HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Dialister micraerophilus (GCA_030227545.1)

Select a Genome:
BAKTA Annotations for GCA_030227545.1
Genome Selected: Dialister micraerophilus
ContigsBases CDSrRNA tmRNAtRNA
104 1407888 1333 0 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2790 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 2790 [6 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 JASOZS010000027.1 GCA030227545_00205 gene open 9471-10052
2002 JASOZS010000027.1 GCA030227545_00206 gene open 10039-11313 secD
2003 JASOZS010000027.1 GCA030227545_00207 gene open 11310-12191 secF
2004 JASOZS010000027.1 GCA030227545_00208 gene open 12262-13224 glpX
2005 JASOZS010000027.1 GCA030227545_00209 gene open 13400-13954 lepB
2006 JASOZS010000027.1 GCA030227545_00210 gene open 14019-15257
2007 JASOZS010000027.1 GCA030227545_00211 gene open 15261-16367 ychF
2008 JASOZS010000027.1 GCA030227545_00212 gene open 16551-16805
2009 JASOZS010000027.1 GCA030227545_00213 gene open 16802-16912
2010 JASOZS010000028.1 GCA030227545_00214 CDS open 306-1412 _na     368_aa csaB polysaccharide pyruvyl transferase CsaB
2011 JASOZS010000028.1 GCA030227545_00215 CDS open 1399-3423 _na     674_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
2012 JASOZS010000028.1 GCA030227545_00216 CDS open 3444-4430 _na     328_aa prfB peptide chain release factor 2
2013 JASOZS010000028.1 GCA030227545_00217 CDS open 4579-7020 _na     813_aa secA preprotein translocase subunit SecA
2014 JASOZS010000028.1 GCA030227545_00218 CDS open 7165-7815 _na     216_aa Competence protein F
2015 JASOZS010000028.1 GCA030227545_00219 CDS open 7812-9944 _na     710_aa recD2 ATP-dependent RecD2 DNA helicase
2016 JASOZS010000028.1 GCA030227545_00220 CDS open 10017-11741 _na     574_aa proline--tRNA ligase
2017 JASOZS010000028.1 GCA030227545_00221 CDS open 11742-12806 _na     354_aa ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
2018 JASOZS010000028.1 GCA030227545_00222 CDS open 14124-14363 _na     79_aa hypothetical protein
2019 JASOZS010000028.1 GCA030227545_00223 CDS open 14369-14632 _na     87_aa hypothetical protein
2020 JASOZS010000028.1 GCA030227545_00224 CDS open 14676-15077 _na     133_aa hypothetical protein
2021 JASOZS010000028.1 GCA030227545_00225 CDS open 15347-15619 _na     90_aa hypothetical protein
2022 JASOZS010000028.1 GCA030227545_00214 gene open 306-1412 csaB
2023 JASOZS010000028.1 GCA030227545_00215 gene open 1399-3423
2024 JASOZS010000028.1 GCA030227545_00216 gene open 3444-4430 prfB
2025 JASOZS010000028.1 GCA030227545_00217 gene open 4579-7020 secA
2026 JASOZS010000028.1 GCA030227545_00218 gene open 7165-7815
2027 JASOZS010000028.1 GCA030227545_00219 gene open 7812-9944 recD2
2028 JASOZS010000028.1 GCA030227545_00220 gene open 10017-11741
2029 JASOZS010000028.1 GCA030227545_00221 gene open 11742-12806 ispG
2030 JASOZS010000028.1 GCA030227545_00222 gene open 14124-14363
2031 JASOZS010000028.1 GCA030227545_00223 gene open 14369-14632
2032 JASOZS010000028.1 GCA030227545_00224 gene open 14676-15077
2033 JASOZS010000028.1 GCA030227545_00225 gene open 15347-15619
2034 JASOZS010000029.1 regulatory_region open 10399-10640 T-box leader
2035 JASOZS010000029.1 GCA030227545_00226 CDS open 780-1043 _na     87_aa xseB exodeoxyribonuclease VII small subunit
2036 JASOZS010000029.1 GCA030227545_00227 CDS open 1055-2116 _na     353_aa xseA exodeoxyribonuclease VII large subunit
2037 JASOZS010000029.1 GCA030227545_00228 CDS open 2094-3050 _na     318_aa N(6)-L-threonylcarbamoyladenine synthase
2038 JASOZS010000029.1 GCA030227545_00229 CDS open 3043-3444 _na     133_aa nusB transcription antitermination factor NusB
2039 JASOZS010000029.1 GCA030227545_00230 CDS open 3454-3795 _na     113_aa Asp23/Gls24 family envelope stress response protein
2040 JASOZS010000029.1 GCA030227545_00231 CDS open 3811-4158 _na     115_aa Asp23/Gls24 family envelope stress response protein
2041 JASOZS010000029.1 GCA030227545_00232 CDS open 4166-4726 _na     186_aa efp elongation factor P
2042 JASOZS010000029.1 GCA030227545_00233 CDS open 4739-5794 _na     351_aa Xaa-Pro dipeptidase
2043 JASOZS010000029.1 GCA030227545_00234 CDS open 6817-7311 _na     164_aa queF preQ(1) synthase
2044 JASOZS010000029.1 GCA030227545_00235 CDS open 7370-8053 _na     227_aa Cobalt transporter
2045 JASOZS010000029.1 GCA030227545_00236 CDS open 8054-8866 _na     270_aa Cobalt ABC superfamily ATP binding cassette transporter%2C ABC protein
2046 JASOZS010000029.1 GCA030227545_00237 CDS open 8870-10342 _na     490_aa Cobalt ABC superfamily ATP binding cassette transporter%2C ABC protein
2047 JASOZS010000029.1 GCA030227545_00238 CDS open 10663-11544 _na     293_aa mscS MscS family small conductance mechanosenstive ion channel
2048 JASOZS010000029.1 GCA030227545_00239 CDS open 11548-12399 _na     283_aa folD Bifunctional protein FolD
2049 JASOZS010000029.1 GCA030227545_00240 CDS open 12409-14076 _na     555_aa formate--tetrahydrofolate ligase
2050 JASOZS010000029.1 GCA030227545_00226 gene open 780-1043 xseB
2051 JASOZS010000029.1 GCA030227545_00227 gene open 1055-2116 xseA
2052 JASOZS010000029.1 GCA030227545_00228 gene open 2094-3050
2053 JASOZS010000029.1 GCA030227545_00229 gene open 3043-3444 nusB
2054 JASOZS010000029.1 GCA030227545_00230 gene open 3454-3795
2055 JASOZS010000029.1 GCA030227545_00231 gene open 3811-4158
2056 JASOZS010000029.1 GCA030227545_00232 gene open 4166-4726 efp
2057 JASOZS010000029.1 GCA030227545_00233 gene open 4739-5794
2058 JASOZS010000029.1 GCA030227545_00234 gene open 6817-7311 queF
