cardiolipin synthase
1302 JAKUWR010000004.1 GCA026782545_00729 CDS open 202733-202876 _na     47_aa Induced during competence
1303 JAKUWR010000004.1 GCA026782545_00730 CDS open 202912-204429 _na     505_aa Competence-induced protein Ccs4
1304 JAKUWR010000004.1 GCA026782545_00731 CDS open 204549-206756 _na     735_aa nrdD anaerobic ribonucleoside-triphosphate reductase
1305 JAKUWR010000004.1 GCA026782545_00732 CDS open 206768-206914 _na     48_aa 30S ribosomal protein S10
1306 JAKUWR010000004.1 GCA026782545_00733 CDS open 206952-207452 _na     166_aa N-acetyltransferase domain-containing protein
1307 JAKUWR010000004.1 GCA026782545_00734 CDS open 207457-208053 _na     198_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
1308 JAKUWR010000004.1 GCA026782545_00735 CDS open 208050-208676 _na     208_aa Phosphoribulokinase/uridine kinase domain-containing protein
1309 JAKUWR010000004.1 GCA026782545_00736 CDS open 208943-209251 _na     102_aa rpsJ 30S ribosomal protein S10
1310 JAKUWR010000004.1 GCA026782545_00737 CDS open 209334-209960 _na     208_aa rplC 50S ribosomal protein L3
1311 JAKUWR010000004.1 GCA026782545_00738 CDS open 209985-210608 _na     207_aa rplD 50S ribosomal protein L4
1312 JAKUWR010000004.1 GCA026782545_00739 CDS open 210608-210904 _na     98_aa rplW 50S ribosomal protein L23
1313 JAKUWR010000004.1 GCA026782545_00740 CDS open 210922-211755 _na     277_aa rplB 50S ribosomal protein L2
1314 JAKUWR010000004.1 GCA026782545_00741 CDS open 211858-212139 _na     93_aa rpsS 30S ribosomal protein S19
1315 JAKUWR010000004.1 GCA026782545_00742 CDS open 212151-212495 _na     114_aa Large ribosomal subunit protein uL22
1316 JAKUWR010000004.1 GCA026782545_00743 CDS open 212508-213161 _na     217_aa rpsC 30S ribosomal protein S3
1317 JAKUWR010000004.1 GCA026782545_00744 CDS open 213165-213578 _na     137_aa rplP 50S ribosomal protein L16
1318 JAKUWR010000004.1 GCA026782545_00745 CDS open 213588-213794 _na     68_aa rpmC 50S ribosomal protein L29
1319 JAKUWR010000004.1 GCA026782545_00746 CDS open 213819-214079 _na     86_aa rpsQ 30S ribosomal protein S17
1320 JAKUWR010000004.1 GCA026782545_00747 CDS open 214105-214473 _na     122_aa rplN 50S ribosomal protein L14
1321 JAKUWR010000004.1 GCA026782545_00748 CDS open 214551-214856 _na     101_aa rplX 50S ribosomal protein L24
1322 JAKUWR010000004.1 GCA026782545_00749 CDS open 214880-215422 _na     180_aa rplE 50S ribosomal protein L5
1323 JAKUWR010000004.1 GCA026782545_00750 CDS open 215440-215625 _na     61_aa rpsZ type Z 30S ribosomal protein S14
1324 JAKUWR010000004.1 GCA026782545_00751 CDS open 215685-215774 _na     29_aa hypothetical protein
1325 JAKUWR010000004.1 GCA026782545_00752 CDS open 215839-216237 _na     132_aa rpsH 30S ribosomal protein S8
1326 JAKUWR010000004.1 GCA026782545_00753 CDS open 216425-216961 _na     178_aa rplF 50S ribosomal protein L6
1327 JAKUWR010000004.1 GCA026782545_00754 CDS open 217045-217401 _na     118_aa rplR 50S ribosomal protein L18
1328 JAKUWR010000004.1 GCA026782545_00755 CDS open 217419-217913 _na     164_aa rpsE 30S ribosomal protein S5
1329 JAKUWR010000004.1 GCA026782545_00756 CDS open 217927-218109 _na     60_aa rpmD 50S ribosomal protein L30
1330 JAKUWR010000004.1 GCA026782545_00757 CDS open 218253-218693 _na     146_aa rplO 50S ribosomal protein L15
