HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium pseudodiphtheriticum (GCA_030229195.1)

Select a Genome:
BAKTA Annotations for GCA_030229195.1
Genome Selected: Corynebacterium pseudodiphtheriticum
ContigsBases CDSrRNA tmRNAtRNA
28 2405178 2166 3 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4448 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 4448 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 JASPHD010000003.1 GCA030229195_01509 gene open 59722-61158
2502 JASPHD010000003.1 GCA030229195_01510 gene open 61209-61793
2503 JASPHD010000003.1 GCA030229195_01511 gene open 62061-62702 lpqE
2504 JASPHD010000003.1 GCA030229195_01512 gene open 62888-64447 radA
2505 JASPHD010000003.1 GCA030229195_01513 gene open 64449-65195
2506 JASPHD010000003.1 GCA030229195_01514 gene open 65405-66022
2507 JASPHD010000003.1 GCA030229195_01515 gene open 66058-66993
2508 JASPHD010000003.1 GCA030229195_01516 gene open 67140-68147
2509 JASPHD010000003.1 GCA030229195_01517 gene open 68150-69133
2510 JASPHD010000003.1 GCA030229195_01518 gene open 69133-69918
2511 JASPHD010000003.1 GCA030229195_01519 gene open 70102-71457
2512 JASPHD010000003.1 GCA030229195_01520 gene open 71691-74564
2513 JASPHD010000003.1 GCA030229195_01521 gene open 74805-76976
2514 JASPHD010000003.1 GCA030229195_01522 gene open 77230-78711
2515 JASPHD010000003.1 GCA030229195_01523 gene open 78750-80192
2516 JASPHD010000003.1 GCA030229195_01524 gene open 80237-81853 lysS
2517 JASPHD010000003.1 GCA030229195_01525 gene open 81989-83710 cstA
2518 JASPHD010000003.1 GCA030229195_01526 gene open 83733-83996
2519 JASPHD010000003.1 GCA030229195_01527 gene open 83987-84985
2520 JASPHD010000003.1 GCA030229195_01528 gene open 84990-85964
2521 JASPHD010000003.1 GCA030229195_01529 gene open 86048-87271
2522 JASPHD010000003.1 GCA030229195_01530 gene open 87286-87747
2523 JASPHD010000003.1 GCA030229195_01531 gene open 87755-88279 folK
2524 JASPHD010000003.1 GCA030229195_01532 gene open 88276-88626 folB
2525 JASPHD010000003.1 GCA030229195_01533 gene open 88681-89619 folP
2526 JASPHD010000003.1 GCA030229195_01534 gene open 89629-90225 folE
2527 JASPHD010000003.1 GCA030229195_01535 gene open 90218-92557 ftsH
2528 JASPHD010000003.1 GCA030229195_01536 gene open 92607-93218 hpt
2529 JASPHD010000003.1 GCA030229195_01537 gene open 93303-94478
2530 JASPHD010000003.1 GCA030229195_01538 gene open 94491-95828 dacB
2531 JASPHD010000003.1 GCA030229195_01539 gene open 96003-96479
2532 JASPHD010000003.1 GCA030229195_01540 gene open 96669-97481
2533 JASPHD010000003.1 GCA030229195_01541 gene open 97695-98021
2534 JASPHD010000003.1 GCA030229195_01542 gene open 98030-98929 ppk2
2535 JASPHD010000003.1 GCA030229195_01543 gene open 99087-99209
2536 JASPHD010000003.1 GCA030229195_01544 gene open 99295-99492
2537 JASPHD010000003.1 GCA030229195_01545 gene open 100048-101694 groL
2538 JASPHD010000003.1 GCA030229195_01546 gene open 101931-103391
2539 JASPHD010000003.1 GCA030229195_01547 gene open 103415-104812
2540 JASPHD010000003.1 GCA030229195_01548 gene open 104863-107922
2541 JASPHD010000003.1 GCA030229195_01549 gene open 107922-108428
2542 JASPHD010000003.1 GCA030229195_01550 gene open 108421-110223
2543 JASPHD010000003.1 GCA030229195_01551 gene open 110223-110798
2544 JASPHD010000003.1 GCA030229195_01552 gene open 110802-111077
2545 JASPHD010000003.1 GCA030229195_01553 gene open 111080-111478
2546 JASPHD010000003.1 GCA030229195_01554 gene open 111487-112665
2547 JASPHD010000003.1 GCA030229195_01555 gene open 112665-113462
2548 JASPHD010000003.1 GCA030229195_01556 gene open 113506-113793
2549 JASPHD010000003.1 GCA030229195_01557 gene open 113798-114409
2550 JASPHD010000003.1 GCA030229195_01558 gene open 114419-115489
2551 JASPHD010000003.1 GCA030229195_01559 gene open 115525-116349
2552 JASPHD010000003.1 GCA030229195_01560 gene open 116353-117945
2553 JASPHD010000003.1 GCA030229195_01561 gene open 117955-118464
2554 JASPHD010000003.1 GCA030229195_01562 gene open 118515-120041
2555 JASPHD010000003.1 GCA030229195_01563 gene open 120038-121129
2556 JASPHD010000003.1 GCA030229195_01564 gene open 121130-123586
2557 JASPHD010000003.1 GCA030229195_01565 gene open 123583-125130 purT
2558 JASPHD010000003.1 GCA030229195_01566 gene open 125137-126429
2559 JASPHD010000003.1 GCA030229195_01567 gene open 126527-127504
2560 JASPHD010000003.1 GCA030229195_01568 gene open 127545-128774
2561 JASPHD010000003.1 GCA030229195_01569 gene open 128817-129851 fbaA
2562 JASPHD010000003.1 GCA030229195_01570 gene open 129910-131115
2563 JASPHD010000003.1 GCA030229195_01571 gene open 131227-131928 spoU
2564 JASPHD010000003.1 GCA030229195_01572 gene open 131928-132485
2565 JASPHD010000003.1 GCA030229195_01573 gene open 132503-134230
2566 JASPHD010000003.1 GCA030229195_01574 gene open 134240-135070
2567 JASPHD010000003.1 GCA030229195_01575 gene open 135128-137686 clpB
2568 JASPHD010000003.1 GCA030229195_01576 gene open 137683-137880
2569 JASPHD010000003.1 GCA030229195_01577 gene open 137898-139295