2059 JASOZS010000029.1 GCA030227545_00235 gene open 7370-8053
2060 JASOZS010000029.1 GCA030227545_00236 gene open 8054-8866
2061 JASOZS010000029.1 GCA030227545_00237 gene open 8870-10342
2062 JASOZS010000029.1 GCA030227545_00238 gene open 10663-11544 mscS
2063 JASOZS010000029.1 GCA030227545_00239 gene open 11548-12399 folD
2064 JASOZS010000029.1 GCA030227545_00240 gene open 12409-14076
2065 JASOZS010000030.1 regulatory_region open 7035-7099 pemK RNA
2066 JASOZS010000030.1 GCA030227545_00241 CDS open 598-771 _na     57_aa hypothetical protein
2067 JASOZS010000030.1 GCA030227545_00242 CDS open 846-2177 _na     443_aa MobA/VirD2-like nuclease domain-containing protein
2068 JASOZS010000030.1 GCA030227545_00243 CDS open 2179-2535 _na     118_aa Bacterial mobilisation domain-containing protein
2069 JASOZS010000030.1 GCA030227545_00244 CDS open 2705-3787 _na     360_aa rhuM Toxin-antitoxin system%2C toxin component%2C Fic family
2070 JASOZS010000030.1 GCA030227545_00245 CDS open 3780-4262 _na     160_aa mreD Rod shape-determining protein MreD
2071 JASOZS010000030.1 GCA030227545_00246 CDS open 4271-4819 _na     182_aa immA IrrE N-terminal-like domain-containing protein
2072 JASOZS010000030.1 GCA030227545_00247 CDS open 4828-5229 _na     133_aa hipB HTH cro/C1-type domain-containing protein
2073 JASOZS010000030.1 GCA030227545_00248 CDS open 5418-5939 _na     173_aa arpU Phage transcriptional regulator%2C ArpU family
2074 JASOZS010000030.1 GCA030227545_00249 CDS open 6209-6619 _na     136_aa rpoE RNA polymerase sigma-70 region 4 domain-containing protein
2075 JASOZS010000030.1 GCA030227545_00250 CDS open 7096-7317 _na     73_aa hypothetical protein
2076 JASOZS010000030.1 GCA030227545_00251 CDS open 7418-9088 _na     556_aa spoIVCA Recombinase
2077 JASOZS010000030.1 GCA030227545_00252 CDS open 9088-10758 _na     556_aa spoIVCA Resolvase%2C N-terminal domain protein
2078 JASOZS010000030.1 GCA030227545_00253 CDS open 10751-12244 _na     497_aa spoIVCA Resolvase%2C N-terminal domain protein
2079 JASOZS010000030.1 GCA030227545_00254 CDS open 12386-12814 _na     142_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
2080 JASOZS010000030.1 GCA030227545_00241 gene open 598-771
2081 JASOZS010000030.1 GCA030227545_00242 gene open 846-2177
2082 JASOZS010000030.1 GCA030227545_00243 gene open 2179-2535
2083 JASOZS010000030.1 GCA030227545_00244 gene open 2705-3787 rhuM
2084 JASOZS010000030.1 GCA030227545_00245 gene open 3780-4262 mreD
2085 JASOZS010000030.1 GCA030227545_00246 gene open 4271-4819 immA
2086 JASOZS010000030.1 GCA030227545_00247 gene open 4828-5229 hipB
2087 JASOZS010000030.1 GCA030227545_00248 gene open 5418-5939 arpU
2088 JASOZS010000030.1 GCA030227545_00249 gene open 6209-6619 rpoE
2089 JASOZS010000030.1 GCA030227545_00250 gene open 7096-7317
2090 JASOZS010000030.1 GCA030227545_00251 gene open 7418-9088 spoIVCA
2091 JASOZS010000030.1 GCA030227545_00252 gene open 9088-10758 spoIVCA
2092 JASOZS010000030.1 GCA030227545_00253 gene open 10751-12244 spoIVCA
2093 JASOZS010000030.1 GCA030227545_00254 gene open 12386-12814 nrdI
2094 JASOZS010000031.1 GCA030227545_00255 CDS open 422-868 _na     148_aa DUF3299 domain-containing protein
2095 JASOZS010000031.1 GCA030227545_00256 CDS open 865-2709 _na     614_aa Alkaline phosphatase
2096 JASOZS010000031.1 GCA030227545_00257 CDS open 3049-4551 _na     500_aa lysS lysine--tRNA ligase
2097 JASOZS010000031.1 GCA030227545_00258 CDS open 4656-5144 _na     162_aa greA transcription elongation factor GreA
2098 JASOZS010000031.1 GCA030227545_00259 CDS open 5991-7307 _na     438_aa potE putrescine-ornithine antiporter
2099 JASOZS010000031.1 GCA030227545_00260 CDS open 7358-8764 _na     468_aa norM putative multidrug resistance protein NorM
2100 JASOZS010000031.1 GCA030227545_00261 CDS open 8757-9407 _na     216_aa fsa fructose-6-phosphate aldolase
2101 JASOZS010000031.1 GCA030227545_00262 CDS open 9569-9985 _na     138_aa Outer membrane chaperone Skp (OmpH)
2102 JASOZS010000031.1 GCA030227545_00263 CDS open 10071-10505 _na     144_aa ytfJ Sporulation protein YtfJ
2103 JASOZS010000031.1 GCA030227545_00264 CDS open 10498-11229 _na     243_aa DUF2953 domain-containing protein
2104 JASOZS010000031.1 GCA030227545_00265 CDS open 11231-12271 _na     346_aa WYL domain-containing protein
2105 JASOZS010000031.1 GCA030227545_00266 CDS open 12273-12797 _na     174_aa Phosphatase
2106 JASOZS010000031.1 GCA030227545_00267 CDS open 12801-13052 _na     83_aa hypothetical protein
2107 JASOZS010000031.1 GCA030227545_00255 gene open 422-868
2108 JASOZS010000031.1 GCA030227545_00256 gene open 865-2709
2109 JASOZS010000031.1 GCA030227545_00257 gene open 3049-4551 lysS
2110 JASOZS010000031.1 GCA030227545_00258 gene open 4656-5144 greA
2111 JASOZS010000031.1 GCA030227545_00259 gene open 5991-7307 potE
2112 JASOZS010000031.1 GCA030227545_00260 gene open 7358-8764 norM
2113 JASOZS010000031.1 GCA030227545_00261 gene open 8757-9407 fsa
2114 JASOZS010000031.1 GCA030227545_00262 gene open 9569-9985
2115 JASOZS010000031.1 GCA030227545_00263 gene open 10071-10505 ytfJ
2116 JASOZS010000031.1 GCA030227545_00264 gene open 10498-11229
2117 JASOZS010000031.1 GCA030227545_00265 gene open 11231-12271
2118 JASOZS010000031.1 GCA030227545_00266 gene open 12273-12797
2119 JASOZS010000031.1 GCA030227545_00267 gene open 12801-13052
2120 JASOZS010000032.1 repeat_region open 12425-13125 CRISPR array with 11 repeats of length 36%2C consensus sequence GTATCAGTTTACCTATATCCAACAGATGTCTAAAAC and spacer length 30
