BAKTAGenome Explorer: Neisseria mucosa (GCA_030216405.1)
Select a Genome:
|
BAKTA Annotations for GCA_030216405.1
|
Search & Sort all 4588 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | JASOLC010000041.1 | GCA030216405_01445 | gene | open | 12366-12734 | |||
| 3502 | JASOLC010000041.1 | GCA030216405_01446 | gene | open | 13077-13559 | yciA | ||
| 3503 | JASOLC010000041.1 | GCA030216405_01447 | gene | open | 13689-14765 | corA | ||
| 3504 | JASOLC010000041.1 | GCA030216405_01448 | gene | open | 14982-15377 | |||
| 3505 | JASOLC010000041.1 | GCA030216405_01449 | gene | open | 15524-16483 | dnaJ | ||
| 3506 | JASOLC010000041.1 | GCA030216405_01450 | gene | open | 16499-16795 | merR | ||
| 3507 | JASOLC010000041.1 | GCA030216405_01451 | gene | open | 16866-17285 | |||
| 3508 | JASOLC010000041.1 | GCA030216405_01452 | gene | open | 17474-18205 | hemD | ||
| 3509 | JASOLC010000041.1 | GCA030216405_01453 | gene | open | 18192-19706 | hemX | ||
| 3510 | JASOLC010000041.1 | GCA030216405_01454 | gene | open | 19703-20926 | hemYx | ||
| 3511 | JASOLC010000041.1 | GCA030216405_01455 | gene | open | 21047-22108 | hemE | ||
| 3512 | JASOLC010000041.1 | GCA030216405_01456 | gene | open | 22414-23907 | cls | ||
| 3513 | JASOLC010000041.1 | GCA030216405_01457 | gene | open | 24012-24935 | rluA | ||
| 3514 | JASOLC010000042.1 | GCA030216405_01458 | CDS | open | 150-1673 | _na 507_aa | cls | Phospholipase D domain protein |
| 3515 | JASOLC010000042.1 | GCA030216405_01459 | CDS | open | 1820-2824 | _na 334_aa | add | adenosine deaminase |
| 3516 | JASOLC010000042.1 | GCA030216405_01460 | CDS | open | 2842-3381 | _na 179_aa | Lipoprotein | |
| 3517 | JASOLC010000042.1 | GCA030216405_01461 | CDS | open | 3457-4467 | _na 336_aa | trpS | tryptophan--tRNA ligase |
| 3518 | JASOLC010000042.1 | GCA030216405_01462 | CDS | open | 4730-7303 | _na 857_aa | clpB | ATP-dependent chaperone ClpB |
| 3519 | JASOLC010000042.1 | GCA030216405_01463 | CDS | open | 7417-8325 | _na 302_aa | Dyp-type peroxidase family protein | |
| 3520 | JASOLC010000042.1 | GCA030216405_01464 | CDS | open | 8458-9543 | _na 361_aa | yaeI | Ser/Thr protein phosphatase |
| 3521 | JASOLC010000042.1 | GCA030216405_01465 | CDS | open | 9749-10345 | _na 198_aa | lemA | LemA family protein |
| 3522 | JASOLC010000042.1 | GCA030216405_01466 | CDS | open | 10472-10618 | _na 48_aa | CCGSCS motif protein | |
| 3523 | JASOLC010000042.1 | GCA030216405_01467 | CDS | open | 10810-11664 | _na 284_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 3524 | JASOLC010000042.1 | GCA030216405_01468 | CDS | open | 11776-12906 | _na 376_aa | mpaA | Peptidase M14 carboxypeptidase A domain-containing protein |
| 3525 | JASOLC010000042.1 | GCA030216405_01469 | CDS | open | 13215-14105 | _na 296_aa | argB | Acetylglutamate kinase |
| 3526 | JASOLC010000042.1 | GCA030216405_01470 | CDS | open | 14255-15763 | _na 502_aa | ppx | exopolyphosphatase |
| 3527 | JASOLC010000042.1 | GCA030216405_01471 | CDS | open | 16045-16674 | _na 209_aa | mltE | Transglycosylase |
| 3528 | JASOLC010000042.1 | GCA030216405_01472 | CDS | open | 16804-18186 | _na 460_aa | araJ | Major facilitator superfamily (MFS) profile domain-containing protein |
| 3529 | JASOLC010000042.1 | GCA030216405_01473 | CDS | open | 18190-18705 | _na 171_aa | ssb | Single-stranded DNA-binding protein |
| 3530 | JASOLC010000042.1 | GCA030216405_01474 | CDS | open | 18958-19152 | _na 64_aa | Inner membrane protein YgaP-like transmembrane domain-containing protein | |
| 3531 | JASOLC010000042.1 | GCA030216405_01475 | CDS | open | 19165-19686 | _na 173_aa | pspE | Rhodanese domain-containing protein |
| 3532 | JASOLC010000042.1 | GCA030216405_01476 | CDS | open | 19766-20068 | _na 100_aa | arsR | Transcriptional regulator%2C ArsR family |
| 3533 | JASOLC010000042.1 | GCA030216405_01477 | CDS | open | 20223-20564 | _na 113_aa | Lipoprotein | |
| 3534 | JASOLC010000042.1 | GCA030216405_01478 | CDS | open | 20884-21705 | _na 273_aa | hypothetical protein | |
| 3535 | JASOLC010000042.1 | GCA030216405_01479 | CDS | open | 22095-22421 | _na 108_aa | hypothetical protein | |
| 3536 | JASOLC010000042.1 | GCA030216405_01480 | CDS | open | 22414-24051 | _na 545_aa | Tetratricopeptide repeat protein | |
| 3537 | JASOLC010000042.1 | GCA030216405_01458 | gene | open | 150-1673 | cls | ||
| 3538 | JASOLC010000042.1 | GCA030216405_01459 | gene | open | 1820-2824 | add | ||
| 3539 | JASOLC010000042.1 | GCA030216405_01460 | gene | open | 2842-3381 | |||
| 3540 | JASOLC010000042.1 | GCA030216405_01461 | gene | open | 3457-4467 | trpS | ||
| 3541 | JASOLC010000042.1 | GCA030216405_01462 | gene | open | 4730-7303 | clpB | ||
| 3542 | JASOLC010000042.1 | GCA030216405_01463 | gene | open | 7417-8325 | |||
| 3543 | JASOLC010000042.1 | GCA030216405_01464 | gene | open | 8458-9543 | yaeI | ||
| 3544 | JASOLC010000042.1 | GCA030216405_01465 | gene | open | 9749-10345 | lemA | ||
| 3545 | JASOLC010000042.1 | GCA030216405_01466 | gene | open | 10472-10618 | |||
| 3546 | JASOLC010000042.1 | GCA030216405_01467 | gene | open | 10810-11664 | lgt | ||
| 3547 | JASOLC010000042.1 | GCA030216405_01468 | gene | open | 11776-12906 | mpaA | ||
| 3548 | JASOLC010000042.1 | GCA030216405_01469 | gene | open | 13215-14105 | argB | ||
| 3549 | JASOLC010000042.1 | GCA030216405_01470 | gene | open | 14255-15763 | ppx | ||
| 3550 | JASOLC010000042.1 | GCA030216405_01471 | gene | open | 16045-16674 | mltE | ||
| 3551 | JASOLC010000042.1 | GCA030216405_01472 | gene | open | 16804-18186 | araJ | ||
| 3552 | JASOLC010000042.1 | GCA030216405_01473 | gene | open | 18190-18705 | ssb | ||
| 3553 | JASOLC010000042.1 | GCA030216405_01474 | gene | open | 18958-19152 | |||
| 3554 | JASOLC010000042.1 | GCA030216405_01475 | gene | open | 19165-19686 | pspE | ||
| 3555 | JASOLC010000042.1 | GCA030216405_01476 | gene | open | 19766-20068 | arsR | ||
| 3556 | JASOLC010000042.1 | GCA030216405_01477 | gene | open | 20223-20564 | |||
| 3557 | JASOLC010000042.1 | GCA030216405_01478 | gene | open | 20884-21705 | |||
| 3558 | JASOLC010000042.1 | GCA030216405_01479 | gene | open | 22095-22421 | |||
| 3559 | JASOLC010000042.1 | GCA030216405_01480 | gene | open | 22414-24051 | |||
| 3560 | JASOLC010000043.1 | GCA030216405_01481 | CDS | open | 260-1120 | _na 286_aa | tehB | SAM-dependent methyltransferase TehB |
| 3561 | JASOLC010000043.1 | GCA030216405_01482 | CDS | open | 1253-1702 | _na 149_aa | rnhA | ribonuclease HI |
| 3562 | JASOLC010000043.1 | GCA030216405_01483 | CDS | open | 1760-3112 | _na 450_aa | dgt | deoxyguanosinetriphosphate triphosphohydrolase |
| 3563 | JASOLC010000043.1 | GCA030216405_01486 | CDS | open | 3637-4254 | _na 205_aa | yqfA | Channel protein%2C hemolysin III family |