1331 JAKUWR010000004.1 GCA026782545_00758 CDS open 218706-220016 _na     436_aa secY preprotein translocase subunit SecY
1332 JAKUWR010000004.1 GCA026782545_00759 CDS open 220173-220811 _na     212_aa adk adenylate kinase
1333 JAKUWR010000004.1 GCA026782545_00760 CDS open 220928-221146 _na     72_aa infA translation initiation factor IF-1
1334 JAKUWR010000004.1 GCA026782545_00761 CDS open 221171-221287 _na     38_aa rpmJ 50S ribosomal protein L36
1335 JAKUWR010000004.1 GCA026782545_00762 CDS open 221305-221670 _na     121_aa rpsM 30S ribosomal protein S13
1336 JAKUWR010000004.1 GCA026782545_00763 CDS open 221688-222071 _na     127_aa rpsK 30S ribosomal protein S11
1337 JAKUWR010000004.1 GCA026782545_00764 CDS open 222114-223049 _na     311_aa rpoA DNA-directed RNA polymerase subunit alpha
1338 JAKUWR010000004.1 GCA026782545_00765 CDS open 223061-223447 _na     128_aa rplQ 50S ribosomal protein L17
1339 JAKUWR010000004.1 GCA026782545_00766 CDS open 223711-223977 _na     88_aa ACT domain-containing protein
1340 JAKUWR010000004.1 GCA026782545_00767 CDS open 223987-225324 _na     445_aa UPF0210 protein SPJ_0248
1341 JAKUWR010000004.1 GCA026782545_00768 CDS open 225259-225381 _na     40_aa hypothetical protein
1342 JAKUWR010000004.1 GCA026782545_00770 CDS open 225561-226253 _na     230_aa phoE 2%2C3-bisphosphoglycerate-dependent phosphoglycerate mutase
1343 JAKUWR010000004.1 GCA026782545_00771 CDS open 226413-228914 _na     833_aa leuS leucine--tRNA ligase
1344 JAKUWR010000004.1 GCA026782545_00772 CDS open 229089-229502 _na     137_aa DUF2992 domain-containing protein
1345 JAKUWR010000004.1 GCA026782545_00773 CDS open 230008-230874 _na     288_aa drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA
1346 JAKUWR010000004.1 GCA026782545_00774 CDS open 230874-231716 _na     280_aa ABC-2 type transporter
1347 JAKUWR010000004.1 GCA026782545_00775 CDS open 231735-232190 _na     151_aa lytR Autolysis response regulater LytR
1348 JAKUWR010000004.1 GCA026782545_00776 CDS open 232200-232619 _na     139_aa DUF3021 domain-containing protein
1349 JAKUWR010000004.1 GCA026782545_00777 CDS open 232713-233408 _na     231_aa rimL GNAT family protein
1350 JAKUWR010000004.1 GCA026782545_00778 CDS open 233420-233836 _na     138_aa Acetyltransferase%2C GNAT family
1351 JAKUWR010000004.1 GCA026782545_00780 CDS open 234028-234906 _na     292_aa araC AraC family transcriptional regulator
1352 JAKUWR010000004.1 GCA026782545_00781 CDS open 234982-236181 _na     399_aa OFA family MFS transporter
1353 JAKUWR010000004.1 GCA026782545_00782 CDS open 236400-237008 _na     202_aa NADPH-dependent FMN reductase domain-containing protein
1354 JAKUWR010000004.1 GCA026782545_00783 CDS open 237034-239445 _na     803_aa urdA Urocanate reductase
1355 JAKUWR010000004.1 GCA026782545_00785 CDS open 239733-240731 _na     332_aa ruvB Holliday junction branch migration DNA helicase RuvB
1356 JAKUWR010000004.1 GCA026782545_00786 CDS open 240712-241296 _na     194_aa Nucleotidyltransferase family protein
1357 JAKUWR010000004.1 GCA026782545_00788 CDS open 241506-242264 _na     252_aa uppS isoprenyl transferase
1358 JAKUWR010000004.1 GCA026782545_00789 CDS open 242273-243076 _na     267_aa Phosphatidate cytidylyltransferase
1359 JAKUWR010000004.1 GCA026782545_00790 CDS open 243092-244348 _na     418_aa rseP RIP metalloprotease RseP