2121 JASOZS010000032.1 GCA030227545_00268 CDS open 1051-1458 _na     135_aa Heat shock protein Hsp20
2122 JASOZS010000032.1 GCA030227545_00269 CDS open 1693-2541 _na     282_aa lpxC UDP-3-O-acyl-N-acetylglucosamine deacetylase
2123 JASOZS010000032.1 GCA030227545_00270 CDS open 2538-2972 _na     144_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
2124 JASOZS010000032.1 GCA030227545_00271 CDS open 3077-3889 _na     270_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
2125 JASOZS010000032.1 GCA030227545_00272 CDS open 4630-5886 _na     418_aa hisS histidine--tRNA ligase
2126 JASOZS010000032.1 GCA030227545_00273 CDS open 6310-6738 _na     142_aa eamA EamA domain-containing protein
2127 JASOZS010000032.1 GCA030227545_00274 CDS open 6854-8143 _na     429_aa adenylosuccinate synthase
2128 JASOZS010000032.1 GCA030227545_00275 CDS open 8160-9452 _na     430_aa purB adenylosuccinate lyase
2129 JASOZS010000032.1 GCA030227545_00276 CDS open 9445-10845 _na     466_aa FAD dependent oxidoreductase
2130 JASOZS010000032.1 GCA030227545_00277 CDS open 10973-11326 _na     117_aa hypothetical protein
2131 JASOZS010000032.1 GCA030227545_00278 CDS open 11455-12012 _na     185_aa hypothetical protein
2132 JASOZS010000032.1 GCA030227545_00279 CDS open 12009-12284 _na     91_aa hypothetical protein
2133 JASOZS010000032.1 GCA030227545_00268 gene open 1051-1458
2134 JASOZS010000032.1 GCA030227545_00269 gene open 1693-2541 lpxC
2135 JASOZS010000032.1 GCA030227545_00270 gene open 2538-2972 fabZ
2136 JASOZS010000032.1 GCA030227545_00271 gene open 3077-3889 lpxA
2137 JASOZS010000032.1 GCA030227545_00272 gene open 4630-5886 hisS
2138 JASOZS010000032.1 GCA030227545_00273 gene open 6310-6738 eamA
2139 JASOZS010000032.1 GCA030227545_00274 gene open 6854-8143
2140 JASOZS010000032.1 GCA030227545_00275 gene open 8160-9452 purB
2141 JASOZS010000032.1 GCA030227545_00276 gene open 9445-10845
2142 JASOZS010000032.1 GCA030227545_00277 gene open 10973-11326
2143 JASOZS010000032.1 GCA030227545_00278 gene open 11455-12012
2144 JASOZS010000032.1 GCA030227545_00279 gene open 12009-12284
2145 JASOZS010000033.1 GCA030227545_00280 CDS open 59-1711 _na     550_aa Cyclic beta-1%2C2-glucan ABC superfamily ATP binding cassette transporter%2C ABC/membrane protein
2146 JASOZS010000033.1 GCA030227545_00281 CDS open 1767-1997 _na     76_aa hypothetical protein
2147 JASOZS010000033.1 GCA030227545_00282 CDS open 1990-2703 _na     237_aa Ser/Thr protein phosphatase
2148 JASOZS010000033.1 GCA030227545_00283 CDS open 2705-3466 _na     253_aa UTP-hexose-1-phosphate uridylyltransferase
2149 JASOZS010000033.1 GCA030227545_00284 CDS open 3636-4433 _na     265_aa Amino acid ABC superfamily ATP binding cassette transporter%2C binding protein
2150 JASOZS010000033.1 GCA030227545_00285 CDS open 4503-5156 _na     217_aa Amino acid ABC superfamily ATP binding cassette transporter%2C membrane protein
2151 JASOZS010000033.1 GCA030227545_00286 CDS open 5165-5920 _na     251_aa Glutamine ABC superfamily ATP binding cassette transporter%2C ABC protein
2152 JASOZS010000033.1 GCA030227545_00287 CDS open 6033-7064 _na     343_aa efflux RND transporter periplasmic adaptor subunit
2153 JASOZS010000033.1 GCA030227545_00288 CDS open 7165-10722 _na     1185_aa smc chromosome segregation protein SMC
2154 JASOZS010000033.1 GCA030227545_00289 CDS open 10709-11650 _na     313_aa ftsY signal recognition particle-docking protein FtsY
2155 JASOZS010000033.1 GCA030227545_00290 CDS open 11834-12700 _na     288_aa lysR LysR family transcriptional regulator
2156 JASOZS010000033.1 GCA030227545_00280 gene open 59-1711
2157 JASOZS010000033.1 GCA030227545_00281 gene open 1767-1997
2158 JASOZS010000033.1 GCA030227545_00282 gene open 1990-2703
2159 JASOZS010000033.1 GCA030227545_00283 gene open 2705-3466
2160 JASOZS010000033.1 GCA030227545_00284 gene open 3636-4433
2161 JASOZS010000033.1 GCA030227545_00285 gene open 4503-5156
2162 JASOZS010000033.1 GCA030227545_00286 gene open 5165-5920
2163 JASOZS010000033.1 GCA030227545_00287 gene open 6033-7064
2164 JASOZS010000033.1 GCA030227545_00288 gene open 7165-10722 smc
2165 JASOZS010000033.1 GCA030227545_00289 gene open 10709-11650 ftsY
2166 JASOZS010000033.1 GCA030227545_00290 gene open 11834-12700 lysR
2167 JASOZS010000033.1 GCA030227545_00291 gene open 12860-12932 trnV
2168 JASOZS010000033.1 GCA030227545_00291 tRNA open 12860-12932 trnV tRNA-Val(tac)
2169 JASOZS010000034.1 GCA030227545_00292 CDS open 986-2074 _na     362_aa PIN/TRAM domain protein
2170 JASOZS010000034.1 GCA030227545_00293 CDS open 2185-3585 _na     466_aa radA DNA repair protein RadA
2171 JASOZS010000034.1 GCA030227545_00294 CDS open 3645-6065 _na     806_aa ATPase
2172 JASOZS010000034.1 GCA030227545_00295 CDS open 6084-6506 _na     140_aa clpC ATP-dependent Clp protease ATP-binding subunit ClpC
2173 JASOZS010000034.1 GCA030227545_00296 CDS open 6510-6944 _na     144_aa ctsR Transcriptional regulator CtsR
2174 JASOZS010000034.1 GCA030227545_00297 CDS open 7028-7465 _na     145_aa recX Regulatory protein RecX
2175 JASOZS010000034.1 GCA030227545_00298 CDS open 7455-8510 _na     351_aa recA recombinase RecA
2176 JASOZS010000034.1 GCA030227545_00299 CDS open 8492-9016 _na     174_aa cinA Competence/damage-inducible protein CinA
2177 JASOZS010000034.1 GCA030227545_00300 CDS open 9018-10364 _na     448_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
2178 JASOZS010000034.1 GCA030227545_00301 CDS open 10368-11399 _na     343_aa ABC transporter%2C solute-binding protein
2179 JASOZS010000034.1 GCA030227545_00302 CDS open 11419-12519 _na     366_aa hypothetical protein