| 3564 | JASOLC010000043.1 | GCA030216405_01487 | CDS | open | 4373-5266 | _na 297_aa | rhaT | Putative membrane protein |
| 3565 | JASOLC010000043.1 | GCA030216405_01488 | CDS | open | 5290-5649 | _na 119_aa | STAS/SEC14 domain-containing protein | |
| 3566 | JASOLC010000043.1 | GCA030216405_01489 | CDS | open | 5726-5950 | _na 74_aa | Branched-chain amino acid ABC transporter | |
| 3567 | JASOLC010000043.1 | GCA030216405_01490 | CDS | open | 6033-6236 | _na 67_aa | cspC | Cold-shock domain family protein |
| 3568 | JASOLC010000043.1 | GCA030216405_01491 | CDS | open | 6548-6859 | _na 103_aa | clpS | ATP-dependent Clp protease adapter ClpS |
| 3569 | JASOLC010000043.1 | GCA030216405_01492 | CDS | open | 6861-9146 | _na 761_aa | clpA | ATP-dependent Clp protease ATP-binding subunit ClpA |
| 3570 | JASOLC010000043.1 | GCA030216405_01493 | CDS | open | 9261-10682 | _na 473_aa | Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein | |
| 3571 | JASOLC010000043.1 | GCA030216405_01494 | CDS | open | 10970-11845 | _na 291_aa | znuB | ABC 3 transport family protein |
| 3572 | JASOLC010000043.1 | GCA030216405_01495 | CDS | open | 11953-12678 | _na 241_aa | znuC | ABC transporter%2C ATP-binding protein |
| 3573 | JASOLC010000043.1 | GCA030216405_01496 | CDS | open | 13201-14184 | _na 327_aa | ompC | Porin domain-containing protein |
| 3574 | JASOLC010000043.1 | GCA030216405_01497 | CDS | open | 14499-16124 | _na 541_aa | oppA | Oligopeptide ABC transporter substrate-binding protein OppA |
| 3575 | JASOLC010000043.1 | GCA030216405_01498 | CDS | open | 16220-18016 | _na 598_aa | pepP | Creatinase |
| 3576 | JASOLC010000043.1 | GCA030216405_01499 | CDS | open | 18487-19407 | _na 306_aa | oppB | oligopeptide ABC transporter permease OppB |
| 3577 | JASOLC010000043.1 | GCA030216405_01500 | CDS | open | 19481-20389 | _na 302_aa | oppC | oligopeptide ABC transporter permease OppC |
| 3578 | JASOLC010000043.1 | GCA030216405_01501 | CDS | open | 20412-22016 | _na 534_aa | cntF | staphylopine uptake ABC transporter ATP-binding protein CntF |
| 3579 | JASOLC010000043.1 | GCA030216405_01502 | CDS | open | 22452-22670 | _na 72_aa | Transposase | |
| 3580 | JASOLC010000043.1 | GCA030216405_01481 | gene | open | 260-1120 | tehB | ||
| 3581 | JASOLC010000043.1 | GCA030216405_01482 | gene | open | 1253-1702 | rnhA | ||
| 3582 | JASOLC010000043.1 | GCA030216405_01483 | gene | open | 1760-3112 | dgt | ||
| 3583 | JASOLC010000043.1 | GCA030216405_01486 | gene | open | 3637-4254 | yqfA | ||
| 3584 | JASOLC010000043.1 | GCA030216405_01487 | gene | open | 4373-5266 | rhaT | ||
| 3585 | JASOLC010000043.1 | GCA030216405_01488 | gene | open | 5290-5649 | |||
| 3586 | JASOLC010000043.1 | GCA030216405_01489 | gene | open | 5726-5950 | |||
| 3587 | JASOLC010000043.1 | GCA030216405_01490 | gene | open | 6033-6236 | cspC | ||
| 3588 | JASOLC010000043.1 | GCA030216405_01491 | gene | open | 6548-6859 | clpS | ||
| 3589 | JASOLC010000043.1 | GCA030216405_01492 | gene | open | 6861-9146 | clpA | ||
| 3590 | JASOLC010000043.1 | GCA030216405_01493 | gene | open | 9261-10682 | |||
| 3591 | JASOLC010000043.1 | GCA030216405_01494 | gene | open | 10970-11845 | znuB | ||
| 3592 | JASOLC010000043.1 | GCA030216405_01495 | gene | open | 11953-12678 | znuC | ||
| 3593 | JASOLC010000043.1 | GCA030216405_01496 | gene | open | 13201-14184 | ompC | ||
| 3594 | JASOLC010000043.1 | GCA030216405_01497 | gene | open | 14499-16124 | oppA | ||
| 3595 | JASOLC010000043.1 | GCA030216405_01498 | gene | open | 16220-18016 | pepP | ||
| 3596 | JASOLC010000043.1 | GCA030216405_01499 | gene | open | 18487-19407 | oppB | ||
| 3597 | JASOLC010000043.1 | GCA030216405_01500 | gene | open | 19481-20389 | oppC | ||
| 3598 | JASOLC010000043.1 | GCA030216405_01501 | gene | open | 20412-22016 | cntF | ||
| 3599 | JASOLC010000043.1 | GCA030216405_01502 | gene | open | 22452-22670 | |||
| 3600 | JASOLC010000043.1 | GCA030216405_01484 | gene | open | 3245-3321 | trnR | ||
| 3601 | JASOLC010000043.1 | GCA030216405_01485 | gene | open | 3340-3414 | trnE | ||
| 3602 | JASOLC010000043.1 | GCA030216405_01484 | tRNA | open | 3245-3321 | trnR | tRNA-Arg(acg) | |
| 3603 | JASOLC010000043.1 | GCA030216405_01485 | tRNA | open | 3340-3414 | trnE | tRNA-Glu(ttc) | |
| 3604 | JASOLC010000044.1 | GCA030216405_01522 | gene | open | 20805-20969 | nrrF | ||
| 3605 | JASOLC010000044.1 | GCA030216405_01522 | ncRNA | open | 20805-20969 | nrrF | NrrF RNA | |
| 3606 | JASOLC010000044.1 | GCA030216405_01503 | CDS | open | 243-593 | _na 116_aa | Transposase | |
| 3607 | JASOLC010000044.1 | GCA030216405_01504 | CDS | open | 738-1601 | _na 287_aa | prmC | peptide chain release factor N(5)-glutamine methyltransferase |
| 3608 | JASOLC010000044.1 | GCA030216405_01506 | CDS | open | 2293-2652 | _na 119_aa | Roadblock/LAMTOR2 domain-containing protein | |
| 3609 | JASOLC010000044.1 | GCA030216405_01507 | CDS | open | 2690-3331 | _na 213_aa | Peptidase M23 | |
| 3610 | JASOLC010000044.1 | GCA030216405_01508 | CDS | open | 3337-3873 | _na 178_aa | srp102 | ATP-binding protein |
| 3611 | JASOLC010000044.1 | GCA030216405_01509 | CDS | open | 3886-4977 | _na 363_aa | Response regulator receiver domain protein | |
| 3612 | JASOLC010000044.1 | GCA030216405_01510 | CDS | open | 5002-6447 | _na 481_aa | 23S rRNA methyltransferase | |
| 3613 | JASOLC010000044.1 | GCA030216405_01511 | CDS | open | 6599-7945 | _na 448_aa | rlmD | 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD |
| 3614 | JASOLC010000044.1 | GCA030216405_01512 | CDS | open | 8072-9070 | _na 332_aa | erfK | L%2CD-TPase catalytic domain-containing protein |
| 3615 | JASOLC010000044.1 | GCA030216405_01513 | CDS | open | 9354-10397 | _na 347_aa | argC | N-acetyl-gamma-glutamyl-phosphate reductase |
| 3616 | JASOLC010000044.1 | GCA030216405_01514 | CDS | open | 10495-11574 | _na 359_aa | aroB | 3-dehydroquinate synthase |
| 3617 | JASOLC010000044.1 | GCA030216405_01515 | CDS | open | 11770-12306 | _na 178_aa | aroK | Shikimate kinase |
| 3618 | JASOLC010000044.1 | GCA030216405_01516 | CDS | open | 12736-14871 | _na 711_aa | pilQ | Type IV pilus biogenesis and competence protein PilQ |
| 3619 | JASOLC010000044.1 | GCA030216405_01517 | CDS | open | 14890-15444 | _na 184_aa | pilP | Pilus assembly protein PilP |
| 3620 | JASOLC010000044.1 | GCA030216405_01518 | CDS | open | 15459-16148 | _na 229_aa | pilO | Type 4a pilus biogenesis protein PilO |
| 3621 | JASOLC010000044.1 | GCA030216405_01519 | CDS | open | 16149-16763 | _na 204_aa | pilN | Fimbrial assembly protein PilN |
| 3622 | JASOLC010000044.1 | GCA030216405_01520 | CDS | open | 16765-17874 | _na 369_aa | pilM | Type IV pilus assembly protein PilM |
| 3623 | JASOLC010000044.1 | GCA030216405_01521 | CDS | open | 18021-20420 | _na 799_aa | mrcA | Penicillin-binding protein 1A |