1360 JAKUWR010000004.1 GCA026782545_00791 CDS open 244365-246218 _na     617_aa proS proline--tRNA ligase
1361 JAKUWR010000004.1 GCA026782545_00792 CDS open 246316-247695 _na     459_aa bglB 6-phospho-beta-glucosidase
1362 JAKUWR010000004.1 GCA026782545_00793 CDS open 247733-248146 _na     137_aa eamA EamA domain-containing protein
1363 JAKUWR010000004.1 GCA026782545_00794 CDS open 248362-250170 _na     602_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
1364 JAKUWR010000004.1 GCA026782545_00795 CDS open 250281-251333 _na     350_aa ssuD Luciferase-like domain-containing protein
1365 JAKUWR010000004.1 GCA026782545_00796 CDS open 251370-251462 _na     30_aa hypothetical protein
1366 JAKUWR010000004.1 GCA026782545_00797 CDS open 251561-252418 _na     285_aa 5'-nucleotidase%2C lipoprotein e(P4) family
1367 JAKUWR010000004.1 GCA026782545_00798 CDS open 252786-253790 _na     334_aa Uroporphyrinogen decarboxylase (URO-D) domain-containing protein
1368 JAKUWR010000004.1 GCA026782545_00799 CDS open 254008-255006 _na     332_aa Uroporphyrinogen decarboxylase (URO-D) domain-containing protein
1369 JAKUWR010000004.1 GCA026782545_00800 CDS open 255018-255896 _na     292_aa Solute-binding protein family 3/N-terminal domain-containing protein
1370 JAKUWR010000004.1 GCA026782545_00801 CDS open 255929-256621 _na     230_aa ABC transmembrane type-1 domain-containing protein
1371 JAKUWR010000004.1 GCA026782545_00802 CDS open 256625-257347 _na     240_aa ABC transmembrane type-1 domain-containing protein
1372 JAKUWR010000004.1 GCA026782545_00803 CDS open 257357-258121 _na     254_aa glnQ Glutamine ABC transporter%2C ATP-binding protein GlnQ
1373 JAKUWR010000004.1 GCA026782545_00804 CDS open 258309-262025 _na     1238_aa pullulanase
1374 JAKUWR010000004.1 GCA026782545_00805 CDS open 262468-266079 _na     1203_aa rpoB DNA-directed RNA polymerase subunit beta
1375 JAKUWR010000004.1 GCA026782545_00806 CDS open 266112-269777 _na     1221_aa rpoC DNA-directed RNA polymerase subunit beta'
1376 JAKUWR010000004.1 GCA026782545_00807 CDS open 269887-270306 _na     139_aa ndk nucleoside-diphosphate kinase
1377 JAKUWR010000004.1 GCA026782545_00808 CDS open 270443-271066 _na     207_aa Lipoprotein
1378 JAKUWR010000004.1 GCA026782545_00809 CDS open 271152-271595 _na     147_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1379 JAKUWR010000004.1 GCA026782545_00810 CDS open 271585-272106 _na     173_aa Spermidine N(1)-acetyltransferase
1380 JAKUWR010000004.1 GCA026782545_00811 CDS open 272099-273151 _na     350_aa brpA biofilm formation/cell division transcriptional regulator BrpA
1381 JAKUWR010000004.1 GCA026782545_00812 CDS open 273225-274481 _na     418_aa competence/damage-inducible protein A
1382 JAKUWR010000004.1 GCA026782545_00813 CDS open 274536-275684 _na     382_aa recA recombinase RecA
1383 JAKUWR010000004.1 GCA026782545_00814 CDS open 275803-276357 _na     184_aa N-acetyltransferase domain-containing protein
1384 JAKUWR010000004.1 GCA026782545_00815 CDS open 276467-277837 _na     456_aa MATE efflux family protein
1385 JAKUWR010000004.1 GCA026782545_00816 CDS open 277934-278650 _na     238_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
1386 JAKUWR010000004.1 GCA026782545_00817 CDS open 278698-279366 _na     222_aa CD20-like family protein
1387 JAKUWR010000004.1 GCA026782545_00818 CDS open 279581-280042 _na     153_aa marR Transcriptional regulator%2C MarR family