2180 JASOZS010000034.1 GCA030227545_00292 gene open 986-2074
2181 JASOZS010000034.1 GCA030227545_00293 gene open 2185-3585 radA
2182 JASOZS010000034.1 GCA030227545_00294 gene open 3645-6065
2183 JASOZS010000034.1 GCA030227545_00295 gene open 6084-6506 clpC
2184 JASOZS010000034.1 GCA030227545_00296 gene open 6510-6944 ctsR
2185 JASOZS010000034.1 GCA030227545_00297 gene open 7028-7465 recX
2186 JASOZS010000034.1 GCA030227545_00298 gene open 7455-8510 recA
2187 JASOZS010000034.1 GCA030227545_00299 gene open 8492-9016 cinA
2188 JASOZS010000034.1 GCA030227545_00300 gene open 9018-10364 rimO
2189 JASOZS010000034.1 GCA030227545_00301 gene open 10368-11399
2190 JASOZS010000034.1 GCA030227545_00302 gene open 11419-12519
2191 JASOZS010000035.1 GCA030227545_00303 CDS open 74-328 _na     84_aa hypothetical protein
2192 JASOZS010000035.1 GCA030227545_00304 CDS open 356-1117 _na     253_aa ABC transporter permease
2193 JASOZS010000035.1 GCA030227545_00305 CDS open 1126-1890 _na     254_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
2194 JASOZS010000035.1 GCA030227545_00306 CDS open 1887-3038 _na     383_aa Mce/MlaD domain-containing protein
2195 JASOZS010000035.1 GCA030227545_00307 CDS open 3049-4488 _na     479_aa Outer membrane efflux protein
2196 JASOZS010000035.1 GCA030227545_00308 CDS open 4609-8877 _na     1422_aa tamB Translocation and assembly module TamB
2197 JASOZS010000035.1 GCA030227545_00309 CDS open 9066-11417 _na     783_aa Outer membrane protein%2C OMP85 family
2198 JASOZS010000035.1 GCA030227545_00310 CDS open 11516-12040 _na     174_aa Outer membrane chaperone Skp (OmpH)
2199 JASOZS010000035.1 GCA030227545_00303 gene open 74-328
2200 JASOZS010000035.1 GCA030227545_00304 gene open 356-1117
2201 JASOZS010000035.1 GCA030227545_00305 gene open 1126-1890
2202 JASOZS010000035.1 GCA030227545_00306 gene open 1887-3038
2203 JASOZS010000035.1 GCA030227545_00307 gene open 3049-4488
2204 JASOZS010000035.1 GCA030227545_00308 gene open 4609-8877 tamB
2205 JASOZS010000035.1 GCA030227545_00309 gene open 9066-11417
2206 JASOZS010000035.1 GCA030227545_00310 gene open 11516-12040
2207 JASOZS010000036.1 GCA030227545_00311 CDS open 634-1116 _na     160_aa N-acetyltransferase domain-containing protein
2208 JASOZS010000036.1 GCA030227545_00312 CDS open 1120-3543 _na     807_aa Tail tubular protein B
2209 JASOZS010000036.1 GCA030227545_00313 CDS open 3547-4101 _na     184_aa Tail tubular protein A
2210 JASOZS010000036.1 GCA030227545_00314 CDS open 4222-5184 _na     320_aa Capsid Gp10A/Gp10B-like domain-containing protein
2211 JASOZS010000036.1 GCA030227545_00315 CDS open 5216-5977 _na     253_aa Phage T7 capsid assembly protein
2212 JASOZS010000036.1 GCA030227545_00316 CDS open 5997-7547 _na     516_aa Head-to-tail joining protein
2213 JASOZS010000036.1 GCA030227545_00317 CDS open 7549-7743 _na     64_aa hypothetical protein
2214 JASOZS010000036.1 GCA030227545_00318 CDS open 7766-7951 _na     61_aa hypothetical protein
2215 JASOZS010000036.1 GCA030227545_00319 CDS open 7991-8188 _na     65_aa hypothetical protein
2216 JASOZS010000036.1 GCA030227545_00320 CDS open 8164-8952 _na     262_aa Putative Exodeoxyribonuclease
2217 JASOZS010000036.1 GCA030227545_00321 CDS open 8939-9439 _na     166_aa DNA polymerase
2218 JASOZS010000036.1 GCA030227545_00322 CDS open 9585-10082 _na     165_aa endonuclease VII domain-containing protein
2219 JASOZS010000036.1 GCA030227545_00323 CDS open 10122-11516 _na     464_aa DNA polymerase
2220 JASOZS010000036.1 GCA030227545_00324 CDS open 11534-11773 _na     79_aa hypothetical protein
2221 JASOZS010000036.1 GCA030227545_00325 CDS open 11763-11939 _na     58_aa yozE YozE SAM-like domain-containing protein
2222 JASOZS010000036.1 GCA030227545_00326 CDS open 11957-12619 _na     220_aa DnaB-like helicase C-terminal domain-containing protein
2223 JASOZS010000036.1 GCA030227545_00311 gene open 634-1116
2224 JASOZS010000036.1 GCA030227545_00312 gene open 1120-3543
2225 JASOZS010000036.1 GCA030227545_00313 gene open 3547-4101
2226 JASOZS010000036.1 GCA030227545_00314 gene open 4222-5184
2227 JASOZS010000036.1 GCA030227545_00315 gene open 5216-5977
2228 JASOZS010000036.1 GCA030227545_00316 gene open 5997-7547
2229 JASOZS010000036.1 GCA030227545_00317 gene open 7549-7743
2230 JASOZS010000036.1 GCA030227545_00318 gene open 7766-7951
2231 JASOZS010000036.1 GCA030227545_00319 gene open 7991-8188
2232 JASOZS010000036.1 GCA030227545_00320 gene open 8164-8952
2233 JASOZS010000036.1 GCA030227545_00321 gene open 8939-9439
2234 JASOZS010000036.1 GCA030227545_00322 gene open 9585-10082
2235 JASOZS010000036.1 GCA030227545_00323 gene open 10122-11516
2236 JASOZS010000036.1 GCA030227545_00324 gene open 11534-11773
2237 JASOZS010000036.1 GCA030227545_00325 gene open 11763-11939 yozE
2238 JASOZS010000036.1 GCA030227545_00326 gene open 11957-12619
2239 JASOZS010000037.1 GCA030227545_00327 CDS open 86-1183 _na     365_aa alr alanine racemase
2240 JASOZS010000037.1 GCA030227545_00328 CDS open 1268-2404 _na     378_aa hemW radical SAM family heme chaperone HemW
2241 JASOZS010000037.1 GCA030227545_00329 CDS open 2397-4193 _na     598_aa lepA translation elongation factor 4
2242 JASOZS010000037.1 GCA030227545_00330 CDS open 4248-5684 _na     478_aa APC family amino acid-polyamine-organocation transporter
2243 JASOZS010000037.1 GCA030227545_00332 CDS open 5997-7229 _na     410_aa Aluminum resistance protein
2244 JASOZS010000037.1 GCA030227545_00333 CDS open 7230-8147 _na     305_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