| 3624 | JASOLC010000044.1 | GCA030216405_01503 | gene | open | 243-593 | |||
| 3625 | JASOLC010000044.1 | GCA030216405_01504 | gene | open | 738-1601 | prmC | ||
| 3626 | JASOLC010000044.1 | GCA030216405_01506 | gene | open | 2293-2652 | |||
| 3627 | JASOLC010000044.1 | GCA030216405_01507 | gene | open | 2690-3331 | |||
| 3628 | JASOLC010000044.1 | GCA030216405_01508 | gene | open | 3337-3873 | srp102 | ||
| 3629 | JASOLC010000044.1 | GCA030216405_01509 | gene | open | 3886-4977 | |||
| 3630 | JASOLC010000044.1 | GCA030216405_01510 | gene | open | 5002-6447 | |||
| 3631 | JASOLC010000044.1 | GCA030216405_01511 | gene | open | 6599-7945 | rlmD | ||
| 3632 | JASOLC010000044.1 | GCA030216405_01512 | gene | open | 8072-9070 | erfK | ||
| 3633 | JASOLC010000044.1 | GCA030216405_01513 | gene | open | 9354-10397 | argC | ||
| 3634 | JASOLC010000044.1 | GCA030216405_01514 | gene | open | 10495-11574 | aroB | ||
| 3635 | JASOLC010000044.1 | GCA030216405_01515 | gene | open | 11770-12306 | aroK | ||
| 3636 | JASOLC010000044.1 | GCA030216405_01516 | gene | open | 12736-14871 | pilQ | ||
| 3637 | JASOLC010000044.1 | GCA030216405_01517 | gene | open | 14890-15444 | pilP | ||
| 3638 | JASOLC010000044.1 | GCA030216405_01518 | gene | open | 15459-16148 | pilO | ||
| 3639 | JASOLC010000044.1 | GCA030216405_01519 | gene | open | 16149-16763 | pilN | ||
| 3640 | JASOLC010000044.1 | GCA030216405_01520 | gene | open | 16765-17874 | pilM | ||
| 3641 | JASOLC010000044.1 | GCA030216405_01521 | gene | open | 18021-20420 | mrcA | ||
| 3642 | JASOLC010000044.1 | GCA030216405_01505 | gene | open | 2121-2196 | trnN | ||
| 3643 | JASOLC010000044.1 | GCA030216405_01505 | tRNA | open | 2121-2196 | trnN | tRNA-Asn(gtt) | |
| 3644 | JASOLC010000045.1 | GCA030216405_01524 | gene | open | 4558-4654 | Bacteria_small_SRP | ||
| 3645 | JASOLC010000045.1 | GCA030216405_01524 | ncRNA | open | 4558-4654 | Bacterial small signal recognition particle RNA | ||
| 3646 | JASOLC010000045.1 | GCA030216405_01523 | CDS | open | 391-4224 | _na 1277_aa | glcD | FAD-linked oxidase |
| 3647 | JASOLC010000045.1 | GCA030216405_01525 | CDS | open | 4768-6093 | _na 441_aa | araJ | MFS transporter |
| 3648 | JASOLC010000045.1 | GCA030216405_01526 | CDS | open | 6639-8330 | _na 563_aa | dld | D-lactate dehydrogenase |
| 3649 | JASOLC010000045.1 | GCA030216405_01527 | CDS | open | 8595-9143 | _na 182_aa | Peroxidase-like protein | |
| 3650 | JASOLC010000045.1 | GCA030216405_01528 | CDS | open | 9298-10386 | _na 362_aa | caiA | Acyl-CoA dehydrogenase family protein |
| 3651 | JASOLC010000045.1 | GCA030216405_01529 | CDS | open | 10472-10642 | _na 56_aa | norV | Rubredoxin |
| 3652 | JASOLC010000045.1 | GCA030216405_01532 | CDS | open | 11318-12097 | _na 259_aa | yaaA | peroxide stress protein YaaA |
| 3653 | JASOLC010000045.1 | GCA030216405_01533 | CDS | open | 12257-14269 | _na 670_aa | Arylsulfatase | |
| 3654 | JASOLC010000045.1 | GCA030216405_01534 | CDS | open | 14669-16648 | _na 659_aa | tkt | transketolase |
| 3655 | JASOLC010000045.1 | GCA030216405_01535 | CDS | open | 17165-18676 | _na 503_aa | ccoG | cytochrome c oxidase accessory protein CcoG |
| 3656 | JASOLC010000045.1 | GCA030216405_01536 | CDS | open | 18680-19249 | _na 189_aa | ccoH | FixH |
| 3657 | JASOLC010000045.1 | GCA030216405_01537 | CDS | open | 19590-20135 | _na 181_aa | Type IV secretion protein Rhs | |
| 3658 | JASOLC010000045.1 | GCA030216405_01538 | CDS | open | 20237-20797 | _na 186_aa | pgsA | CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase |
| 3659 | JASOLC010000045.1 | GCA030216405_01523 | gene | open | 391-4224 | glcD | ||
| 3660 | JASOLC010000045.1 | GCA030216405_01525 | gene | open | 4768-6093 | araJ | ||
| 3661 | JASOLC010000045.1 | GCA030216405_01526 | gene | open | 6639-8330 | dld | ||
| 3662 | JASOLC010000045.1 | GCA030216405_01527 | gene | open | 8595-9143 | |||
| 3663 | JASOLC010000045.1 | GCA030216405_01528 | gene | open | 9298-10386 | caiA | ||
| 3664 | JASOLC010000045.1 | GCA030216405_01529 | gene | open | 10472-10642 | norV | ||
| 3665 | JASOLC010000045.1 | GCA030216405_01532 | gene | open | 11318-12097 | yaaA | ||
| 3666 | JASOLC010000045.1 | GCA030216405_01533 | gene | open | 12257-14269 | |||
| 3667 | JASOLC010000045.1 | GCA030216405_01534 | gene | open | 14669-16648 | tkt | ||
| 3668 | JASOLC010000045.1 | GCA030216405_01535 | gene | open | 17165-18676 | ccoG | ||
| 3669 | JASOLC010000045.1 | GCA030216405_01536 | gene | open | 18680-19249 | ccoH | ||
| 3670 | JASOLC010000045.1 | GCA030216405_01537 | gene | open | 19590-20135 | |||
| 3671 | JASOLC010000045.1 | GCA030216405_01538 | gene | open | 20237-20797 | pgsA | ||
| 3672 | JASOLC010000045.1 | GCA030216405_01530 | gene | open | 10976-11065 | trnS | ||
| 3673 | JASOLC010000045.1 | GCA030216405_01531 | gene | open | 11147-11237 | trnS | ||
| 3674 | JASOLC010000045.1 | GCA030216405_01539 | gene | open | 20884-20959 | trnG | ||
| 3675 | JASOLC010000045.1 | GCA030216405_01540 | gene | open | 20998-21073 | trnG | ||
| 3676 | JASOLC010000045.1 | GCA030216405_01541 | gene | open | 21100-21172 | trnG | ||
| 3677 | JASOLC010000045.1 | GCA030216405_01530 | tRNA | open | 10976-11065 | trnS | tRNA-Ser(cga) | |
| 3678 | JASOLC010000045.1 | GCA030216405_01531 | tRNA | open | 11147-11237 | trnS | tRNA-Ser(tga) | |
| 3679 | JASOLC010000045.1 | GCA030216405_01539 | tRNA | open | 20884-20959 | trnG | tRNA-Gly(gcc) | |
| 3680 | JASOLC010000045.1 | GCA030216405_01540 | tRNA | open | 20998-21073 | trnG | tRNA-Gly(gcc) | |
| 3681 | JASOLC010000045.1 | GCA030216405_01541 | tRNA | open | 21100-21172 | trnG | tRNA-Gly(gcc) | |
| 3682 | JASOLC010000046.1 | repeat_region | open | 20500-20939 | CRISPR array with 7 repeats of length 32%2C consensus sequence CCAGCCGCCTTCAGGCGGCTGTGTGTTGAAAC and spacer length 34 | |||
| 3683 | JASOLC010000046.1 | GCA030216405_01542 | CDS | open | 121-1062 | _na 313_aa | tehA | dicarboxylate transporter/tellurite-resistance protein TehA |
| 3684 | JASOLC010000046.1 | GCA030216405_01543 | CDS | open | 1288-2193 | _na 301_aa | lysR | LysR substrate binding domain protein |
| 3685 | JASOLC010000046.1 | GCA030216405_01544 | CDS | open | 2212-2850 | _na 212_aa | RloB-like protein | |
| 3686 | JASOLC010000046.1 | GCA030216405_01545 | CDS | open | 2853-4172 | _na 439_aa | ATPase AAA-type core domain-containing protein | |
| 3687 | JASOLC010000046.1 | GCA030216405_01546 | CDS | open | 4437-5582 | _na 381_aa | Xaa-Pro dipeptidyl-peptidase-like domain-containing protein | |
| 3688 | JASOLC010000046.1 | GCA030216405_01547 | CDS | open | 5718-6467 | _na 249_aa | ubiE | Demethylmenaquinone methyltransferase |
| 3689 | JASOLC010000046.1 | GCA030216405_01548 | CDS | open | 6702-6950 | _na 82_aa | csbD | CsbD family protein |