2570 JASPHD010000003.1 GCA030229195_01578 gene open 139446-140768
2571 JASPHD010000003.1 GCA030229195_01579 gene open 140765-141031
2572 JASPHD010000003.1 GCA030229195_01580 gene open 141329-143368
2573 JASPHD010000003.1 GCA030229195_01581 gene open 143437-144081
2574 JASPHD010000003.1 GCA030229195_01582 gene open 144106-144933
2575 JASPHD010000003.1 GCA030229195_01583 gene open 145046-145339
2576 JASPHD010000003.1 GCA030229195_01584 gene open 145342-146622
2577 JASPHD010000003.1 GCA030229195_01585 gene open 146703-147161 hspR
2578 JASPHD010000003.1 GCA030229195_01586 gene open 147192-148382 dnaJ
2579 JASPHD010000003.1 GCA030229195_01587 gene open 148408-149130 grpE
2580 JASPHD010000003.1 GCA030229195_01588 gene open 149131-150993 dnaK
2581 JASPHD010000003.1 GCA030229195_01589 gene open 151404-154859
2582 JASPHD010000003.1 GCA030229195_01590 gene open 154951-156327
2583 JASPHD010000003.1 GCA030229195_01591 gene open 156364-157461
2584 JASPHD010000003.1 GCA030229195_01592 gene open 157488-157994
2585 JASPHD010000003.1 GCA030229195_01593 gene open 158170-158964
2586 JASPHD010000003.1 GCA030229195_01594 gene open 158945-159685
2587 JASPHD010000003.1 GCA030229195_01595 gene open 159676-160908
2588 JASPHD010000003.1 GCA030229195_01596 gene open 160977-161603
2589 JASPHD010000003.1 GCA030229195_01597 gene open 161625-162860
2590 JASPHD010000003.1 GCA030229195_01598 gene open 162844-163395
2591 JASPHD010000003.1 GCA030229195_01599 gene open 163659-163784
2592 JASPHD010000003.1 GCA030229195_01600 gene open 163793-164056
2593 JASPHD010000003.1 GCA030229195_01601 gene open 164167-165513
2594 JASPHD010000003.1 GCA030229195_01602 gene open 165583-167211
2595 JASPHD010000003.1 GCA030229195_01603 gene open 167888-168253
2596 JASPHD010000003.1 GCA030229195_01453 gene open 188-260 trnK
2597 JASPHD010000003.1 GCA030229195_01489 gene open 41483-41555 trnT
2598 JASPHD010000003.1 GCA030229195_01453 tRNA open 188-260 trnK tRNA-Lys(ttt)
2599 JASPHD010000003.1 GCA030229195_01489 tRNA open 41483-41555 trnT tRNA-Thr(tgt)
2600 JASPHD010000004.1 repeat_region open 118829-123443 CRISPR array with 76 repeats of length 28%2C consensus sequence GTTTTCCCCGCGCATGCGGGGATGAGCC and spacer length 33
2601 JASPHD010000004.1 repeat_region open 123628-125435 CRISPR array with 30 repeats of length 28%2C consensus sequence GTTTTCCCCGCGCATGCGGGGATGAGCC and spacer length 33
2602 JASPHD010000004.1 GCA030229195_01604 CDS open 339-935 _na     198_aa cadD Cadmium resistance transporter
2603 JASPHD010000004.1 GCA030229195_01605 CDS open 936-1295 _na     119_aa arsR HTH arsR-type domain-containing protein
2604 JASPHD010000004.1 GCA030229195_01606 CDS open 2031-2249 _na     72_aa Transposase
2605 JASPHD010000004.1 GCA030229195_01607 CDS open 2339-2641 _na     100_aa Multicopper oxidase domain-containing protein
2606 JASPHD010000004.1 GCA030229195_01608 CDS open 2713-3819 _na     368_aa Plastocyanin-like domain-containing protein
2607 JASPHD010000004.1 GCA030229195_01609 CDS open 3891-4466 _na     191_aa Secreted protein
2608 JASPHD010000004.1 GCA030229195_01610 CDS open 4786-5592 _na     268_aa ompR Two-component system response regulator
2609 JASPHD010000004.1 GCA030229195_01611 CDS open 5589-6716 _na     375_aa baeS histidine kinase
2610 JASPHD010000004.1 GCA030229195_01612 CDS open 6831-7157 _na     108_aa copZ HMA domain-containing protein
2611 JASPHD010000004.1 GCA030229195_01613 CDS open 7209-9398 _na     729_aa zntA Copper-exporting ATPase
2612 JASPHD010000004.1 GCA030229195_01614 CDS open 9446-10060 _na     204_aa DUF1541 domain-containing protein
2613 JASPHD010000004.1 GCA030229195_01615 CDS open 10646-10957 _na     103_aa GtrA-like protein domain-containing protein
2614 JASPHD010000004.1 GCA030229195_01616 CDS open 11717-12859 _na     380_aa Glycosyltransferase subfamily 4-like N-terminal domain-containing protein
2615 JASPHD010000004.1 GCA030229195_01617 CDS open 12869-13162 _na     97_aa hypothetical protein
2616 JASPHD010000004.1 GCA030229195_01618 CDS open 13360-14301 _na     313_aa hypothetical protein
2617 JASPHD010000004.1 GCA030229195_01619 CDS open 14363-14524 _na     53_aa hypothetical protein
2618 JASPHD010000004.1 GCA030229195_01620 CDS open 14634-15593 _na     319_aa Methylenetetrahydrofolate reductase
2619 JASPHD010000004.1 GCA030229195_01621 CDS open 15721-18018 _na     765_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
2620 JASPHD010000004.1 GCA030229195_01622 CDS open 18115-19824 _na     569_aa hypothetical protein
2621 JASPHD010000004.1 GCA030229195_01623 CDS open 20582-21763 _na     393_aa DUF5667 domain-containing protein
2622 JASPHD010000004.1 GCA030229195_01624 CDS open 21763-22287 _na     174_aa RNA polymerase sigma factor
2623 JASPHD010000004.1 GCA030229195_01625 CDS open 22366-22749 _na     127_aa Secreted protein
2624 JASPHD010000004.1 GCA030229195_01626 CDS open 22935-23207 _na     90_aa crgA cell division protein CrgA