2245 JASOZS010000037.1 GCA030227545_00334 CDS open 8144-8911 _na     255_aa SAM-dependent methyltransferase
2246 JASOZS010000037.1 GCA030227545_00335 CDS open 8908-10776 _na     622_aa mutL DNA mismatch repair endonuclease MutL
2247 JASOZS010000037.1 GCA030227545_00336 CDS open 10776-11879 _na     367_aa hypothetical protein
2248 JASOZS010000037.1 GCA030227545_00327 gene open 86-1183 alr
2249 JASOZS010000037.1 GCA030227545_00328 gene open 1268-2404 hemW
2250 JASOZS010000037.1 GCA030227545_00329 gene open 2397-4193 lepA
2251 JASOZS010000037.1 GCA030227545_00330 gene open 4248-5684
2252 JASOZS010000037.1 GCA030227545_00332 gene open 5997-7229
2253 JASOZS010000037.1 GCA030227545_00333 gene open 7230-8147 miaA
2254 JASOZS010000037.1 GCA030227545_00334 gene open 8144-8911
2255 JASOZS010000037.1 GCA030227545_00335 gene open 8908-10776 mutL
2256 JASOZS010000037.1 GCA030227545_00336 gene open 10776-11879
2257 JASOZS010000037.1 GCA030227545_00331 gene open 5890-5966 trnV
2258 JASOZS010000037.1 GCA030227545_00331 tRNA open 5890-5966 trnV tRNA-Val(gac)
2259 JASOZS010000038.1 GCA030227545_00337 CDS open 609-1628 _na     339_aa Diacylglycerol kinase catalytic domain protein
2260 JASOZS010000038.1 GCA030227545_00338 CDS open 1720-2736 _na     338_aa UDP-N-acetylglucosamine kinase
2261 JASOZS010000038.1 GCA030227545_00339 CDS open 3014-4345 _na     443_aa hypothetical protein
2262 JASOZS010000038.1 GCA030227545_00340 CDS open 4371-5033 _na     220_aa sdaAB L-serine ammonia-lyase%2C iron-sulfur-dependent subunit beta
2263 JASOZS010000038.1 GCA030227545_00341 CDS open 5044-5913 _na     289_aa sdaAA L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha
2264 JASOZS010000038.1 GCA030227545_00342 CDS open 5968-6663 _na     231_aa Type VII secretion system protein EssD-like domain-containing protein
2265 JASOZS010000038.1 GCA030227545_00343 CDS open 6738-8933 _na     731_aa Ornithine decarboxylase
2266 JASOZS010000038.1 GCA030227545_00337 gene open 609-1628
2267 JASOZS010000038.1 GCA030227545_00338 gene open 1720-2736
2268 JASOZS010000038.1 GCA030227545_00339 gene open 3014-4345
2269 JASOZS010000038.1 GCA030227545_00340 gene open 4371-5033 sdaAB
2270 JASOZS010000038.1 GCA030227545_00341 gene open 5044-5913 sdaAA
2271 JASOZS010000038.1 GCA030227545_00342 gene open 5968-6663
2272 JASOZS010000038.1 GCA030227545_00343 gene open 6738-8933
2273 JASOZS010000039.1 GCA030227545_00344 CDS open 86-568 _na     160_aa ybaK Cys-tRNA(Pro) deacylase
2274 JASOZS010000039.1 GCA030227545_00345 CDS open 791-1756 _na     321_aa aspartate carbamoyltransferase catalytic subunit
2275 JASOZS010000039.1 GCA030227545_00346 CDS open 1734-3029 _na     431_aa Dihydroorotase
2276 JASOZS010000039.1 GCA030227545_00347 CDS open 3026-4093 _na     355_aa carbamoyl phosphate synthase small subunit
2277 JASOZS010000039.1 GCA030227545_00348 CDS open 4086-7292 _na     1068_aa carB carbamoyl-phosphate synthase large subunit
2278 JASOZS010000039.1 GCA030227545_00349 CDS open 7294-8058 _na     254_aa Dihydroorotate dehydrogenase B (NAD(+))%2C electron transfer subunit
2279 JASOZS010000039.1 GCA030227545_00350 CDS open 8055-8960 _na     301_aa dihydroorotate dehydrogenase
2280 JASOZS010000039.1 GCA030227545_00351 CDS open 9126-10238 _na     370_aa hypothetical protein
2281 JASOZS010000039.1 GCA030227545_00344 gene open 86-568 ybaK
2282 JASOZS010000039.1 GCA030227545_00345 gene open 791-1756
2283 JASOZS010000039.1 GCA030227545_00346 gene open 1734-3029
2284 JASOZS010000039.1 GCA030227545_00347 gene open 3026-4093
2285 JASOZS010000039.1 GCA030227545_00348 gene open 4086-7292 carB
2286 JASOZS010000039.1 GCA030227545_00349 gene open 7294-8058
2287 JASOZS010000039.1 GCA030227545_00350 gene open 8055-8960
2288 JASOZS010000039.1 GCA030227545_00351 gene open 9126-10238
2289 JASOZS010000040.1 GCA030227545_00352 CDS open 45-3953 _na     1302_aa Eco57I restriction-modification methylase domain-containing protein
2290 JASOZS010000040.1 GCA030227545_00353 CDS open 4053-4265 _na     70_aa HTH cro/C1-type domain-containing protein
2291 JASOZS010000040.1 GCA030227545_00354 CDS open 4269-4802 _na     177_aa RDD family protein
2292 JASOZS010000040.1 GCA030227545_00355 CDS open 4799-5029 _na     76_aa YgiT-type zinc finger domain-containing protein
2293 JASOZS010000040.1 GCA030227545_00356 CDS open 5129-5371 _na     80_aa DUF3847 domain-containing protein
2294 JASOZS010000040.1 GCA030227545_00357 CDS open 5659-6402 _na     247_aa Fluoroquinolones export ATP-binding protein/MT2762
2295 JASOZS010000040.1 GCA030227545_00358 CDS open 6383-7108 _na     241_aa ABC-2 family transporter protein
2296 JASOZS010000040.1 GCA030227545_00359 CDS open 7117-7884 _na     255_aa ABC-2 type transporter
2297 JASOZS010000040.1 GCA030227545_00360 CDS open 7896-8576 _na     226_aa Response regulator receiver domain protein
2298 JASOZS010000040.1 GCA030227545_00361 CDS open 8566-9642 _na     358_aa histidine kinase
2299 JASOZS010000040.1 GCA030227545_00362 CDS open 9715-10005 _na     96_aa DUF3847 domain-containing protein
2300 JASOZS010000040.1 GCA030227545_00352 gene open 45-3953
2301 JASOZS010000040.1 GCA030227545_00353 gene open 4053-4265
2302 JASOZS010000040.1 GCA030227545_00354 gene open 4269-4802
2303 JASOZS010000040.1 GCA030227545_00355 gene open 4799-5029
2304 JASOZS010000040.1 GCA030227545_00356 gene open 5129-5371
2305 JASOZS010000040.1 GCA030227545_00357 gene open 5659-6402
2306 JASOZS010000040.1 GCA030227545_00358 gene open 6383-7108
2307 JASOZS010000040.1 GCA030227545_00359 gene open 7117-7884