| 3690 | JASOLC010000046.1 | GCA030216405_01549 | CDS | open | 7079-8608 | _na 509_aa | osmF | ABC transporter%2C substrate-binding protein%2C QAT family |
| 3691 | JASOLC010000046.1 | GCA030216405_01550 | CDS | open | 8687-8896 | _na 69_aa | HMA domain-containing protein | |
| 3692 | JASOLC010000046.1 | GCA030216405_01551 | CDS | open | 9451-11733 | _na 760_aa | CRISPR-associated helicase/endonuclease Cas3 | |
| 3693 | JASOLC010000046.1 | GCA030216405_01552 | CDS | open | 11805-13634 | _na 609_aa | ATP-dependent endonuclease | |
| 3694 | JASOLC010000046.1 | GCA030216405_01553 | CDS | open | 13708-14382 | _na 224_aa | cas5c | type I-C CRISPR-associated protein Cas5c |
| 3695 | JASOLC010000046.1 | GCA030216405_01554 | CDS | open | 14379-16157 | _na 592_aa | cas8c | type I-C CRISPR-associated protein Cas8c/Csd1 |
| 3696 | JASOLC010000046.1 | GCA030216405_01555 | CDS | open | 16169-17035 | _na 288_aa | cas7c | type I-C CRISPR-associated protein Cas7/Csd2 |
| 3697 | JASOLC010000046.1 | GCA030216405_01556 | CDS | open | 17050-17700 | _na 216_aa | cas4 | CRISPR-associated protein Cas4 |
| 3698 | JASOLC010000046.1 | GCA030216405_01557 | CDS | open | 17720-18835 | _na 371_aa | DUF4263 domain-containing protein | |
| 3699 | JASOLC010000046.1 | GCA030216405_01558 | CDS | open | 18929-19942 | _na 337_aa | cas1c | type I-C CRISPR-associated endonuclease Cas1c |
| 3700 | JASOLC010000046.1 | GCA030216405_01559 | CDS | open | 20017-20310 | _na 97_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3701 | JASOLC010000046.1 | GCA030216405_01542 | gene | open | 121-1062 | tehA | ||
| 3702 | JASOLC010000046.1 | GCA030216405_01543 | gene | open | 1288-2193 | lysR | ||
| 3703 | JASOLC010000046.1 | GCA030216405_01544 | gene | open | 2212-2850 | |||
| 3704 | JASOLC010000046.1 | GCA030216405_01545 | gene | open | 2853-4172 | |||
| 3705 | JASOLC010000046.1 | GCA030216405_01546 | gene | open | 4437-5582 | |||
| 3706 | JASOLC010000046.1 | GCA030216405_01547 | gene | open | 5718-6467 | ubiE | ||
| 3707 | JASOLC010000046.1 | GCA030216405_01548 | gene | open | 6702-6950 | csbD | ||
| 3708 | JASOLC010000046.1 | GCA030216405_01549 | gene | open | 7079-8608 | osmF | ||
| 3709 | JASOLC010000046.1 | GCA030216405_01550 | gene | open | 8687-8896 | |||
| 3710 | JASOLC010000046.1 | GCA030216405_01551 | gene | open | 9451-11733 | |||
| 3711 | JASOLC010000046.1 | GCA030216405_01552 | gene | open | 11805-13634 | |||
| 3712 | JASOLC010000046.1 | GCA030216405_01553 | gene | open | 13708-14382 | cas5c | ||
| 3713 | JASOLC010000046.1 | GCA030216405_01554 | gene | open | 14379-16157 | cas8c | ||
| 3714 | JASOLC010000046.1 | GCA030216405_01555 | gene | open | 16169-17035 | cas7c | ||
| 3715 | JASOLC010000046.1 | GCA030216405_01556 | gene | open | 17050-17700 | cas4 | ||
| 3716 | JASOLC010000046.1 | GCA030216405_01557 | gene | open | 17720-18835 | |||
| 3717 | JASOLC010000046.1 | GCA030216405_01558 | gene | open | 18929-19942 | cas1c | ||
| 3718 | JASOLC010000046.1 | GCA030216405_01559 | gene | open | 20017-20310 | cas2 | ||
| 3719 | JASOLC010000047.1 | GCA030216405_01560 | CDS | open | 161-997 | _na 278_aa | cysT | sulfate ABC transporter permease subunit CysT |
| 3720 | JASOLC010000047.1 | GCA030216405_01561 | CDS | open | 1232-1705 | _na 157_aa | rIC | Putative iron-sulfur cluster repair di-iron protein |
| 3721 | JASOLC010000047.1 | GCA030216405_01562 | CDS | open | 1806-2300 | _na 164_aa | nemA | NemA protein |
| 3722 | JASOLC010000047.1 | GCA030216405_01564 | CDS | open | 2661-3311 | _na 216_aa | nfsB | oxygen-insensitive NAD(P)H nitroreductase |
| 3723 | JASOLC010000047.1 | GCA030216405_01565 | CDS | open | 3447-3806 | _na 119_aa | DUF2069 domain-containing protein | |
| 3724 | JASOLC010000047.1 | GCA030216405_01566 | CDS | open | 3806-5647 | _na 613_aa | rfaL | O-antigen ligase C-terminal domain-containing protein |
| 3725 | JASOLC010000047.1 | GCA030216405_01567 | CDS | open | 5987-9214 | _na 1075_aa | recC | exodeoxyribonuclease V subunit gamma |
| 3726 | JASOLC010000047.1 | GCA030216405_01568 | CDS | open | 9820-12582 | _na 920_aa | cirA | TonB-dependent receptor |
| 3727 | JASOLC010000047.1 | GCA030216405_01569 | CDS | open | 12756-12995 | _na 79_aa | hlx | Hemolysin |
| 3728 | JASOLC010000047.1 | GCA030216405_01570 | CDS | open | 13093-13860 | _na 255_aa | bepA | Peptidase%2C M48 family |
| 3729 | JASOLC010000047.1 | GCA030216405_01571 | CDS | open | 13990-14922 | _na 310_aa | pbpG | D-alanyl-D-alanine endopeptidase PbpG |
| 3730 | JASOLC010000047.1 | GCA030216405_01572 | CDS | open | 15252-16520 | _na 422_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 3731 | JASOLC010000047.1 | GCA030216405_01573 | CDS | open | 16760-19345 | _na 861_aa | acnB | bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase |
| 3732 | JASOLC010000047.1 | GCA030216405_01574 | CDS | open | 19488-20360 | _na 290_aa | aroGA | 3-deoxy-7-phosphoheptulonate synthase |
| 3733 | JASOLC010000047.1 | GCA030216405_01560 | gene | open | 161-997 | cysT | ||
| 3734 | JASOLC010000047.1 | GCA030216405_01561 | gene | open | 1232-1705 | rIC | ||
| 3735 | JASOLC010000047.1 | GCA030216405_01562 | gene | open | 1806-2300 | nemA | ||
| 3736 | JASOLC010000047.1 | GCA030216405_01564 | gene | open | 2661-3311 | nfsB | ||
| 3737 | JASOLC010000047.1 | GCA030216405_01565 | gene | open | 3447-3806 | |||
| 3738 | JASOLC010000047.1 | GCA030216405_01566 | gene | open | 3806-5647 | rfaL | ||
| 3739 | JASOLC010000047.1 | GCA030216405_01567 | gene | open | 5987-9214 | recC | ||
| 3740 | JASOLC010000047.1 | GCA030216405_01568 | gene | open | 9820-12582 | cirA | ||
| 3741 | JASOLC010000047.1 | GCA030216405_01569 | gene | open | 12756-12995 | hlx | ||
| 3742 | JASOLC010000047.1 | GCA030216405_01570 | gene | open | 13093-13860 | bepA | ||
| 3743 | JASOLC010000047.1 | GCA030216405_01571 | gene | open | 13990-14922 | pbpG | ||
| 3744 | JASOLC010000047.1 | GCA030216405_01572 | gene | open | 15252-16520 | clpX | ||
| 3745 | JASOLC010000047.1 | GCA030216405_01573 | gene | open | 16760-19345 | acnB | ||
| 3746 | JASOLC010000047.1 | GCA030216405_01574 | gene | open | 19488-20360 | aroGA | ||
| 3747 | JASOLC010000047.1 | GCA030216405_01563 | gene | open | 2412-2487 | trnN | ||
| 3748 | JASOLC010000047.1 | GCA030216405_01563 | tRNA | open | 2412-2487 | trnN | tRNA-Asn(gtt) | |
| 3749 | JASOLC010000048.1 | GCA030216405_01589 | gene | open | 17302-17664 | ssrA | ||
| 3750 | JASOLC010000048.1 | GCA030216405_01589 | tmRNA | open | 17302-17664 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3751 | JASOLC010000048.1 | GCA030216405_01575 | CDS | open | 219-1772 | _na 517_aa | ydgA | DUF945 domain-containing protein |
| 3752 | JASOLC010000048.1 | GCA030216405_01576 | CDS | open | 2060-3469 | _na 469_aa | araJ | Major facilitator family transporter HsrA |