2625 JASPHD010000004.1 GCA030229195_01627 CDS open 23324-25387 _na     687_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
2626 JASPHD010000004.1 GCA030229195_01628 CDS open 25390-27201 _na     603_aa non-specific serine/threonine protein kinase
2627 JASPHD010000004.1 GCA030229195_01629 CDS open 27205-28632 _na     475_aa Penicillin-binding protein 2
2628 JASPHD010000004.1 GCA030229195_01630 CDS open 28629-30137 _na     502_aa ftsW Cell division protein FtsW
2629 JASPHD010000004.1 GCA030229195_01631 CDS open 30138-31721 _na     527_aa PPM-type phosphatase domain-containing protein
2630 JASPHD010000004.1 GCA030229195_01632 CDS open 31722-32189 _na     155_aa FHA domain-containing protein
2631 JASPHD010000004.1 GCA030229195_01633 CDS open 32219-33124 _na     301_aa FHA domain-containing protein
2632 JASPHD010000004.1 GCA030229195_01635 CDS open 33749-34432 _na     227_aa Heme oxygenase
2633 JASPHD010000004.1 GCA030229195_01636 CDS open 34434-35525 _na     363_aa Fe/B12 periplasmic-binding domain-containing protein
2634 JASPHD010000004.1 GCA030229195_01637 CDS open 35528-36574 _na     348_aa ABC transporter permease
2635 JASPHD010000004.1 GCA030229195_01638 CDS open 36582-37922 _na     446_aa Peptidase M20 dimerisation domain-containing protein
2636 JASPHD010000004.1 GCA030229195_01639 CDS open 37959-38660 _na     233_aa DUF4442 domain-containing protein
2637 JASPHD010000004.1 GCA030229195_01640 CDS open 38859-39839 _na     326_aa bioB biotin synthase BioB
2638 JASPHD010000004.1 GCA030229195_01641 CDS open 39870-40175 _na     101_aa Aminotransferase
2639 JASPHD010000004.1 GCA030229195_01642 CDS open 40218-41228 _na     336_aa Deacetylase sirtuin-type domain-containing protein
2640 JASPHD010000004.1 GCA030229195_01643 CDS open 41225-42457 _na     410_aa AB hydrolase-1 domain-containing protein
2641 JASPHD010000004.1 GCA030229195_01644 CDS open 43141-43599 _na     152_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
2642 JASPHD010000004.1 GCA030229195_01645 CDS open 43603-44607 _na     334_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
2643 JASPHD010000004.1 GCA030229195_01646 CDS open 44804-47116 _na     770_aa Htaa domain-containing protein
2644 JASPHD010000004.1 GCA030229195_01647 CDS open 47437-48867 _na     476_aa Fibronectin type-III domain-containing protein
2645 JASPHD010000004.1 GCA030229195_01648 CDS open 49095-50321 _na     408_aa Htaa domain-containing protein
2646 JASPHD010000004.1 GCA030229195_01649 CDS open 50518-51333 _na     271_aa heme ABC transporter ATP-binding protein
2647 JASPHD010000004.1 GCA030229195_01650 CDS open 51333-52463 _na     376_aa ABC transporter permease
2648 JASPHD010000004.1 GCA030229195_01651 CDS open 52444-53547 _na     367_aa Fe/B12 periplasmic-binding domain-containing protein
2649 JASPHD010000004.1 GCA030229195_01652 CDS open 53624-55582 _na     652_aa Htaa domain-containing protein
2650 JASPHD010000004.1 GCA030229195_01653 CDS open 55829-56362 _na     177_aa Cell-surface hemin receptor
2651 JASPHD010000004.1 GCA030229195_01654 CDS open 56409-57029 _na     206_aa Haloacid dehalogenase
2652 JASPHD010000004.1 GCA030229195_01655 CDS open 57069-57587 _na     172_aa Gamma carbonic anhydrase family protein
2653 JASPHD010000004.1 GCA030229195_01656 CDS open 57689-58987 _na     432_aa HTH marR-type domain-containing protein
2654 JASPHD010000004.1 GCA030229195_01657 CDS open 59128-60864 _na     578_aa DUF885 domain-containing protein
2655 JASPHD010000004.1 GCA030229195_01658 CDS open 60937-61281 _na     114_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
2656 JASPHD010000004.1 GCA030229195_01659 CDS open 61278-62222 _na     314_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
2657 JASPHD010000004.1 GCA030229195_01660 CDS open 62228-62875 _na     215_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
2658 JASPHD010000004.1 GCA030229195_01661 CDS open 62872-63594 _na     240_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
2659 JASPHD010000004.1 GCA030229195_01662 CDS open 63596-64726 _na     376_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
2660 JASPHD010000004.1 GCA030229195_01663 CDS open 64753-65370 _na     205_aa casB type I-E CRISPR-associated protein Cse2/CasB
2661 JASPHD010000004.1 GCA030229195_01664 CDS open 65363-67075 _na     570_aa casA type I-E CRISPR-associated protein Cse1/CasA
2662 JASPHD010000004.1 GCA030229195_01665 CDS open 67121-69913 _na     930_aa CRISPR-associated helicase Cas3
2663 JASPHD010000004.1 GCA030229195_01666 CDS open 70226-70567 _na     113_aa N-acetyltransferase domain-containing protein
2664 JASPHD010000004.1 GCA030229195_01667 CDS open 70586-71521 _na     311_aa hypothetical protein
2665 JASPHD010000004.1 GCA030229195_01668 CDS open 71521-71874 _na     117_aa hypothetical protein
2666 JASPHD010000004.1 GCA030229195_01669 CDS open 71963-72235 _na     90_aa hypothetical protein
2667 JASPHD010000004.1 GCA030229195_01670 CDS open 72303-72626 _na     107_aa hypothetical protein