2308 JASOZS010000040.1 GCA030227545_00360 gene open 7896-8576
2309 JASOZS010000040.1 GCA030227545_00361 gene open 8566-9642
2310 JASOZS010000040.1 GCA030227545_00362 gene open 9715-10005
2311 JASOZS010000041.1 GCA030227545_00363 CDS open 102-884 _na     260_aa Arginine ABC superfamily ATP binding cassette transporter%2C binding protein
2312 JASOZS010000041.1 GCA030227545_00364 CDS open 1151-1741 _na     196_aa dedA DedA family protein
2313 JASOZS010000041.1 GCA030227545_00365 CDS open 1808-3475 _na     555_aa Dolichyl-phosphate-mannose-protein mannosyltransferase
2314 JASOZS010000041.1 GCA030227545_00366 CDS open 3450-4169 _na     239_aa Uracil-DNA glycosylase-like domain-containing protein
2315 JASOZS010000041.1 GCA030227545_00367 CDS open 4206-4604 _na     132_aa GtrA/DPMS transmembrane domain-containing protein
2316 JASOZS010000041.1 GCA030227545_00368 CDS open 4610-5308 _na     232_aa DUF4176 domain-containing protein
2317 JASOZS010000041.1 GCA030227545_00369 CDS open 5292-5909 _na     205_aa Transglycosylase SLT domain protein
2318 JASOZS010000041.1 GCA030227545_00370 CDS open 5912-6523 _na     203_aa coaE dephospho-CoA kinase
2319 JASOZS010000041.1 GCA030227545_00371 CDS open 6523-9096 _na     857_aa polA DNA polymerase I
2320 JASOZS010000041.1 GCA030227545_00363 gene open 102-884
2321 JASOZS010000041.1 GCA030227545_00364 gene open 1151-1741 dedA
2322 JASOZS010000041.1 GCA030227545_00365 gene open 1808-3475
2323 JASOZS010000041.1 GCA030227545_00366 gene open 3450-4169
2324 JASOZS010000041.1 GCA030227545_00367 gene open 4206-4604
2325 JASOZS010000041.1 GCA030227545_00368 gene open 4610-5308
2326 JASOZS010000041.1 GCA030227545_00369 gene open 5292-5909
2327 JASOZS010000041.1 GCA030227545_00370 gene open 5912-6523 coaE
2328 JASOZS010000041.1 GCA030227545_00371 gene open 6523-9096 polA
2329 JASOZS010000041.1 GCA030227545_00372 gene open 9221-9306 trnL
2330 JASOZS010000041.1 GCA030227545_00373 gene open 9336-9422 trnL
2331 JASOZS010000041.1 GCA030227545_00374 gene open 9432-9507 trnF
2332 JASOZS010000041.1 GCA030227545_00375 gene open 9512-9588 trnD
2333 JASOZS010000041.1 GCA030227545_00376 gene open 9591-9666 trnV
2334 JASOZS010000041.1 GCA030227545_00372 tRNA open 9221-9306 trnL tRNA-Leu(cag)
2335 JASOZS010000041.1 GCA030227545_00373 tRNA open 9336-9422 trnL tRNA-Leu(gag)
2336 JASOZS010000041.1 GCA030227545_00374 tRNA open 9432-9507 trnF tRNA-Phe(gaa)
2337 JASOZS010000041.1 GCA030227545_00375 tRNA open 9512-9588 trnD tRNA-Asp(gtc)
2338 JASOZS010000041.1 GCA030227545_00376 tRNA open 9591-9666 trnV tRNA-Val(tac)
2339 JASOZS010000042.1 GCA030227545_00377 CDS open 510-1955 _na     481_aa nhaC NhaC family sodium:proton (Na+:H+) antiporter
2340 JASOZS010000042.1 GCA030227545_00378 CDS open 1993-2898 _na     301_aa Acetamidase/formamidase
2341 JASOZS010000042.1 GCA030227545_00379 CDS open 3030-3422 _na     130_aa Pyridoxamine 5'-phosphate oxidase
2342 JASOZS010000042.1 GCA030227545_00380 CDS open 3674-4573 _na     299_aa Acetamidase/formamidase
2343 JASOZS010000042.1 GCA030227545_00381 CDS open 5398-5790 _na     130_aa merR Hg(II)-responsive transcriptional regulator
2344 JASOZS010000042.1 GCA030227545_00382 CDS open 5819-7714 _na     631_aa merA mercury(II) reductase
2345 JASOZS010000042.1 GCA030227545_00383 CDS open 7865-9196 _na     443_aa ISL3 family transposase
2346 JASOZS010000042.1 GCA030227545_00377 gene open 510-1955 nhaC
2347 JASOZS010000042.1 GCA030227545_00378 gene open 1993-2898
2348 JASOZS010000042.1 GCA030227545_00379 gene open 3030-3422
2349 JASOZS010000042.1 GCA030227545_00380 gene open 3674-4573
2350 JASOZS010000042.1 GCA030227545_00381 gene open 5398-5790 merR
2351 JASOZS010000042.1 GCA030227545_00382 gene open 5819-7714 merA
2352 JASOZS010000042.1 GCA030227545_00383 gene open 7865-9196
2353 JASOZS010000043.1 GCA030227545_00384 CDS open 230-1021 _na     263_aa hypothetical protein
2354 JASOZS010000043.1 GCA030227545_00385 CDS open 1201-1386 _na     61_aa rpmF 50S ribosomal protein L32
2355 JASOZS010000043.1 GCA030227545_00386 CDS open 1429-2505 _na     358_aa ABC superfamily ATP binding cassette transporter substrate binding protein
2356 JASOZS010000043.1 GCA030227545_00387 CDS open 2637-2906 _na     89_aa rpsO 30S ribosomal protein S15
2357 JASOZS010000043.1 GCA030227545_00388 CDS open 3032-3619 _na     195_aa XTP/dITP diphosphatase
2358 JASOZS010000043.1 GCA030227545_00389 CDS open 3663-4481 _na     272_aa speD adenosylmethionine decarboxylase
2359 JASOZS010000043.1 GCA030227545_00390 CDS open 4495-5697 _na     400_aa NADP-dependent malate dehydrogenase (Oxaloacetate-decarboxylating)
2360 JASOZS010000043.1 GCA030227545_00391 CDS open 5867-7339 _na     490_aa RNA nucleotidyltransferase
2361 JASOZS010000043.1 GCA030227545_00392 CDS open 7326-9290 _na     654_aa Penicillin-binding protein 2B
2362 JASOZS010000043.1 GCA030227545_00384 gene open 230-1021
2363 JASOZS010000043.1 GCA030227545_00385 gene open 1201-1386 rpmF
2364 JASOZS010000043.1 GCA030227545_00386 gene open 1429-2505
2365 JASOZS010000043.1 GCA030227545_00387 gene open 2637-2906 rpsO
2366 JASOZS010000043.1 GCA030227545_00388 gene open 3032-3619
2367 JASOZS010000043.1 GCA030227545_00389 gene open 3663-4481 speD
2368 JASOZS010000043.1 GCA030227545_00390 gene open 4495-5697
2369 JASOZS010000043.1 GCA030227545_00391 gene open 5867-7339
2370 JASOZS010000043.1 GCA030227545_00392 gene open 7326-9290
2371 JASOZS010000044.1 GCA030227545_00393 CDS open 447-641 _na     64_aa hypothetical protein
2372 JASOZS010000044.1 GCA030227545_00394 CDS open 1651-2238 _na     195_aa Exonuclease