| 3753 | JASOLC010000048.1 | GCA030216405_01577 | CDS | open | 3897-4676 | _na 259_aa | glpC | Cysteine-rich domain-containing protein |
| 3754 | JASOLC010000048.1 | GCA030216405_01578 | CDS | open | 4673-5374 | _na 233_aa | lutC | putative protein NMB1437 |
| 3755 | JASOLC010000048.1 | GCA030216405_01579 | CDS | open | 5371-6825 | _na 484_aa | lutB | LutB/LldF family L-lactate oxidation iron-sulfur protein |
| 3756 | JASOLC010000048.1 | GCA030216405_01580 | CDS | open | 7130-8989 | _na 619_aa | ilvD | dihydroxy-acid dehydratase |
| 3757 | JASOLC010000048.1 | GCA030216405_01581 | CDS | open | 9241-9720 | _na 159_aa | ispF | 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase |
| 3758 | JASOLC010000048.1 | GCA030216405_01582 | CDS | open | 9791-10462 | _na 223_aa | rpiA | ribose-5-phosphate isomerase RpiA |
| 3759 | JASOLC010000048.1 | GCA030216405_01583 | CDS | open | 10547-11254 | _na 235_aa | yncB | Nuclease-like protein |
| 3760 | JASOLC010000048.1 | GCA030216405_01584 | CDS | open | 11323-13158 | _na 611_aa | uvrC | excinuclease ABC subunit UvrC |
| 3761 | JASOLC010000048.1 | GCA030216405_01585 | CDS | open | 13297-13617 | _na 106_aa | Stress response protein | |
| 3762 | JASOLC010000048.1 | GCA030216405_01586 | CDS | open | 13922-14605 | _na 227_aa | rsuA | Pseudouridine synthase |
| 3763 | JASOLC010000048.1 | GCA030216405_01587 | CDS | open | 14646-15764 | _na 372_aa | hemK | Ribosomal protein L11 methyltransferase-like protein |
| 3764 | JASOLC010000048.1 | GCA030216405_01588 | CDS | open | 15972-17186 | _na 404_aa | aspB | Putative 8-amino-7-oxononanoate synthase |
| 3765 | JASOLC010000048.1 | GCA030216405_01590 | CDS | open | 17672-18850 | _na 392_aa | Integrase | |
| 3766 | JASOLC010000048.1 | GCA030216405_01591 | CDS | open | 18820-19008 | _na 62_aa | Excisionase | |
| 3767 | JASOLC010000048.1 | GCA030216405_01575 | gene | open | 219-1772 | ydgA | ||
| 3768 | JASOLC010000048.1 | GCA030216405_01576 | gene | open | 2060-3469 | araJ | ||
| 3769 | JASOLC010000048.1 | GCA030216405_01577 | gene | open | 3897-4676 | glpC | ||
| 3770 | JASOLC010000048.1 | GCA030216405_01578 | gene | open | 4673-5374 | lutC | ||
| 3771 | JASOLC010000048.1 | GCA030216405_01579 | gene | open | 5371-6825 | lutB | ||
| 3772 | JASOLC010000048.1 | GCA030216405_01580 | gene | open | 7130-8989 | ilvD | ||
| 3773 | JASOLC010000048.1 | GCA030216405_01581 | gene | open | 9241-9720 | ispF | ||
| 3774 | JASOLC010000048.1 | GCA030216405_01582 | gene | open | 9791-10462 | rpiA | ||
| 3775 | JASOLC010000048.1 | GCA030216405_01583 | gene | open | 10547-11254 | yncB | ||
| 3776 | JASOLC010000048.1 | GCA030216405_01584 | gene | open | 11323-13158 | uvrC | ||
| 3777 | JASOLC010000048.1 | GCA030216405_01585 | gene | open | 13297-13617 | |||
| 3778 | JASOLC010000048.1 | GCA030216405_01586 | gene | open | 13922-14605 | rsuA | ||
| 3779 | JASOLC010000048.1 | GCA030216405_01587 | gene | open | 14646-15764 | hemK | ||
| 3780 | JASOLC010000048.1 | GCA030216405_01588 | gene | open | 15972-17186 | aspB | ||
| 3781 | JASOLC010000048.1 | GCA030216405_01590 | gene | open | 17672-18850 | |||
| 3782 | JASOLC010000048.1 | GCA030216405_01591 | gene | open | 18820-19008 | |||
| 3783 | JASOLC010000049.1 | GCA030216405_01592 | CDS | open | 218-3136 | _na 972_aa | infB | translation initiation factor IF-2 |
| 3784 | JASOLC010000049.1 | GCA030216405_01593 | CDS | open | 3136-4638 | _na 500_aa | nusA | Transcription termination/antitermination protein NusA |
| 3785 | JASOLC010000049.1 | GCA030216405_01594 | CDS | open | 4664-5095 | _na 143_aa | rimP | ribosome maturation factor RimP |
| 3786 | JASOLC010000049.1 | GCA030216405_01595 | CDS | open | 5451-6557 | _na 368_aa | serC | phosphoserine transaminase |
| 3787 | JASOLC010000049.1 | GCA030216405_01596 | CDS | open | 6788-7345 | _na 185_aa | nfnB | Putative NAD(P)H nitroreductase |
| 3788 | JASOLC010000049.1 | GCA030216405_01597 | CDS | open | 7506-8282 | _na 258_aa | glpR | Glycerol-3-phosphate regulon repressor |
| 3789 | JASOLC010000049.1 | GCA030216405_01598 | CDS | open | 8392-10080 | _na 562_aa | glnS | glutamine--tRNA ligase/YqeY domain fusion protein |
| 3790 | JASOLC010000049.1 | GCA030216405_01599 | CDS | open | 10155-10409 | _na 84_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 3791 | JASOLC010000049.1 | GCA030216405_01600 | CDS | open | 10556-10999 | _na 147_aa | gpG | phage virion morphogenesis protein |
| 3792 | JASOLC010000049.1 | GCA030216405_01601 | CDS | open | 11002-11904 | _na 300_aa | Phage head morphogenesis protein | |
| 3793 | JASOLC010000049.1 | GCA030216405_01602 | CDS | open | 11901-13370 | _na 489_aa | gp29 | Phage-associated protein%2C HI1409 family |
| 3794 | JASOLC010000049.1 | GCA030216405_01603 | CDS | open | 13392-14906 | _na 504_aa | terminase large subunit | |
| 3795 | JASOLC010000049.1 | GCA030216405_01604 | CDS | open | 14903-15448 | _na 181_aa | DUF3486 domain-containing protein | |
| 3796 | JASOLC010000049.1 | GCA030216405_01605 | CDS | open | 15450-15767 | _na 105_aa | Phage associated protein | |
| 3797 | JASOLC010000049.1 | GCA030216405_01606 | CDS | open | 15764-16084 | _na 106_aa | Phage associated protein | |
| 3798 | JASOLC010000049.1 | GCA030216405_01607 | CDS | open | 16087-16296 | _na 69_aa | traR | Phage/conjugal plasmid C-4 type zinc finger protein%2C TraR family |
| 3799 | JASOLC010000049.1 | GCA030216405_01608 | CDS | open | 16289-16510 | _na 73_aa | Phage associated protein | |
| 3800 | JASOLC010000049.1 | GCA030216405_01609 | CDS | open | 16488-16877 | _na 129_aa | Phage associated protein | |
| 3801 | JASOLC010000049.1 | GCA030216405_01610 | CDS | open | 16870-17136 | _na 88_aa | Phage protein | |
| 3802 | JASOLC010000049.1 | GCA030216405_01611 | CDS | open | 17133-17303 | _na 56_aa | hypothetical protein | |
| 3803 | JASOLC010000049.1 | GCA030216405_01612 | CDS | open | 17317-17820 | _na 167_aa | zliS | Glycoside hydrolase family 108 protein |
| 3804 | JASOLC010000049.1 | GCA030216405_01613 | CDS | open | 17910-18395 | _na 161_aa | Integral membrane protein | |
| 3805 | JASOLC010000049.1 | GCA030216405_01592 | gene | open | 218-3136 | infB | ||
| 3806 | JASOLC010000049.1 | GCA030216405_01593 | gene | open | 3136-4638 | nusA | ||
| 3807 | JASOLC010000049.1 | GCA030216405_01594 | gene | open | 4664-5095 | rimP | ||
| 3808 | JASOLC010000049.1 | GCA030216405_01595 | gene | open | 5451-6557 | serC | ||
| 3809 | JASOLC010000049.1 | GCA030216405_01596 | gene | open | 6788-7345 | nfnB | ||
| 3810 | JASOLC010000049.1 | GCA030216405_01597 | gene | open | 7506-8282 | glpR | ||
| 3811 | JASOLC010000049.1 | GCA030216405_01598 | gene | open | 8392-10080 | glnS | ||