2668 JASPHD010000004.1 GCA030229195_01671 CDS open 72881-73249 _na     122_aa D52 family tumor protein
2669 JASPHD010000004.1 GCA030229195_01672 CDS open 73246-73701 _na     151_aa hypothetical protein
2670 JASPHD010000004.1 GCA030229195_01673 CDS open 73712-74122 _na     136_aa Holin
2671 JASPHD010000004.1 GCA030229195_01674 CDS open 74123-74992 _na     289_aa N-acetylmuramoyl-L-alanine amidase
2672 JASPHD010000004.1 GCA030229195_01675 CDS open 75190-75297 _na     35_aa hypothetical protein
2673 JASPHD010000004.1 GCA030229195_01676 CDS open 75379-75546 _na     55_aa hypothetical protein
2674 JASPHD010000004.1 GCA030229195_01677 CDS open 75536-75763 _na     75_aa Helix-turn-helix domain-containing protein
2675 JASPHD010000004.1 GCA030229195_01678 CDS open 75766-76401 _na     211_aa Chitin-binding type-3 domain-containing protein
2676 JASPHD010000004.1 GCA030229195_01679 CDS open 76411-76686 _na     91_aa hypothetical protein
2677 JASPHD010000004.1 GCA030229195_01680 CDS open 76743-77039 _na     98_aa hypothetical protein
2678 JASPHD010000004.1 GCA030229195_01681 CDS open 77043-78809 _na     588_aa hypothetical protein
2679 JASPHD010000004.1 GCA030229195_01682 CDS open 78821-81190 _na     789_aa hypothetical protein
2680 JASPHD010000004.1 GCA030229195_01683 CDS open 81187-82164 _na     325_aa Phage tail protein
2681 JASPHD010000004.1 GCA030229195_01684 CDS open 82195-82893 _na     232_aa hypothetical protein
2682 JASPHD010000004.1 GCA030229195_01685 CDS open 82886-89482 _na     2198_aa phage tail tape measure protein
2683 JASPHD010000004.1 GCA030229195_01686 CDS open 89522-90136 _na     204_aa hypothetical protein
2684 JASPHD010000004.1 GCA030229195_01687 CDS open 90140-90478 _na     112_aa hypothetical protein
2685 JASPHD010000004.1 GCA030229195_01688 CDS open 90648-91445 _na     265_aa Phage tail protein
2686 JASPHD010000004.1 GCA030229195_01689 CDS open 91460-91867 _na     135_aa hypothetical protein
2687 JASPHD010000004.1 GCA030229195_01690 CDS open 91864-92172 _na     102_aa hypothetical protein
2688 JASPHD010000004.1 GCA030229195_01691 CDS open 92162-92524 _na     120_aa hypothetical protein
2689 JASPHD010000004.1 GCA030229195_01692 CDS open 92524-92961 _na     145_aa Gp19/Gp15/Gp42 family protein
2690 JASPHD010000004.1 GCA030229195_01693 CDS open 92973-93302 _na     109_aa hypothetical protein
2691 JASPHD010000004.1 GCA030229195_01694 CDS open 93302-94234 _na     310_aa HK97 family phage major capsid protein
2692 JASPHD010000004.1 GCA030229195_01695 CDS open 94261-94662 _na     133_aa Scaffolding protein
2693 JASPHD010000004.1 GCA030229195_01696 CDS open 94674-96077 _na     467_aa head maturation protease%2C ClpP-related
2694 JASPHD010000004.1 GCA030229195_01697 CDS open 96162-97520 _na     452_aa DUF935 domain-containing protein
2695 JASPHD010000004.1 GCA030229195_01698 CDS open 97532-99106 _na     524_aa Phage terminase%2C large subunit
2696 JASPHD010000004.1 GCA030229195_01699 CDS open 99126-99449 _na     107_aa P27 family phage terminase small subunit
2697 JASPHD010000004.1 GCA030229195_01700 CDS open 99458-100237 _na     259_aa Phospholipase D-like domain-containing protein
2698 JASPHD010000004.1 GCA030229195_01701 CDS open 100615-100848 _na     77_aa hypothetical protein
2699 JASPHD010000004.1 GCA030229195_01702 CDS open 101221-101844 _na     207_aa hypothetical protein
2700 JASPHD010000004.1 GCA030229195_01703 CDS open 101896-102168 _na     90_aa hypothetical protein
2701 JASPHD010000004.1 GCA030229195_01704 CDS open 102150-102395 _na     81_aa hypothetical protein
2702 JASPHD010000004.1 GCA030229195_01705 CDS open 102388-103092 _na     234_aa thyX FAD-dependent thymidylate synthase
2703 JASPHD010000004.1 GCA030229195_01706 CDS open 103188-103565 _na     125_aa hypothetical protein
2704 JASPHD010000004.1 GCA030229195_01707 CDS open 103558-104034 _na     158_aa DUF3310 domain-containing protein
2705 JASPHD010000004.1 GCA030229195_01708 CDS open 104031-104228 _na     65_aa hypothetical protein
2706 JASPHD010000004.1 GCA030229195_01709 CDS open 104225-104473 _na     82_aa hypothetical protein
2707 JASPHD010000004.1 GCA030229195_01710 CDS open 104466-104828 _na     120_aa hypothetical protein
2708 JASPHD010000004.1 GCA030229195_01711 CDS open 104818-105132 _na     104_aa hypothetical protein
2709 JASPHD010000004.1 GCA030229195_01712 CDS open 105129-105359 _na     76_aa hypothetical protein
2710 JASPHD010000004.1 GCA030229195_01713 CDS open 105362-105748 _na     128_aa Phosphoribosyl-ATP pyrophosphohydrolase
2711 JASPHD010000004.1 GCA030229195_01714 CDS open 105767-105979 _na     70_aa hypothetical protein
2712 JASPHD010000004.1 GCA030229195_01715 CDS open 105979-106164 _na     61_aa DUF2508 domain-containing protein
2713 JASPHD010000004.1 GCA030229195_01716 CDS open 106161-106364 _na     67_aa hypothetical protein
2714 JASPHD010000004.1 GCA030229195_01717 CDS open 106375-106554 _na     59_aa hypothetical protein
2715 JASPHD010000004.1 GCA030229195_01718 CDS open 106551-106673 _na     40_aa hypothetical protein