2373 JASOZS010000044.1 GCA030227545_00395 CDS open 2366-3286 _na     306_aa lysR LysR family transcriptional regulator
2374 JASOZS010000044.1 GCA030227545_00396 CDS open 3729-5039 _na     436_aa potE putrescine-ornithine antiporter
2375 JASOZS010000044.1 GCA030227545_00397 CDS open 5120-7303 _na     727_aa Ornithine decarboxylase
2376 JASOZS010000044.1 GCA030227545_00398 CDS open 7790-8968 _na     392_aa hrtB Putative hemin transport system permease protein HrtB
2377 JASOZS010000044.1 GCA030227545_00393 gene open 447-641
2378 JASOZS010000044.1 GCA030227545_00394 gene open 1651-2238
2379 JASOZS010000044.1 GCA030227545_00395 gene open 2366-3286 lysR
2380 JASOZS010000044.1 GCA030227545_00396 gene open 3729-5039 potE
2381 JASOZS010000044.1 GCA030227545_00397 gene open 5120-7303
2382 JASOZS010000044.1 GCA030227545_00398 gene open 7790-8968 hrtB
2383 JASOZS010000045.1 GCA030227545_00400 CDS open 530-691 _na     53_aa hypothetical protein
2384 JASOZS010000045.1 GCA030227545_00401 CDS open 812-925 _na     37_aa hypothetical protein
2385 JASOZS010000045.1 GCA030227545_00402 CDS open 964-1935 _na     323_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
2386 JASOZS010000045.1 GCA030227545_00403 CDS open 1974-2558 _na     194_aa hypothetical protein
2387 JASOZS010000045.1 GCA030227545_00404 CDS open 2699-2830 _na     43_aa hypothetical protein
2388 JASOZS010000045.1 GCA030227545_00405 CDS open 2981-4681 _na     566_aa terL phage terminase large subunit
2389 JASOZS010000045.1 GCA030227545_00406 CDS open 4795-5025 _na     76_aa hypothetical protein
2390 JASOZS010000045.1 GCA030227545_00407 CDS open 4979-5119 _na     46_aa hypothetical protein
2391 JASOZS010000045.1 GCA030227545_00408 CDS open 5167-5898 _na     243_aa hypothetical protein
2392 JASOZS010000045.1 GCA030227545_00409 CDS open 6025-6480 _na     151_aa Putative muramidase-2
2393 JASOZS010000045.1 GCA030227545_00410 CDS open 6470-6724 _na     84_aa hypothetical protein
2394 JASOZS010000045.1 GCA030227545_00411 CDS open 7115-8095 _na     326_aa hypothetical protein
2395 JASOZS010000045.1 GCA030227545_00400 gene open 530-691
2396 JASOZS010000045.1 GCA030227545_00401 gene open 812-925
2397 JASOZS010000045.1 GCA030227545_00402 gene open 964-1935
2398 JASOZS010000045.1 GCA030227545_00403 gene open 1974-2558
2399 JASOZS010000045.1 GCA030227545_00404 gene open 2699-2830
2400 JASOZS010000045.1 GCA030227545_00405 gene open 2981-4681 terL
2401 JASOZS010000045.1 GCA030227545_00406 gene open 4795-5025
2402 JASOZS010000045.1 GCA030227545_00407 gene open 4979-5119
2403 JASOZS010000045.1 GCA030227545_00408 gene open 5167-5898
2404 JASOZS010000045.1 GCA030227545_00409 gene open 6025-6480
2405 JASOZS010000045.1 GCA030227545_00410 gene open 6470-6724
2406 JASOZS010000045.1 GCA030227545_00411 gene open 7115-8095
2407 JASOZS010000045.1 GCA030227545_00399 gene open 318-410 trnS
2408 JASOZS010000045.1 GCA030227545_00399 tRNA open 318-410 trnS tRNA-Ser(gga)
2409 JASOZS010000046.1 GCA030227545_00412 CDS open 1251-1529 _na     92_aa DUF4198 domain-containing protein
2410 JASOZS010000046.1 GCA030227545_00413 CDS open 1533-1739 _na     68_aa hypothetical protein
2411 JASOZS010000046.1 GCA030227545_00414 CDS open 2011-3165 _na     384_aa ABC superfamily ATP binding cassette transporter
2412 JASOZS010000046.1 GCA030227545_00415 CDS open 3165-4310 _na     381_aa ABC-2 type transporter transmembrane domain-containing protein
2413 JASOZS010000046.1 GCA030227545_00416 CDS open 4324-5172 _na     282_aa hlyD HlyD family secretion protein
2414 JASOZS010000046.1 GCA030227545_00417 CDS open 5912-6484 _na     190_aa ESPR domain-containing protein
2415 JASOZS010000046.1 GCA030227545_00412 gene open 1251-1529
2416 JASOZS010000046.1 GCA030227545_00413 gene open 1533-1739
2417 JASOZS010000046.1 GCA030227545_00414 gene open 2011-3165
2418 JASOZS010000046.1 GCA030227545_00415 gene open 3165-4310
2419 JASOZS010000046.1 GCA030227545_00416 gene open 4324-5172 hlyD
2420 JASOZS010000046.1 GCA030227545_00417 gene open 5912-6484
2421 JASOZS010000047.1 GCA030227545_00418 CDS open 15-1292 _na     425_aa phosphoethanolamine transferase
2422 JASOZS010000047.1 GCA030227545_00419 CDS open 1320-1979 _na     219_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
2423 JASOZS010000047.1 GCA030227545_00420 CDS open 1943-3241 _na     432_aa ftsW putative peptidoglycan glycosyltransferase FtsW
2424 JASOZS010000047.1 GCA030227545_00421 CDS open 3250-3681 _na     143_aa Transposase
2425 JASOZS010000047.1 GCA030227545_00422 CDS open 3745-4683 _na     312_aa Cytochrome D ubiquinol oxidase subunit II
2426 JASOZS010000047.1 GCA030227545_00423 CDS open 4695-4859 _na     54_aa Tryptophan--tRNA ligase
2427 JASOZS010000047.1 GCA030227545_00418 gene open 15-1292
2428 JASOZS010000047.1 GCA030227545_00419 gene open 1320-1979 trmB
2429 JASOZS010000047.1 GCA030227545_00420 gene open 1943-3241 ftsW
2430 JASOZS010000047.1 GCA030227545_00421 gene open 3250-3681
2431 JASOZS010000047.1 GCA030227545_00422 gene open 3745-4683
2432 JASOZS010000047.1 GCA030227545_00423 gene open 4695-4859
2433 JASOZS010000048.1 GCA030227545_00424 CDS open 471-1457 _na     328_aa tRNA pseudouridine synthase A
2434 JASOZS010000048.1 GCA030227545_00425 CDS open 1477-2397 _na     306_aa UDP-glucose 4-epimerase
2435 JASOZS010000048.1 GCA030227545_00426 CDS open 2425-3129 _na     234_aa DNA-binding response regulator
2436 JASOZS010000048.1 GCA030227545_00427 CDS open 3122-4252 _na     376_aa histidine kinase