1388 JAKUWR010000004.1 GCA026782545_00819 CDS open 280026-281795 _na     589_aa ABC transporter ATP-binding protein
1389 JAKUWR010000004.1 GCA026782545_00820 CDS open 281785-283545 _na     586_aa ABC transporter ATP-binding protein
1390 JAKUWR010000004.1 GCA026782545_00821 CDS open 283642-284145 _na     167_aa bcrC Undecaprenyl-diphosphatase BcrC
1391 JAKUWR010000004.1 GCA026782545_00822 CDS open 284259-284705 _na     148_aa lytTR HTH LytTR-type domain-containing protein
1392 JAKUWR010000004.1 GCA026782545_00823 CDS open 284711-285385 _na     224_aa liaF LiaF transmembrane domain-containing protein
1393 JAKUWR010000004.1 GCA026782545_00824 CDS open 285492-285680 _na     62_aa rpmB 50S ribosomal protein L28
1394 JAKUWR010000004.1 GCA026782545_00825 CDS open 285833-286198 _na     121_aa yloU Asp23/Gls24 family envelope stress response protein
1395 JAKUWR010000004.1 GCA026782545_00826 CDS open 286201-287868 _na     555_aa fakA DhaL domain-containing protein
1396 JAKUWR010000004.1 GCA026782545_00827 CDS open 288007-288198 _na     63_aa Alanine aminotransferase
1397 JAKUWR010000004.1 GCA026782545_00828 CDS open 288195-288389 _na     64_aa Alanine aminotransferase
1398 JAKUWR010000004.1 GCA026782545_00829 CDS open 288376-289251 _na     291_aa yxlF Putative ABC transporter ATP-binding protein YxlF
1399 JAKUWR010000004.1 GCA026782545_00830 CDS open 289264-289998 _na     244_aa Multidrug ABC transporter permease
1400 JAKUWR010000004.1 GCA026782545_00831 CDS open 290003-291100 _na     365_aa histidine kinase
1401 JAKUWR010000004.1 GCA026782545_00832 CDS open 291102-291701 _na     199_aa citB Response regulator
1402 JAKUWR010000004.1 GCA026782545_00833 CDS open 292019-292432 _na     137_aa rpsL 30S ribosomal protein S12
1403 JAKUWR010000004.1 GCA026782545_00834 CDS open 292452-292922 _na     156_aa rpsG 30S ribosomal protein S7
1404 JAKUWR010000004.1 GCA026782545_00835 CDS open 293202-295283 _na     693_aa fusA elongation factor G
1405 JAKUWR010000004.1 GCA026782545_00836 CDS open 295614-297314 _na     566_aa ilvB acetolactate synthase large subunit
1406 JAKUWR010000004.1 GCA026782545_00837 CDS open 297307-297783 _na     158_aa ilvN acetolactate synthase small subunit
1407 JAKUWR010000004.1 GCA026782545_00838 CDS open 297874-298896 _na     340_aa ilvC ketol-acid reductoisomerase
1408 JAKUWR010000004.1 GCA026782545_00839 CDS open 298976-300226 _na     416_aa ilvA threonine ammonia-lyase IlvA
1409 JAKUWR010000004.1 GCA026782545_00840 CDS open 300309-301205 _na     298_aa hflK Modulator of FtsH protease HflK
1410 JAKUWR010000004.1 GCA026782545_00841 CDS open 301312-301527 _na     71_aa Spermidine synthase
1411 JAKUWR010000004.1 GCA026782545_00842 CDS open 301620-302360 _na     246_aa glnQ ABC transporter ATP-binding protein
1412 JAKUWR010000004.1 GCA026782545_00843 CDS open 302357-303925 _na     522_aa hisJ Glutamine ABC transporter substrate-binding protein
1413 JAKUWR010000004.1 GCA026782545_00844 CDS open 304056-305948 _na     630_aa Threonine dehydratase
1414 JAKUWR010000004.1 GCA026782545_00845 CDS open 306008-306853 _na     281_aa undecaprenyl-diphosphate phosphatase
1415 JAKUWR010000004.1 GCA026782545_00846 CDS open 306887-307948 _na     353_aa dinB DNA polymerase IV
1416 JAKUWR010000004.1 GCA026782545_00847 CDS open 308186-310501 _na     771_aa pflB formate C-acetyltransferase