2716 JASPHD010000004.1 GCA030229195_01719 CDS open 106646-106843 _na     65_aa hypothetical protein
2717 JASPHD010000004.1 GCA030229195_01720 CDS open 106824-107276 _na     150_aa hypothetical protein
2718 JASPHD010000004.1 GCA030229195_01721 CDS open 107273-108124 _na     283_aa hypothetical protein
2719 JASPHD010000004.1 GCA030229195_01722 CDS open 108230-108451 _na     73_aa hypothetical protein
2720 JASPHD010000004.1 GCA030229195_01723 CDS open 108448-108564 _na     38_aa hypothetical protein
2721 JASPHD010000004.1 GCA030229195_01724 CDS open 108549-109328 _na     259_aa Methyltransferase
2722 JASPHD010000004.1 GCA030229195_01725 CDS open 109389-109565 _na     58_aa hypothetical protein
2723 JASPHD010000004.1 GCA030229195_01726 CDS open 109558-109890 _na     110_aa hypothetical protein
2724 JASPHD010000004.1 GCA030229195_01727 CDS open 109899-110828 _na     309_aa SAM-dependent methyltransferase
2725 JASPHD010000004.1 GCA030229195_01728 CDS open 110986-111483 _na     165_aa single-stranded DNA-binding protein
2726 JASPHD010000004.1 GCA030229195_01729 CDS open 111484-112518 _na     344_aa AAA family ATPase
2727 JASPHD010000004.1 GCA030229195_01730 CDS open 112541-113146 _na     201_aa hypothetical protein
2728 JASPHD010000004.1 GCA030229195_01731 CDS open 113188-113430 _na     80_aa hypothetical protein
2729 JASPHD010000004.1 GCA030229195_01732 CDS open 113431-113577 _na     48_aa hypothetical protein
2730 JASPHD010000004.1 GCA030229195_01733 CDS open 113642-113878 _na     78_aa helix-turn-helix domain-containing protein
2731 JASPHD010000004.1 GCA030229195_01734 CDS open 114369-115136 _na     255_aa phage antirepressor KilAC domain-containing protein
2732 JASPHD010000004.1 GCA030229195_01735 CDS open 115282-115590 _na     102_aa hypothetical protein
2733 JASPHD010000004.1 GCA030229195_01736 CDS open 115604-115825 _na     73_aa DNA-binding transcriptional regulator
2734 JASPHD010000004.1 GCA030229195_01737 CDS open 115951-116406 _na     151_aa HTH cro/C1-type domain-containing protein
2735 JASPHD010000004.1 GCA030229195_01738 CDS open 116399-116764 _na     121_aa ImmA/IrrE family metallo-endopeptidase
2736 JASPHD010000004.1 GCA030229195_01739 CDS open 116761-117231 _na     156_aa hypothetical protein
2737 JASPHD010000004.1 GCA030229195_01740 CDS open 117355-118425 _na     356_aa site-specific integrase
2738 JASPHD010000004.1 GCA030229195_01741 CDS open 125839-126078 _na     79_aa hypothetical protein
2739 JASPHD010000004.1 GCA030229195_01742 CDS open 126198-126359 _na     53_aa hypothetical protein
2740 JASPHD010000004.1 GCA030229195_01743 CDS open 126362-126709 _na     115_aa HTH cro/C1-type domain-containing protein
2741 JASPHD010000004.1 GCA030229195_01744 CDS open 127322-128395 _na     357_aa Ammonia monooxygenase
2742 JASPHD010000004.1 GCA030229195_01745 CDS open 128422-129150 _na     242_aa SDR family oxidoreductase
2743 JASPHD010000004.1 GCA030229195_01746 CDS open 129200-129520 _na     106_aa RNA-binding S4 domain-containing protein
2744 JASPHD010000004.1 GCA030229195_01747 CDS open 129520-130350 _na     276_aa VOC domain-containing protein
2745 JASPHD010000004.1 GCA030229195_01748 CDS open 130621-131211 _na     196_aa hypothetical protein
2746 JASPHD010000004.1 GCA030229195_01749 CDS open 131257-131640 _na     127_aa hypothetical protein
2747 JASPHD010000004.1 GCA030229195_01750 CDS open 131845-132864 _na     339_aa ATP-binding protein
2748 JASPHD010000004.1 GCA030229195_01751 CDS open 132874-134730 _na     618_aa FAD-dependent monooxygenase
2749 JASPHD010000004.1 GCA030229195_01752 CDS open 135033-136397 _na     454_aa Major facilitator superfamily (MFS) profile domain-containing protein
2750 JASPHD010000004.1 GCA030229195_01753 CDS open 136618-138126 _na     502_aa fumarylacetoacetate hydrolase family protein
2751 JASPHD010000004.1 GCA030229195_01754 CDS open 138123-138803 _na     226_aa gntR GntR family transcriptional regulator
2752 JASPHD010000004.1 GCA030229195_01755 CDS open 138825-140342 _na     505_aa hpaE 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase
2753 JASPHD010000004.1 GCA030229195_01756 CDS open 140428-141522 _na     364_aa hpaD 3%2C4-dihydroxyphenylacetate 2%2C3-dioxygenase
2754 JASPHD010000004.1 GCA030229195_01757 CDS open 141559-142344 _na     261_aa hpaH 2-oxo-hept-4-ene-1%2C7-dioate hydratase
2755 JASPHD010000004.1 GCA030229195_01758 CDS open 142329-143108 _na     259_aa HpcH/HpaI aldolase/citrate lyase family protein
2756 JASPHD010000004.1 GCA030229195_01759 CDS open 143131-143814 _na     227_aa MOSC domain-containing protein
2757 JASPHD010000004.1 GCA030229195_01604 gene open 339-935 cadD
2758 JASPHD010000004.1 GCA030229195_01605 gene open 936-1295 arsR
2759 JASPHD010000004.1 GCA030229195_01606 gene open 2031-2249
2760 JASPHD010000004.1 GCA030229195_01607 gene open 2339-2641
2761 JASPHD010000004.1 GCA030229195_01608 gene open 2713-3819
2762 JASPHD010000004.1 GCA030229195_01609 gene open 3891-4466