| 3812 | JASOLC010000049.1 | GCA030216405_01599 | gene | open | 10155-10409 | |||
| 3813 | JASOLC010000049.1 | GCA030216405_01600 | gene | open | 10556-10999 | gpG | ||
| 3814 | JASOLC010000049.1 | GCA030216405_01601 | gene | open | 11002-11904 | |||
| 3815 | JASOLC010000049.1 | GCA030216405_01602 | gene | open | 11901-13370 | gp29 | ||
| 3816 | JASOLC010000049.1 | GCA030216405_01603 | gene | open | 13392-14906 | |||
| 3817 | JASOLC010000049.1 | GCA030216405_01604 | gene | open | 14903-15448 | |||
| 3818 | JASOLC010000049.1 | GCA030216405_01605 | gene | open | 15450-15767 | |||
| 3819 | JASOLC010000049.1 | GCA030216405_01606 | gene | open | 15764-16084 | |||
| 3820 | JASOLC010000049.1 | GCA030216405_01607 | gene | open | 16087-16296 | traR | ||
| 3821 | JASOLC010000049.1 | GCA030216405_01608 | gene | open | 16289-16510 | |||
| 3822 | JASOLC010000049.1 | GCA030216405_01609 | gene | open | 16488-16877 | |||
| 3823 | JASOLC010000049.1 | GCA030216405_01610 | gene | open | 16870-17136 | |||
| 3824 | JASOLC010000049.1 | GCA030216405_01611 | gene | open | 17133-17303 | |||
| 3825 | JASOLC010000049.1 | GCA030216405_01612 | gene | open | 17317-17820 | zliS | ||
| 3826 | JASOLC010000049.1 | GCA030216405_01613 | gene | open | 17910-18395 | |||
| 3827 | JASOLC010000050.1 | GCA030216405_01673 | CDS | open | 161-967 | _na 268_aa | Phosphoribosylglycinamide formyltransferase | |
| 3828 | JASOLC010000050.1 | GCA030216405_01674 | CDS | open | 1067-1561 | _na 164_aa | GIY-YIG nuclease family protein | |
| 3829 | JASOLC010000050.1 | GCA030216405_01675 | CDS | open | 1697-2257 | _na 186_aa | rsuA | Pseudouridine synthase |
| 3830 | JASOLC010000050.1 | GCA030216405_01677 | CDS | open | 2772-4619 | _na 615_aa | mltE | Transglycosylase SLT domain protein |
| 3831 | JASOLC010000050.1 | GCA030216405_01678 | CDS | open | 4790-5350 | _na 186_aa | apt | adenine phosphoribosyltransferase |
| 3832 | JASOLC010000050.1 | GCA030216405_01679 | CDS | open | 5503-6120 | _na 205_aa | gmk | guanylate kinase |
| 3833 | JASOLC010000050.1 | GCA030216405_01680 | CDS | open | 6178-6384 | _na 68_aa | rpoZ | DNA-directed RNA polymerase subunit omega |
| 3834 | JASOLC010000050.1 | GCA030216405_01681 | CDS | open | 6495-8651 | _na 718_aa | spoT | Guanosine 3'%2C5'-bis(Diphosphate) 3'-pyrophosphohydrolase |
| 3835 | JASOLC010000050.1 | GCA030216405_01682 | CDS | open | 8753-9733 | _na 326_aa | phoH | PhoH-like protein |
| 3836 | JASOLC010000050.1 | GCA030216405_01683 | CDS | open | 9802-11475 | _na 557_aa | menE | Long-chain-fatty-acid--CoA ligase |
| 3837 | JASOLC010000050.1 | GCA030216405_01684 | CDS | open | 11581-12684 | _na 367_aa | mnmA | tRNA 2-thiouridine(34) synthase MnmA |
| 3838 | JASOLC010000050.1 | GCA030216405_01685 | CDS | open | 12886-13365 | _na 159_aa | Copper chaperone PCu(A)C | |
| 3839 | JASOLC010000050.1 | GCA030216405_01686 | CDS | open | 13561-13953 | _na 130_aa | dgkA | Diacylglycerol kinase |
| 3840 | JASOLC010000050.1 | GCA030216405_01687 | CDS | open | 14261-15217 | _na 318_aa | gshB | glutathione synthase |
| 3841 | JASOLC010000050.1 | GCA030216405_01688 | CDS | open | 15368-17029 | _na 553_aa | recN | DNA repair protein RecN |
| 3842 | JASOLC010000050.1 | GCA030216405_01673 | gene | open | 161-967 | |||
| 3843 | JASOLC010000050.1 | GCA030216405_01674 | gene | open | 1067-1561 | |||
| 3844 | JASOLC010000050.1 | GCA030216405_01675 | gene | open | 1697-2257 | rsuA | ||
| 3845 | JASOLC010000050.1 | GCA030216405_01677 | gene | open | 2772-4619 | mltE | ||
| 3846 | JASOLC010000050.1 | GCA030216405_01678 | gene | open | 4790-5350 | apt | ||
| 3847 | JASOLC010000050.1 | GCA030216405_01679 | gene | open | 5503-6120 | gmk | ||
| 3848 | JASOLC010000050.1 | GCA030216405_01680 | gene | open | 6178-6384 | rpoZ | ||
| 3849 | JASOLC010000050.1 | GCA030216405_01681 | gene | open | 6495-8651 | spoT | ||
| 3850 | JASOLC010000050.1 | GCA030216405_01682 | gene | open | 8753-9733 | phoH | ||
| 3851 | JASOLC010000050.1 | GCA030216405_01683 | gene | open | 9802-11475 | menE | ||
| 3852 | JASOLC010000050.1 | GCA030216405_01684 | gene | open | 11581-12684 | mnmA | ||
| 3853 | JASOLC010000050.1 | GCA030216405_01685 | gene | open | 12886-13365 | |||
| 3854 | JASOLC010000050.1 | GCA030216405_01686 | gene | open | 13561-13953 | dgkA | ||
| 3855 | JASOLC010000050.1 | GCA030216405_01687 | gene | open | 14261-15217 | gshB | ||
| 3856 | JASOLC010000050.1 | GCA030216405_01688 | gene | open | 15368-17029 | recN | ||
| 3857 | JASOLC010000050.1 | GCA030216405_01676 | gene | open | 2423-2515 | trnS | ||
| 3858 | JASOLC010000050.1 | GCA030216405_01676 | tRNA | open | 2423-2515 | trnS | tRNA-Ser(gct) | |
| 3859 | JASOLC010000051.1 | rep_origin | open | 12861-15339 | ||||
| 3860 | JASOLC010000051.1 | GCA030216405_01689 | CDS | open | 252-668 | _na 138_aa | dksA | RNA polymerase-binding protein DksA |
| 3861 | JASOLC010000051.1 | GCA030216405_01690 | CDS | open | 862-1416 | _na 184_aa | YGGT family protein | |
| 3862 | JASOLC010000051.1 | GCA030216405_01691 | CDS | open | 1419-2216 | _na 265_aa | proC | pyrroline-5-carboxylate reductase |
| 3863 | JASOLC010000051.1 | GCA030216405_01692 | CDS | open | 2307-2702 | _na 131_aa | RNA-binding protein | |
| 3864 | JASOLC010000051.1 | GCA030216405_01693 | CDS | open | 2699-3406 | _na 235_aa | yggS | Pyridoxal phosphate homeostasis protein |
| 3865 | JASOLC010000051.1 | GCA030216405_01694 | CDS | open | 3586-4632 | _na 348_aa | pilT | Twitching motility protein PilT |
| 3866 | JASOLC010000051.1 | GCA030216405_01695 | CDS | open | 4804-6036 | _na 410_aa | pilT | Twitching motility protein PilT |
| 3867 | JASOLC010000051.1 | GCA030216405_01696 | CDS | open | 6448-6984 | _na 178_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3868 | JASOLC010000051.1 | GCA030216405_01697 | CDS | open | 7366-7902 | _na 178_aa | nlpC | NlpC/P60 domain-containing protein |
| 3869 | JASOLC010000051.1 | GCA030216405_01698 | CDS | open | 7995-8666 | _na 223_aa | elyC | DUF218 domain-containing protein |
| 3870 | JASOLC010000051.1 | GCA030216405_01699 | CDS | open | 8689-9048 | _na 119_aa | arsC | arsenate reductase (glutaredoxin) |
| 3871 | JASOLC010000051.1 | GCA030216405_01700 | CDS | open | 9392-9874 | _na 160_aa | trxA | Redoxin family protein |
| 3872 | JASOLC010000051.1 | GCA030216405_01701 | CDS | open | 10208-10858 | _na 216_aa | ftsE | cell division ATP-binding protein FtsE |
| 3873 | JASOLC010000051.1 | GCA030216405_01702 | CDS | open | 10855-11772 | _na 305_aa | ftsX | permease-like cell division protein FtsX |
| 3874 | JASOLC010000051.1 | GCA030216405_01703 | CDS | open | 11872-12405 | _na 177_aa | Ligase | |
| 3875 | JASOLC010000051.1 | GCA030216405_01704 | CDS | open | 12608-12799 | _na 63_aa | hypothetical protein | |