1417 JAKUWR010000004.1 GCA026782545_00848 CDS open 310820-314572 _na     1250_aa Gram-positive cocci surface proteins LPxTG domain-containing protein
1418 JAKUWR010000004.1 GCA026782545_00849 CDS open 314851-314940 _na     29_aa hypothetical protein
1419 JAKUWR010000004.1 GCA026782545_00850 CDS open 315024-317129 _na     701_aa clpL ATP-dependent Clp protease ATP-binding subunit ClpL
1420 JAKUWR010000004.1 GCA026782545_00851 CDS open 317189-317671 _na     160_aa luxS S-ribosylhomocysteine lyase
1421 JAKUWR010000004.1 GCA026782545_00852 CDS open 317967-318674 _na     235_aa Multidrug ABC transporter
1422 JAKUWR010000004.1 GCA026782545_00853 CDS open 318676-319464 _na     262_aa ABC-2 family transporter protein
1423 JAKUWR010000004.1 GCA026782545_00854 CDS open 319464-320186 _na     240_aa ABC-2 family transporter protein
1424 JAKUWR010000004.1 GCA026782545_00855 CDS open 320199-320867 _na     222_aa arlR Response regulator ArlR
1425 JAKUWR010000004.1 GCA026782545_00856 CDS open 320864-321895 _na     343_aa histidine kinase
1426 JAKUWR010000004.1 GCA026782545_00857 CDS open 322030-323514 _na     494_aa UPF0371 protein SP70585_0405
1427 JAKUWR010000004.1 GCA026782545_00858 CDS open 323667-325277 _na     536_aa dexB Glucan 1%2C6-alpha-glucosidase
1428 JAKUWR010000004.1 GCA026782545_00859 CDS open 325446-327413 _na     655_aa amiA Oligopeptide-binding protein AmiA
1429 JAKUWR010000004.1 GCA026782545_00860 CDS open 327561-329522 _na     653_aa sarA Oligopeptide-binding protein SarA
1430 JAKUWR010000004.1 GCA026782545_00861 CDS open 329714-331159 _na     481_aa Cell envelope-related transcriptional attenuator domain-containing protein
1431 JAKUWR010000004.1 GCA026782545_00862 CDS open 331161-331892 _na     243_aa cps4B capsular polysaccharide biosynthesis protein Cps4B
1432 JAKUWR010000004.1 GCA026782545_00863 CDS open 331901-332593 _na     230_aa cpsC capsular polysaccharide biosynthesis protein CpsC
1433 JAKUWR010000004.1 GCA026782545_00864 CDS open 332603-333286 _na     227_aa cpsD Tyrosine-protein kinase CpsD
1434 JAKUWR010000004.1 GCA026782545_00865 CDS open 333309-334676 _na     455_aa epsL Putative sugar transferase EpsL
1435 JAKUWR010000004.1 GCA026782545_00866 CDS open 334680-335081 _na     133_aa tagD glycerol-3-phosphate cytidylyltransferase
1436 JAKUWR010000004.1 GCA026782545_00867 CDS open 335104-335925 _na     273_aa LicD/FKTN/FKRP nucleotidyltransferase domain-containing protein
1437 JAKUWR010000004.1 GCA026782545_00868 CDS open 335940-336404 _na     154_aa pssD PssD/Cps14F family polysaccharide biosynthesis glycosyltransferase
1438 JAKUWR010000004.1 GCA026782545_00869 CDS open 336404-336883 _na     159_aa Glycosyltransferase family 28 C-terminal domain protein
1439 JAKUWR010000004.1 GCA026782545_00870 CDS open 336915-338006 _na     363_aa epsF Putative glycosyltransferase EpsF
1440 JAKUWR010000004.1 GCA026782545_00871 CDS open 338014-338940 _na     308_aa epsE Putative glycosyltransferase EpsE
1441 JAKUWR010000004.1 GCA026782545_00872 CDS open 338989-340164 _na     391_aa Polysaccharide polymerase
1442 JAKUWR010000004.1 GCA026782545_00873 CDS open 340136-340864 _na     242_aa Family 2 glycosyl transferase
1443 JAKUWR010000004.1 GCA026782545_00874 CDS open 340864-341619 _na     251_aa DUF4422 domain-containing protein