2763 JASPHD010000004.1 GCA030229195_01610 gene open 4786-5592 ompR
2764 JASPHD010000004.1 GCA030229195_01611 gene open 5589-6716 baeS
2765 JASPHD010000004.1 GCA030229195_01612 gene open 6831-7157 copZ
2766 JASPHD010000004.1 GCA030229195_01613 gene open 7209-9398 zntA
2767 JASPHD010000004.1 GCA030229195_01614 gene open 9446-10060
2768 JASPHD010000004.1 GCA030229195_01615 gene open 10646-10957
2769 JASPHD010000004.1 GCA030229195_01616 gene open 11717-12859
2770 JASPHD010000004.1 GCA030229195_01617 gene open 12869-13162
2771 JASPHD010000004.1 GCA030229195_01618 gene open 13360-14301
2772 JASPHD010000004.1 GCA030229195_01619 gene open 14363-14524
2773 JASPHD010000004.1 GCA030229195_01620 gene open 14634-15593
2774 JASPHD010000004.1 GCA030229195_01621 gene open 15721-18018 metE
2775 JASPHD010000004.1 GCA030229195_01622 gene open 18115-19824
2776 JASPHD010000004.1 GCA030229195_01623 gene open 20582-21763
2777 JASPHD010000004.1 GCA030229195_01624 gene open 21763-22287
2778 JASPHD010000004.1 GCA030229195_01625 gene open 22366-22749
2779 JASPHD010000004.1 GCA030229195_01626 gene open 22935-23207 crgA
2780 JASPHD010000004.1 GCA030229195_01627 gene open 23324-25387 pknB
2781 JASPHD010000004.1 GCA030229195_01628 gene open 25390-27201
2782 JASPHD010000004.1 GCA030229195_01629 gene open 27205-28632
2783 JASPHD010000004.1 GCA030229195_01630 gene open 28629-30137 ftsW
2784 JASPHD010000004.1 GCA030229195_01631 gene open 30138-31721
2785 JASPHD010000004.1 GCA030229195_01632 gene open 31722-32189
2786 JASPHD010000004.1 GCA030229195_01633 gene open 32219-33124
2787 JASPHD010000004.1 GCA030229195_01635 gene open 33749-34432
2788 JASPHD010000004.1 GCA030229195_01636 gene open 34434-35525
2789 JASPHD010000004.1 GCA030229195_01637 gene open 35528-36574
2790 JASPHD010000004.1 GCA030229195_01638 gene open 36582-37922
2791 JASPHD010000004.1 GCA030229195_01639 gene open 37959-38660
2792 JASPHD010000004.1 GCA030229195_01640 gene open 38859-39839 bioB
2793 JASPHD010000004.1 GCA030229195_01641 gene open 39870-40175
2794 JASPHD010000004.1 GCA030229195_01642 gene open 40218-41228
2795 JASPHD010000004.1 GCA030229195_01643 gene open 41225-42457
2796 JASPHD010000004.1 GCA030229195_01644 gene open 43141-43599 nrdI
2797 JASPHD010000004.1 GCA030229195_01645 gene open 43603-44607 nrdF
2798 JASPHD010000004.1 GCA030229195_01646 gene open 44804-47116
2799 JASPHD010000004.1 GCA030229195_01647 gene open 47437-48867
2800 JASPHD010000004.1 GCA030229195_01648 gene open 49095-50321
2801 JASPHD010000004.1 GCA030229195_01649 gene open 50518-51333
2802 JASPHD010000004.1 GCA030229195_01650 gene open 51333-52463
2803 JASPHD010000004.1 GCA030229195_01651 gene open 52444-53547
2804 JASPHD010000004.1 GCA030229195_01652 gene open 53624-55582
2805 JASPHD010000004.1 GCA030229195_01653 gene open 55829-56362
2806 JASPHD010000004.1 GCA030229195_01654 gene open 56409-57029
2807 JASPHD010000004.1 GCA030229195_01655 gene open 57069-57587
2808 JASPHD010000004.1 GCA030229195_01656 gene open 57689-58987
2809 JASPHD010000004.1 GCA030229195_01657 gene open 59128-60864
2810 JASPHD010000004.1 GCA030229195_01658 gene open 60937-61281 cas2e
2811 JASPHD010000004.1 GCA030229195_01659 gene open 61278-62222 cas1e
2812 JASPHD010000004.1 GCA030229195_01660 gene open 62228-62875 cas6e
2813 JASPHD010000004.1 GCA030229195_01661 gene open 62872-63594 cas5e
2814 JASPHD010000004.1 GCA030229195_01662 gene open 63596-64726 cas7e
2815 JASPHD010000004.1 GCA030229195_01663 gene open 64753-65370 casB
2816 JASPHD010000004.1 GCA030229195_01664 gene open 65363-67075 casA
2817 JASPHD010000004.1 GCA030229195_01665 gene open 67121-69913
2818 JASPHD010000004.1 GCA030229195_01666 gene open 70226-70567
2819 JASPHD010000004.1 GCA030229195_01667 gene open 70586-71521
2820 JASPHD010000004.1 GCA030229195_01668 gene open 71521-71874
2821 JASPHD010000004.1 GCA030229195_01669 gene open 71963-72235
2822 JASPHD010000004.1 GCA030229195_01670 gene open 72303-72626
2823 JASPHD010000004.1 GCA030229195_01671 gene open 72881-73249
2824 JASPHD010000004.1 GCA030229195_01672 gene open 73246-73701
2825 JASPHD010000004.1 GCA030229195_01673 gene open 73712-74122
2826 JASPHD010000004.1 GCA030229195_01674 gene open 74123-74992
2827 JASPHD010000004.1 GCA030229195_01675 gene open 75190-75297
2828 JASPHD010000004.1 GCA030229195_01676 gene open 75379-75546
2829 JASPHD010000004.1 GCA030229195_01677 gene open 75536-75763
2830 JASPHD010000004.1 GCA030229195_01678 gene open 75766-76401
2831 JASPHD010000004.1 GCA030229195_01679 gene open 76411-76686
2832 JASPHD010000004.1 GCA030229195_01680 gene open 76743-77039
2833 JASPHD010000004.1 GCA030229195_01681 gene open 77043-78809
2834 JASPHD010000004.1 GCA030229195_01682 gene open 78821-81190
2835 JASPHD010000004.1 GCA030229195_01683 gene open 81187-82164
2836 JASPHD010000004.1 GCA030229195_01684 gene open 82195-82893
2837 JASPHD010000004.1 GCA030229195_01685 gene open 82886-89482
2838 JASPHD010000004.1 GCA030229195_01686 gene open 89522-90136