| 3876 | JASOLC010000051.1 | GCA030216405_01705 | CDS | open | 12905-15535 | _na 876_aa | mutS | DNA mismatch repair protein MutS |
| 3877 | JASOLC010000051.1 | GCA030216405_01706 | CDS | open | 16395-16883 | _na 162_aa | hypothetical protein | |
| 3878 | JASOLC010000051.1 | GCA030216405_01689 | gene | open | 252-668 | dksA | ||
| 3879 | JASOLC010000051.1 | GCA030216405_01690 | gene | open | 862-1416 | |||
| 3880 | JASOLC010000051.1 | GCA030216405_01691 | gene | open | 1419-2216 | proC | ||
| 3881 | JASOLC010000051.1 | GCA030216405_01692 | gene | open | 2307-2702 | |||
| 3882 | JASOLC010000051.1 | GCA030216405_01693 | gene | open | 2699-3406 | yggS | ||
| 3883 | JASOLC010000051.1 | GCA030216405_01694 | gene | open | 3586-4632 | pilT | ||
| 3884 | JASOLC010000051.1 | GCA030216405_01695 | gene | open | 4804-6036 | pilT | ||
| 3885 | JASOLC010000051.1 | GCA030216405_01696 | gene | open | 6448-6984 | |||
| 3886 | JASOLC010000051.1 | GCA030216405_01697 | gene | open | 7366-7902 | nlpC | ||
| 3887 | JASOLC010000051.1 | GCA030216405_01698 | gene | open | 7995-8666 | elyC | ||
| 3888 | JASOLC010000051.1 | GCA030216405_01699 | gene | open | 8689-9048 | arsC | ||
| 3889 | JASOLC010000051.1 | GCA030216405_01700 | gene | open | 9392-9874 | trxA | ||
| 3890 | JASOLC010000051.1 | GCA030216405_01701 | gene | open | 10208-10858 | ftsE | ||
| 3891 | JASOLC010000051.1 | GCA030216405_01702 | gene | open | 10855-11772 | ftsX | ||
| 3892 | JASOLC010000051.1 | GCA030216405_01703 | gene | open | 11872-12405 | |||
| 3893 | JASOLC010000051.1 | GCA030216405_01704 | gene | open | 12608-12799 | |||
| 3894 | JASOLC010000051.1 | GCA030216405_01705 | gene | open | 12905-15535 | mutS | ||
| 3895 | JASOLC010000051.1 | GCA030216405_01706 | gene | open | 16395-16883 | |||
| 3896 | JASOLC010000052.1 | GCA030216405_01707 | CDS | open | 274-1401 | _na 375_aa | bamC | NlpB/DapX lipoprotein |
| 3897 | JASOLC010000052.1 | GCA030216405_01708 | CDS | open | 1474-2355 | _na 293_aa | dapA | 4-hydroxy-tetrahydrodipicolinate synthase |
| 3898 | JASOLC010000052.1 | GCA030216405_01709 | CDS | open | 2702-3412 | _na 236_aa | azlC | LIV-E family branched chain amino acid permease AzlC |
| 3899 | JASOLC010000052.1 | GCA030216405_01710 | CDS | open | 3409-3717 | _na 102_aa | Branched-chain amino acid transporter | |
| 3900 | JASOLC010000052.1 | GCA030216405_01711 | CDS | open | 3809-4558 | _na 249_aa | rlmB | 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB |
| 3901 | JASOLC010000052.1 | GCA030216405_01712 | CDS | open | 4642-5595 | _na 317_aa | mdh | L-lactate dehydrogenase |
| 3902 | JASOLC010000052.1 | GCA030216405_01713 | CDS | open | 5935-6729 | _na 264_aa | factor H-binding protein | |
| 3903 | JASOLC010000052.1 | GCA030216405_01714 | CDS | open | 7257-8108 | _na 283_aa | DUF1853 domain-containing protein | |
| 3904 | JASOLC010000052.1 | GCA030216405_01715 | CDS | open | 8178-8993 | _na 271_aa | trmJ | tRNA/rRNA methyltransferase |
| 3905 | JASOLC010000052.1 | GCA030216405_01716 | CDS | open | 9177-9962 | _na 261_aa | suhB | Putative Nus factor SuhB |
| 3906 | JASOLC010000052.1 | GCA030216405_01717 | CDS | open | 10323-11462 | _na 379_aa | tolC | Outer membrane efflux protein |
| 3907 | JASOLC010000052.1 | GCA030216405_01718 | CDS | open | 11502-13685 | _na 727_aa | sunT | Type I secretion system ATPase |
| 3908 | JASOLC010000052.1 | GCA030216405_01719 | CDS | open | 13778-15004 | _na 408_aa | emrA | Membrane fusion protein (MFP) family protein |
| 3909 | JASOLC010000052.1 | GCA030216405_01720 | CDS | open | 15266-16576 | _na 436_aa | cysN | sulfate adenylyltransferase |
| 3910 | JASOLC010000052.1 | GCA030216405_01707 | gene | open | 274-1401 | bamC | ||
| 3911 | JASOLC010000052.1 | GCA030216405_01708 | gene | open | 1474-2355 | dapA | ||
| 3912 | JASOLC010000052.1 | GCA030216405_01709 | gene | open | 2702-3412 | azlC | ||
| 3913 | JASOLC010000052.1 | GCA030216405_01710 | gene | open | 3409-3717 | |||
| 3914 | JASOLC010000052.1 | GCA030216405_01711 | gene | open | 3809-4558 | rlmB | ||
| 3915 | JASOLC010000052.1 | GCA030216405_01712 | gene | open | 4642-5595 | mdh | ||
| 3916 | JASOLC010000052.1 | GCA030216405_01713 | gene | open | 5935-6729 | |||
| 3917 | JASOLC010000052.1 | GCA030216405_01714 | gene | open | 7257-8108 | |||
| 3918 | JASOLC010000052.1 | GCA030216405_01715 | gene | open | 8178-8993 | trmJ | ||
| 3919 | JASOLC010000052.1 | GCA030216405_01716 | gene | open | 9177-9962 | suhB | ||
| 3920 | JASOLC010000052.1 | GCA030216405_01717 | gene | open | 10323-11462 | tolC | ||
| 3921 | JASOLC010000052.1 | GCA030216405_01718 | gene | open | 11502-13685 | sunT | ||
| 3922 | JASOLC010000052.1 | GCA030216405_01719 | gene | open | 13778-15004 | emrA | ||
| 3923 | JASOLC010000052.1 | GCA030216405_01720 | gene | open | 15266-16576 | cysN | ||
| 3924 | JASOLC010000053.1 | GCA030216405_01721 | CDS | open | 177-1553 | _na 458_aa | mpl | UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase |
| 3925 | JASOLC010000053.1 | GCA030216405_01722 | CDS | open | 1688-2413 | _na 241_aa | trmR | Class I SAM-dependent methyltransferase |
| 3926 | JASOLC010000053.1 | GCA030216405_01723 | CDS | open | 2450-3976 | _na 508_aa | fbpB | ABC transporter%2C permease protein |
| 3927 | JASOLC010000053.1 | GCA030216405_01724 | CDS | open | 4312-5211 | _na 299_aa | nnr2 | ADP-dependent (S)-NAD(P)H-hydrate dehydratase |
| 3928 | JASOLC010000053.1 | GCA030216405_01725 | CDS | open | 5344-6003 | _na 219_aa | cytB | Nickel-dependent hydrogenases B-type cytochrome subunit |
| 3929 | JASOLC010000053.1 | GCA030216405_01726 | CDS | open | 6064-6696 | _na 210_aa | mlaC | Toluene tolerance family protein |
| 3930 | JASOLC010000053.1 | GCA030216405_01727 | CDS | open | 6791-7294 | _na 167_aa | DUF1841 domain-containing protein | |
| 3931 | JASOLC010000053.1 | GCA030216405_01728 | CDS | open | 7479-8159 | _na 226_aa | radC | DNA repair protein RadC |
| 3932 | JASOLC010000053.1 | GCA030216405_01729 | CDS | open | 8699-9823 | _na 374_aa | potA | Spermidine/putrescine import ATP-binding protein PotA |
| 3933 | JASOLC010000053.1 | GCA030216405_01730 | CDS | open | 9839-10804 | _na 321_aa | potB | ABC transporter permease%2C polyamine |
| 3934 | JASOLC010000053.1 | GCA030216405_01731 | CDS | open | 10804-11691 | _na 295_aa | potC | Spermidine/putrescine ABC transporter%2C permease protein |
| 3935 | JASOLC010000053.1 | GCA030216405_01732 | CDS | open | 11928-13223 | _na 431_aa | dadA | FAD-binding oxidoreductase |
| 3936 | JASOLC010000053.1 | GCA030216405_01733 | CDS | open | 13381-14208 | _na 275_aa | NMB0938 family lipoprotein | |
| 3937 | JASOLC010000053.1 | GCA030216405_01734 | CDS | open | 14320-14622 | _na 100_aa | yfaE | class I ribonucleotide reductase maintenance protein YfaE |