1444 JAKUWR010000004.1 GCA026782545_00875 CDS open 341739-343154 _na     471_aa Putative O-antigen transporter
1445 JAKUWR010000004.1 GCA026782545_00876 CDS open 343156-344154 _na     332_aa yiaH Inner membrane protein YiaH
1446 JAKUWR010000004.1 GCA026782545_00877 CDS open 344168-345268 _na     366_aa glf UDP-galactopyranose mutase
1447 JAKUWR010000004.1 GCA026782545_00878 CDS open 345296-346165 _na     289_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
1448 JAKUWR010000004.1 GCA026782545_00879 CDS open 346166-346759 _na     197_aa dTDP-4-dehydrorhamnose 3%2C5-epimerase
1449 JAKUWR010000004.1 GCA026782545_00880 CDS open 346778-347824 _na     348_aa rfbB dTDP-glucose 4%2C6-dehydratase
1450 JAKUWR010000004.1 GCA026782545_00881 CDS open 347885-348739 _na     284_aa rfbD dTDP-4-dehydrorhamnose reductase
1451 JAKUWR010000004.1 GCA026782545_00882 CDS open 348989-350971 _na     660_aa ABC transporter%2C substrate-binding protein%2C family 5
1452 JAKUWR010000004.1 GCA026782545_00883 CDS open 351239-357610 _na     2123_aa SpGH101 family endo-alpha-N-acetylgalactosaminidase
1453 JAKUWR010000004.1 GCA026782545_00884 CDS open 357751-366111 _na     2786_aa SIALI-17 repeat-containing surface protein
1454 JAKUWR010000004.1 GCA026782545_00885 CDS open 366279-368453 _na     724_aa pbp1a penicillin-binding protein PBP1A
1455 JAKUWR010000004.1 GCA026782545_00886 CDS open 368450-369046 _na     198_aa recU Holliday junction resolvase RecU
1456 JAKUWR010000004.1 GCA026782545_00887 CDS open 369113-369640 _na     175_aa DUF1273 domain-containing protein
1457 JAKUWR010000004.1 GCA026782545_00888 CDS open 369710-370036 _na     108_aa gpsB cell division regulator GpsB
1458 JAKUWR010000004.1 GCA026782545_00890 CDS open 370524-371681 _na     385_aa rlmL THUMP domain-containing protein
1459 JAKUWR010000004.1 GCA026782545_00891 CDS open 371694-373136 _na     480_aa Mid-cell-anchored protein Z
1460 JAKUWR010000004.1 GCA026782545_00892 CDS open 373212-374636 _na     474_aa gndA NADP-dependent phosphogluconate dehydrogenase
1461 JAKUWR010000004.1 GCA026782545_00893 CDS open 374648-375337 _na     229_aa arlR Response regulator ArlR
1462 JAKUWR010000004.1 GCA026782545_00894 CDS open 375437-376441 _na     334_aa cbpF Choline binding protein CbpF
1463 JAKUWR010000004.1 GCA026782545_00895 CDS open 376558-377436 _na     292_aa mvk mevalonate kinase
1464 JAKUWR010000004.1 GCA026782545_00896 CDS open 377418-378371 _na     317_aa mvaD diphosphomevalonate decarboxylase
1465 JAKUWR010000004.1 GCA026782545_00897 CDS open 378358-379365 _na     335_aa phosphomevalonate kinase
1466 JAKUWR010000004.1 GCA026782545_00898 CDS open 379349-380350 _na     333_aa fni type 2 isopentenyl-diphosphate Delta-isomerase
1467 JAKUWR010000004.1 GCA026782545_00899 CDS open 380517-381215 _na     232_aa liaF Cell wall-active antibiotics response LiaF-like C-terminal domain-containing protein
1468 JAKUWR010000004.1 GCA026782545_00900 CDS open 381212-382210 _na     332_aa Sensor histidine kinase
1469 JAKUWR010000004.1 GCA026782545_00901 CDS open 382220-382852 _na     210_aa citB Response regulator
1470 JAKUWR010000004.1 GCA026782545_00902 CDS open 382853-383509 _na     218_aa DNA alkylation repair enzyme
1471 JAKUWR010000004.1 GCA026782545_00903 CDS open 383600-384883 _na     427_aa tig trigger factor
1472 JAKUWR010000004.1 GCA026782545_00904 CDS open 384931-387300 _na     789_aa recD ATP-dependent RecD2 DNA helicase