2839 JASPHD010000004.1 GCA030229195_01687 gene open 90140-90478
2840 JASPHD010000004.1 GCA030229195_01688 gene open 90648-91445
2841 JASPHD010000004.1 GCA030229195_01689 gene open 91460-91867
2842 JASPHD010000004.1 GCA030229195_01690 gene open 91864-92172
2843 JASPHD010000004.1 GCA030229195_01691 gene open 92162-92524
2844 JASPHD010000004.1 GCA030229195_01692 gene open 92524-92961
2845 JASPHD010000004.1 GCA030229195_01693 gene open 92973-93302
2846 JASPHD010000004.1 GCA030229195_01694 gene open 93302-94234
2847 JASPHD010000004.1 GCA030229195_01695 gene open 94261-94662
2848 JASPHD010000004.1 GCA030229195_01696 gene open 94674-96077
2849 JASPHD010000004.1 GCA030229195_01697 gene open 96162-97520
2850 JASPHD010000004.1 GCA030229195_01698 gene open 97532-99106
2851 JASPHD010000004.1 GCA030229195_01699 gene open 99126-99449
2852 JASPHD010000004.1 GCA030229195_01700 gene open 99458-100237
2853 JASPHD010000004.1 GCA030229195_01701 gene open 100615-100848
2854 JASPHD010000004.1 GCA030229195_01702 gene open 101221-101844
2855 JASPHD010000004.1 GCA030229195_01703 gene open 101896-102168
2856 JASPHD010000004.1 GCA030229195_01704 gene open 102150-102395
2857 JASPHD010000004.1 GCA030229195_01705 gene open 102388-103092 thyX
2858 JASPHD010000004.1 GCA030229195_01706 gene open 103188-103565
2859 JASPHD010000004.1 GCA030229195_01707 gene open 103558-104034
2860 JASPHD010000004.1 GCA030229195_01708 gene open 104031-104228
2861 JASPHD010000004.1 GCA030229195_01709 gene open 104225-104473
2862 JASPHD010000004.1 GCA030229195_01710 gene open 104466-104828
2863 JASPHD010000004.1 GCA030229195_01711 gene open 104818-105132
2864 JASPHD010000004.1 GCA030229195_01712 gene open 105129-105359
2865 JASPHD010000004.1 GCA030229195_01713 gene open 105362-105748
2866 JASPHD010000004.1 GCA030229195_01714 gene open 105767-105979
2867 JASPHD010000004.1 GCA030229195_01715 gene open 105979-106164
2868 JASPHD010000004.1 GCA030229195_01716 gene open 106161-106364
2869 JASPHD010000004.1 GCA030229195_01717 gene open 106375-106554
2870 JASPHD010000004.1 GCA030229195_01718 gene open 106551-106673
2871 JASPHD010000004.1 GCA030229195_01719 gene open 106646-106843
2872 JASPHD010000004.1 GCA030229195_01720 gene open 106824-107276
2873 JASPHD010000004.1 GCA030229195_01721 gene open 107273-108124
2874 JASPHD010000004.1 GCA030229195_01722 gene open 108230-108451
2875 JASPHD010000004.1 GCA030229195_01723 gene open 108448-108564
2876 JASPHD010000004.1 GCA030229195_01724 gene open 108549-109328
2877 JASPHD010000004.1 GCA030229195_01725 gene open 109389-109565
2878 JASPHD010000004.1 GCA030229195_01726 gene open 109558-109890
2879 JASPHD010000004.1 GCA030229195_01727 gene open 109899-110828
2880 JASPHD010000004.1 GCA030229195_01728 gene open 110986-111483
2881 JASPHD010000004.1 GCA030229195_01729 gene open 111484-112518
2882 JASPHD010000004.1 GCA030229195_01730 gene open 112541-113146
2883 JASPHD010000004.1 GCA030229195_01731 gene open 113188-113430
2884 JASPHD010000004.1 GCA030229195_01732 gene open 113431-113577
2885 JASPHD010000004.1 GCA030229195_01733 gene open 113642-113878
2886 JASPHD010000004.1 GCA030229195_01734 gene open 114369-115136
2887 JASPHD010000004.1 GCA030229195_01735 gene open 115282-115590
2888 JASPHD010000004.1 GCA030229195_01736 gene open 115604-115825
2889 JASPHD010000004.1 GCA030229195_01737 gene open 115951-116406
2890 JASPHD010000004.1 GCA030229195_01738 gene open 116399-116764
2891 JASPHD010000004.1 GCA030229195_01739 gene open 116761-117231
2892 JASPHD010000004.1 GCA030229195_01740 gene open 117355-118425
2893 JASPHD010000004.1 GCA030229195_01741 gene open 125839-126078
2894 JASPHD010000004.1 GCA030229195_01742 gene open 126198-126359
2895 JASPHD010000004.1 GCA030229195_01743 gene open 126362-126709
2896 JASPHD010000004.1 GCA030229195_01744 gene open 127322-128395
2897 JASPHD010000004.1 GCA030229195_01745 gene open 128422-129150
2898 JASPHD010000004.1 GCA030229195_01746 gene open 129200-129520
2899 JASPHD010000004.1 GCA030229195_01747 gene open 129520-130350
2900 JASPHD010000004.1 GCA030229195_01748 gene open 130621-131211
2901 JASPHD010000004.1 GCA030229195_01749 gene open 131257-131640
2902 JASPHD010000004.1 GCA030229195_01750 gene open 131845-132864
2903 JASPHD010000004.1 GCA030229195_01751 gene open 132874-134730
2904 JASPHD010000004.1 GCA030229195_01752 gene open 135033-136397
2905 JASPHD010000004.1 GCA030229195_01753 gene open 136618-138126
2906 JASPHD010000004.1 GCA030229195_01754 gene open 138123-138803 gntR
2907 JASPHD010000004.1 GCA030229195_01755 gene open 138825-140342 hpaE
2908 JASPHD010000004.1 GCA030229195_01756 gene open 140428-141522 hpaD
2909 JASPHD010000004.1 GCA030229195_01757 gene open 141559-142344 hpaH
2910 JASPHD010000004.1 GCA030229195_01758 gene open 142329-143108
2911 JASPHD010000004.1 GCA030229195_01759 gene open 143131-143814
2912 JASPHD010000004.1 GCA030229195_01634 gene open 33430-33514 trnL
2913 JASPHD010000004.1 GCA030229195_01634 tRNA open 33430-33514 trnL tRNA-Leu(cag)