| 3938 | JASOLC010000053.1 | GCA030216405_01735 | CDS | open | 14742-15896 | _na 384_aa | nrdB | class Ia ribonucleoside-diphosphate reductase subunit beta |
| 3939 | JASOLC010000053.1 | GCA030216405_01721 | gene | open | 177-1553 | mpl | ||
| 3940 | JASOLC010000053.1 | GCA030216405_01722 | gene | open | 1688-2413 | trmR | ||
| 3941 | JASOLC010000053.1 | GCA030216405_01723 | gene | open | 2450-3976 | fbpB | ||
| 3942 | JASOLC010000053.1 | GCA030216405_01724 | gene | open | 4312-5211 | nnr2 | ||
| 3943 | JASOLC010000053.1 | GCA030216405_01725 | gene | open | 5344-6003 | cytB | ||
| 3944 | JASOLC010000053.1 | GCA030216405_01726 | gene | open | 6064-6696 | mlaC | ||
| 3945 | JASOLC010000053.1 | GCA030216405_01727 | gene | open | 6791-7294 | |||
| 3946 | JASOLC010000053.1 | GCA030216405_01728 | gene | open | 7479-8159 | radC | ||
| 3947 | JASOLC010000053.1 | GCA030216405_01729 | gene | open | 8699-9823 | potA | ||
| 3948 | JASOLC010000053.1 | GCA030216405_01730 | gene | open | 9839-10804 | potB | ||
| 3949 | JASOLC010000053.1 | GCA030216405_01731 | gene | open | 10804-11691 | potC | ||
| 3950 | JASOLC010000053.1 | GCA030216405_01732 | gene | open | 11928-13223 | dadA | ||
| 3951 | JASOLC010000053.1 | GCA030216405_01733 | gene | open | 13381-14208 | |||
| 3952 | JASOLC010000053.1 | GCA030216405_01734 | gene | open | 14320-14622 | yfaE | ||
| 3953 | JASOLC010000053.1 | GCA030216405_01735 | gene | open | 14742-15896 | nrdB | ||
| 3954 | JASOLC010000054.1 | GCA030216405_01736 | CDS | open | 137-568 | _na 143_aa | ykuD | YkuD domain-containing protein |
| 3955 | JASOLC010000054.1 | GCA030216405_01737 | CDS | open | 578-1108 | _na 176_aa | bamE | SmpA / OmlA family protein |
| 3956 | JASOLC010000054.1 | GCA030216405_01738 | CDS | open | 1445-2077 | _na 210_aa | gloB | Metallo-beta-lactamase domain-containing protein |
| 3957 | JASOLC010000054.1 | GCA030216405_01739 | CDS | open | 2212-3030 | _na 272_aa | cDC9 | DNA ligase |
| 3958 | JASOLC010000054.1 | GCA030216405_01740 | CDS | open | 3423-5423 | _na 666_aa | Tetratricopeptide repeat protein | |
| 3959 | JASOLC010000054.1 | GCA030216405_01741 | CDS | open | 5694-7709 | _na 671_aa | preP | Prolyl endopeptidase |
| 3960 | JASOLC010000054.1 | GCA030216405_01742 | CDS | open | 7822-8778 | _na 318_aa | araC | Transcriptional regulator%2C AraC family |
| 3961 | JASOLC010000054.1 | GCA030216405_01743 | CDS | open | 9014-9985 | _na 323_aa | ceuA | Ferric enterobactin transporter binding protein |
| 3962 | JASOLC010000054.1 | GCA030216405_01744 | CDS | open | 10938-11261 | _na 107_aa | manC | Cupin type-2 domain-containing protein |
| 3963 | JASOLC010000054.1 | GCA030216405_01745 | CDS | open | 11370-13550 | _na 726_aa | fhuE | TonB-dependent receptor protein |
| 3964 | JASOLC010000054.1 | GCA030216405_01746 | CDS | open | 13970-14332 | _na 120_aa | Cupin | |
| 3965 | JASOLC010000054.1 | GCA030216405_01747 | CDS | open | 14457-14924 | _na 155_aa | pncC | Competence/damage-inducible protein CinA |
| 3966 | JASOLC010000054.1 | GCA030216405_01748 | CDS | open | 15126-15710 | _na 194_aa | ruvA | Holliday junction branch migration protein RuvA |
| 3967 | JASOLC010000054.1 | GCA030216405_01736 | gene | open | 137-568 | ykuD | ||
| 3968 | JASOLC010000054.1 | GCA030216405_01737 | gene | open | 578-1108 | bamE | ||
| 3969 | JASOLC010000054.1 | GCA030216405_01738 | gene | open | 1445-2077 | gloB | ||
| 3970 | JASOLC010000054.1 | GCA030216405_01739 | gene | open | 2212-3030 | cDC9 | ||
| 3971 | JASOLC010000054.1 | GCA030216405_01740 | gene | open | 3423-5423 | |||
| 3972 | JASOLC010000054.1 | GCA030216405_01741 | gene | open | 5694-7709 | preP | ||
| 3973 | JASOLC010000054.1 | GCA030216405_01742 | gene | open | 7822-8778 | araC | ||
| 3974 | JASOLC010000054.1 | GCA030216405_01743 | gene | open | 9014-9985 | ceuA | ||
| 3975 | JASOLC010000054.1 | GCA030216405_01744 | gene | open | 10938-11261 | manC | ||
| 3976 | JASOLC010000054.1 | GCA030216405_01745 | gene | open | 11370-13550 | fhuE | ||
| 3977 | JASOLC010000054.1 | GCA030216405_01746 | gene | open | 13970-14332 | |||
| 3978 | JASOLC010000054.1 | GCA030216405_01747 | gene | open | 14457-14924 | pncC | ||
| 3979 | JASOLC010000054.1 | GCA030216405_01748 | gene | open | 15126-15710 | ruvA | ||
| 3980 | JASOLC010000055.1 | GCA030216405_01749 | CDS | open | 707-814 | _na 35_aa | hypothetical protein | |
| 3981 | JASOLC010000055.1 | GCA030216405_01750 | CDS | open | 986-1090 | _na 34_aa | hypothetical protein | |
| 3982 | JASOLC010000055.1 | GCA030216405_01751 | CDS | open | 1298-1405 | _na 35_aa | hypothetical protein | |
| 3983 | JASOLC010000055.1 | GCA030216405_01752 | CDS | open | 1522-2460 | _na 312_aa | potA | Spermidine/putrescine ABC superfamily ATP binding cassette transporter%2C ABC protein |
| 3984 | JASOLC010000055.1 | GCA030216405_01753 | CDS | open | 2545-3423 | _na 292_aa | yjhB | Hydrolase%2C NUDIX family |
| 3985 | JASOLC010000055.1 | GCA030216405_01754 | CDS | open | 3579-4175 | _na 198_aa | cynT | Carbonate dehydratase |
| 3986 | JASOLC010000055.1 | GCA030216405_01755 | CDS | open | 4233-4844 | _na 203_aa | nadD | nicotinate-nucleotide adenylyltransferase |
| 3987 | JASOLC010000055.1 | GCA030216405_01756 | CDS | open | 4912-5298 | _na 128_aa | rsfS | ribosome silencing factor |
| 3988 | JASOLC010000055.1 | GCA030216405_01757 | CDS | open | 5494-5964 | _na 156_aa | rlmH | 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH |
| 3989 | JASOLC010000055.1 | GCA030216405_01759 | CDS | open | 6452-6682 | _na 76_aa | Helix-turn-helix transcriptional regulator | |
| 3990 | JASOLC010000055.1 | GCA030216405_01760 | CDS | open | 6784-7179 | _na 131_aa | PH domain-containing protein | |
| 3991 | JASOLC010000055.1 | GCA030216405_01761 | CDS | open | 7385-7660 | _na 91_aa | Membrane protein | |
| 3992 | JASOLC010000055.1 | GCA030216405_01762 | CDS | open | 7882-8307 | _na 141_aa | hemJ | Protoporphyrinogen IX oxidase |
| 3993 | JASOLC010000055.1 | GCA030216405_01763 | CDS | open | 8362-8826 | _na 154_aa | cYTH | Adenylate cyclase |
| 3994 | JASOLC010000055.1 | GCA030216405_01764 | CDS | open | 9346-10668 | _na 440_aa | mltA | peptidoglycan lytic exotransglycosylase |
| 3995 | JASOLC010000055.1 | GCA030216405_01765 | CDS | open | 11175-12011 | _na 278_aa | efeU | iron uptake transporter permease EfeU |
| 3996 | JASOLC010000055.1 | GCA030216405_01766 | CDS | open | 12086-13249 | _na 387_aa | efeO | iron uptake system protein EfeO |
| 3997 | JASOLC010000055.1 | GCA030216405_01767 | CDS | open | 13729-14997 | _na 422_aa | efeB | iron uptake transporter deferrochelatase/peroxidase subunit |
| 3998 | JASOLC010000055.1 | GCA030216405_01749 | gene | open | 707-814 | |||
| 3999 | JASOLC010000055.1 | GCA030216405_01750 | gene | open | 986-1090 | |||
| 4000 | JASOLC010000055.1 | GCA030216405_01751 | gene | open | 1298-1405 |