1473 JAKUWR010000004.1 GCA026782545_00905 CDS open 387430-388044 _na     204_aa lepB signal peptidase I
1474 JAKUWR010000004.1 GCA026782545_00906 CDS open 388048-388929 _na     293_aa rnhC ribonuclease HIII
1475 JAKUWR010000004.1 GCA026782545_00907 CDS open 389016-389318 _na     100_aa zapA Cell division protein ZapA
1476 JAKUWR010000004.1 GCA026782545_00908 CDS open 389315-389863 _na     182_aa cvpA CvpA family protein
1477 JAKUWR010000004.1 GCA026782545_00909 CDS open 389977-392313 _na     778_aa mutS2 endonuclease MutS2
1478 JAKUWR010000004.1 GCA026782545_00910 CDS open 392660-393982 _na     440_aa alsT Amino acid carrier family protein
1479 JAKUWR010000004.1 GCA026782545_00911 CDS open 394114-394662 _na     182_aa yciW Carboxymuconolactone decarboxylase-like domain-containing protein
1480 JAKUWR010000004.1 GCA026782545_00912 CDS open 394774-395673 _na     299_aa tehA Exfoliative toxin A
1481 JAKUWR010000004.1 GCA026782545_00913 CDS open 395697-396971 _na     424_aa serS serine--tRNA ligase
1482 JAKUWR010000004.1 GCA026782545_00914 CDS open 397185-397556 _na     123_aa manO PTS mannose transporter accessory protein ManO
1483 JAKUWR010000004.1 GCA026782545_00915 CDS open 397559-398923 _na     454_aa metL1 aspartate kinase
1484 JAKUWR010000004.1 GCA026782545_00916 CDS open 399206-399991 _na     261_aa enoyl-CoA hydratase
1485 JAKUWR010000004.1 GCA026782545_00917 CDS open 400082-400516 _na     144_aa HTH marR-type domain-containing protein
1486 JAKUWR010000004.1 GCA026782545_00918 CDS open 400516-401490 _na     324_aa Beta-ketoacyl-[acyl-carrier-protein] synthase III
1487 JAKUWR010000004.1 GCA026782545_00919 CDS open 401547-401771 _na     74_aa acpP Acyl carrier protein
1488 JAKUWR010000004.1 GCA026782545_00920 CDS open 401889-402863 _na     324_aa fabK enoyl-[acyl-carrier-protein] reductase FabK
1489 JAKUWR010000004.1 GCA026782545_00921 CDS open 402856-403776 _na     306_aa fabD ACP S-malonyltransferase
1490 JAKUWR010000004.1 GCA026782545_00922 CDS open 403822-404553 _na     243_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
1491 JAKUWR010000004.1 GCA026782545_00923 CDS open 404582-405817 _na     411_aa fabF beta-ketoacyl-ACP synthase II
1492 JAKUWR010000004.1 GCA026782545_00924 CDS open 405820-406296 _na     158_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
1493 JAKUWR010000004.1 GCA026782545_00925 CDS open 406293-406715 _na     140_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
1494 JAKUWR010000004.1 GCA026782545_00926 CDS open 406727-408094 _na     455_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
1495 JAKUWR010000004.1 GCA026782545_00927 CDS open 408130-408996 _na     288_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
1496 JAKUWR010000004.1 GCA026782545_00928 CDS open 408993-409760 _na     255_aa acetyl-CoA carboxylase carboxyl transferase subunit alpha
1497 JAKUWR010000004.1 GCA026782545_00929 CDS open 409907-410608 _na     233_aa CPBP family intramembrane metalloprotease
1498 JAKUWR010000004.1 GCA026782545_00930 CDS open 410658-411080 _na     140_aa nusB transcription antitermination factor NusB
1499 JAKUWR010000004.1 GCA026782545_00931 CDS open 411073-411462 _na     129_aa yloU General stress protein%2C Gls24 family
1500 JAKUWR010000004.1 GCA026782545_00932 CDS open 411484-412044 _na     186_aa efp elongation factor P