2437 JASOZS010000048.1 GCA030227545_00428 CDS open 4268-5032 _na     254_aa exodeoxyribonuclease III
2438 JASOZS010000048.1 GCA030227545_00429 CDS open 5224-5514 _na     96_aa ACT domain-containing protein
2439 JASOZS010000048.1 GCA030227545_00430 CDS open 5523-6881 _na     452_aa UPF0210 protein HMPREF9083_0008
2440 JASOZS010000048.1 GCA030227545_00431 CDS open 7358-7531 _na     57_aa hypothetical protein
2441 JASOZS010000048.1 GCA030227545_00424 gene open 471-1457
2442 JASOZS010000048.1 GCA030227545_00425 gene open 1477-2397
2443 JASOZS010000048.1 GCA030227545_00426 gene open 2425-3129
2444 JASOZS010000048.1 GCA030227545_00427 gene open 3122-4252
2445 JASOZS010000048.1 GCA030227545_00428 gene open 4268-5032
2446 JASOZS010000048.1 GCA030227545_00429 gene open 5224-5514
2447 JASOZS010000048.1 GCA030227545_00430 gene open 5523-6881
2448 JASOZS010000048.1 GCA030227545_00431 gene open 7358-7531
2449 JASOZS010000049.1 GCA030227545_00432 CDS open 276-1661 _na     461_aa ltrA group II intron reverse transcriptase/maturase
2450 JASOZS010000049.1 GCA030227545_00433 CDS open 2016-3305 _na     429_aa DNA methylase
2451 JASOZS010000049.1 GCA030227545_00434 CDS open 3292-3876 _na     194_aa DNA (cytosine-5-)-methyltransferase
2452 JASOZS010000049.1 GCA030227545_00435 CDS open 3916-4257 _na     113_aa DNA (cytosine-5-)-methyltransferase
2453 JASOZS010000049.1 GCA030227545_00436 CDS open 4250-5971 _na     573_aa topA DNA topoisomerase
2454 JASOZS010000049.1 GCA030227545_00437 CDS open 6065-7048 _na     327_aa Nucleotidyl transferase%2C PF08843 family
2455 JASOZS010000049.1 GCA030227545_00438 CDS open 7041-7652 _na     203_aa Transcriptional regulator%2C AbiEi antitoxin%2C Type IV TA system
2456 JASOZS010000049.1 GCA030227545_00439 CDS open 7726-8037 _na     103_aa hypothetical protein
2457 JASOZS010000049.1 GCA030227545_00432 gene open 276-1661 ltrA
2458 JASOZS010000049.1 GCA030227545_00433 gene open 2016-3305
2459 JASOZS010000049.1 GCA030227545_00434 gene open 3292-3876
2460 JASOZS010000049.1 GCA030227545_00435 gene open 3916-4257
2461 JASOZS010000049.1 GCA030227545_00436 gene open 4250-5971 topA
2462 JASOZS010000049.1 GCA030227545_00437 gene open 6065-7048
2463 JASOZS010000049.1 GCA030227545_00438 gene open 7041-7652
2464 JASOZS010000049.1 GCA030227545_00439 gene open 7726-8037
2465 JASOZS010000050.1 GCA030227545_00440 CDS open 426-545 _na     39_aa Cardiolipin synthase N-terminal domain-containing protein
2466 JASOZS010000050.1 GCA030227545_00441 CDS open 559-5259 _na     1566_aa internal virion protein with endolysin domain
2467 JASOZS010000050.1 GCA030227545_00442 CDS open 5280-7532 _na     750_aa hypothetical protein
2468 JASOZS010000050.1 GCA030227545_00440 gene open 426-545
2469 JASOZS010000050.1 GCA030227545_00441 gene open 559-5259
2470 JASOZS010000050.1 GCA030227545_00442 gene open 5280-7532
2471 JASOZS010000051.1 GCA030227545_00443 CDS open 49-432 _na     127_aa ATP synthase subunit I
2472 JASOZS010000051.1 GCA030227545_00444 CDS open 436-675 _na     79_aa Glutathione ABC superfamily ATP binding cassette transporter%2C permease protein
2473 JASOZS010000051.1 GCA030227545_00445 CDS open 808-1950 _na     380_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
2474 JASOZS010000051.1 GCA030227545_00446 CDS open 1947-3005 _na     352_aa UDP-N-acetylglucosamine:undecaprenyl-P N-acetylglucosaminyl 1-P transferase
2475 JASOZS010000051.1 GCA030227545_00447 CDS open 3173-4708 _na     511_aa Dolichyl-phosphate-mannose-protein mannosyltransferase
2476 JASOZS010000051.1 GCA030227545_00448 CDS open 4789-7482 _na     897_aa RNA polymerase subunit alpha
2477 JASOZS010000051.1 GCA030227545_00443 gene open 49-432
2478 JASOZS010000051.1 GCA030227545_00444 gene open 436-675
2479 JASOZS010000051.1 GCA030227545_00445 gene open 808-1950 wecB
2480 JASOZS010000051.1 GCA030227545_00446 gene open 1947-3005
2481 JASOZS010000051.1 GCA030227545_00447 gene open 3173-4708
2482 JASOZS010000051.1 GCA030227545_00448 gene open 4789-7482
2483 JASOZS010000052.1 GCA030227545_00449 CDS open 8-1990 _na     660_aa YadA-like family protein
2484 JASOZS010000052.1 GCA030227545_00450 CDS open 2114-2986 _na     290_aa Pseudouridine synthase
2485 JASOZS010000052.1 GCA030227545_00451 CDS open 2964-3815 _na     283_aa pgeF peptidoglycan editing factor PgeF
2486 JASOZS010000052.1 GCA030227545_00452 CDS open 3840-4652 _na     270_aa Oxidoreductase%2C aldo/keto reductase family protein
2487 JASOZS010000052.1 GCA030227545_00453 CDS open 4698-5636 _na     312_aa araC AraC family transcriptional regulator
2488 JASOZS010000052.1 GCA030227545_00454 CDS open 7121-7360 _na     79_aa hypothetical protein
2489 JASOZS010000052.1 GCA030227545_00449 gene open 8-1990
2490 JASOZS010000052.1 GCA030227545_00450 gene open 2114-2986
2491 JASOZS010000052.1 GCA030227545_00451 gene open 2964-3815 pgeF
2492 JASOZS010000052.1 GCA030227545_00452 gene open 3840-4652
2493 JASOZS010000052.1 GCA030227545_00453 gene open 4698-5636 araC
2494 JASOZS010000052.1 GCA030227545_00454 gene open 7121-7360
2495 JASOZS010000053.1 GCA030227545_00462 gene open 7251-7383 SpR18_sRNA
2496 JASOZS010000053.1 GCA030227545_00462 ncRNA open 7251-7383 Streptococcus sRNA SpR18
2497 JASOZS010000053.1 GCA030227545_00455 CDS open 25-660 _na     211_aa Spermidine synthase
2498 JASOZS010000053.1 GCA030227545_00456 CDS open 734-2338 _na     534_aa peptide chain release factor 3
2499 JASOZS010000053.1 GCA030227545_00457 CDS open 2680-2913 _na     77_aa hypothetical protein
2500 JASOZS010000053.1 GCA030227545_00458 CDS open 3041-4501 _na     486_aa restriction endonuclease subunit S