2914 JASPHD010000005.1 regulatory_region open 77926-78038 TPP riboswitch aptamer (THI element)
2915 JASPHD010000005.1 GCA030229195_01760 CDS open 315-2636 _na     773_aa Copper-translocating P-type ATPase
2916 JASPHD010000005.1 GCA030229195_01761 CDS open 2665-2928 _na     87_aa heavy-metal-associated domain-containing protein
2917 JASPHD010000005.1 GCA030229195_01762 CDS open 3384-4559 _na     391_aa DUF4185 domain-containing protein
2918 JASPHD010000005.1 GCA030229195_01763 CDS open 4560-4970 _na     136_aa csoR Copper-sensing transcriptional repressor CsoR
2919 JASPHD010000005.1 GCA030229195_01766 CDS open 5423-6337 _na     304_aa Oxidoreductase
2920 JASPHD010000005.1 GCA030229195_01769 CDS open 7178-7471 _na     97_aa N-acetyltransferase domain-containing protein
2921 JASPHD010000005.1 GCA030229195_01770 CDS open 7735-8301 _na     188_aa epsC serine O-acetyltransferase EpsC
2922 JASPHD010000005.1 GCA030229195_01771 CDS open 8322-9257 _na     311_aa cysK cysteine synthase A
2923 JASPHD010000005.1 GCA030229195_01772 CDS open 9578-10420 _na     280_aa ramA acetate metabolism transcriptional regulator RamA
2924 JASPHD010000005.1 GCA030229195_01773 CDS open 10451-11713 _na     420_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
2925 JASPHD010000005.1 GCA030229195_01774 CDS open 11842-12660 _na     272_aa ABC transporter domain-containing protein
2926 JASPHD010000005.1 GCA030229195_01775 CDS open 12663-15278 _na     871_aa ABC3 transporter permease protein domain-containing protein
2927 JASPHD010000005.1 GCA030229195_01776 CDS open 15280-15801 _na     173_aa mauE Methylamine utilisation protein MauE domain-containing protein
2928 JASPHD010000005.1 GCA030229195_01777 CDS open 15867-16586 _na     239_aa Thioredoxin-like fold domain-containing protein
2929 JASPHD010000005.1 GCA030229195_01779 CDS open 16940-17125 _na     61_aa Secreted protein
2930 JASPHD010000005.1 GCA030229195_01780 CDS open 17205-18395 _na     396_aa Cytochrome P450
2931 JASPHD010000005.1 GCA030229195_01781 CDS open 18546-19034 _na     162_aa DUF4149 domain-containing protein
2932 JASPHD010000005.1 GCA030229195_01782 CDS open 19087-19947 _na     286_aa dedA DedA family protein
2933 JASPHD010000005.1 GCA030229195_01783 CDS open 20005-20763 _na     252_aa Fructosamine kinase
2934 JASPHD010000005.1 GCA030229195_01784 CDS open 20760-21629 _na     289_aa nadE ammonia-dependent NAD(+) synthetase
2935 JASPHD010000005.1 GCA030229195_01785 CDS open 21671-23107 _na     478_aa Major facilitator superfamily (MFS) profile domain-containing protein
2936 JASPHD010000005.1 GCA030229195_01786 CDS open 23293-23415 _na     40_aa ykgO type B 50S ribosomal protein L36
2937 JASPHD010000005.1 GCA030229195_01787 CDS open 23879-24124 _na     81_aa nrdH Glutaredoxin-like protein NrdH
2938 JASPHD010000005.1 GCA030229195_01788 CDS open 24269-24709 _na     146_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
2939 JASPHD010000005.1 GCA030229195_01789 CDS open 24787-26949 _na     720_aa nrdE class 1b ribonucleoside-diphosphate reductase subunit alpha
2940 JASPHD010000005.1 GCA030229195_01790 CDS open 26996-27736 _na     246_aa HTH gntR-type domain-containing protein
2941 JASPHD010000005.1 GCA030229195_01791 CDS open 27932-28915 _na     327_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
2942 JASPHD010000005.1 GCA030229195_01792 CDS open 29330-31072 _na     580_aa ctaD cytochrome c oxidase subunit I
2943 JASPHD010000005.1 GCA030229195_01793 CDS open 31313-32614 _na     433_aa serB phosphoserine phosphatase SerB
2944 JASPHD010000005.1 GCA030229195_01794 CDS open 32655-34769 _na     704_aa DNA 5'-3' helicase
2945 JASPHD010000005.1 GCA030229195_01795 CDS open 34770-36113 _na     447_aa nicotinate phosphoribosyltransferase
2946 JASPHD010000005.1 GCA030229195_01796 CDS open 36246-36671 _na     141_aa clpS ATP-dependent Clp protease adapter ClpS
2947 JASPHD010000005.1 GCA030229195_01797 CDS open 36790-37323 _na     177_aa DUF2017 domain-containing protein
2948 JASPHD010000005.1 GCA030229195_01798 CDS open 37332-38378 _na     348_aa Peptidase
2949 JASPHD010000005.1 GCA030229195_01799 CDS open 38394-39104 _na     236_aa Peptidase S54 rhomboid domain-containing protein
2950 JASPHD010000005.1 GCA030229195_01800 CDS open 39268-40101 _na     277_aa murI glutamate racemase
2951 JASPHD010000005.1 GCA030229195_01801 CDS open 40170-40943 _na     257_aa Metallo-beta-lactamase domain-containing protein
2952 JASPHD010000005.1 GCA030229195_01802 CDS open 40973-41764 _na     263_aa rph ribonuclease PH
2953 JASPHD010000005.1 GCA030229195_01803 CDS open 41764-42405 _na     213_aa dITP/XTP pyrophosphatase
2954 JASPHD010000005.1 GCA030229195_01804 CDS open 42491-42853 _na     120_aa DUF3817 domain-containing protein
2955 JASPHD010000005.1 GCA030229195_01805 CDS open 42853-43290 _na     145_aa DNA-binding transcriptional regulator of glucitol operon
2956 JASPHD010000005.1 GCA030229195_01807 CDS open 43583-44194 _na     203_aa Methyltransferase domain-containing protein
2957 JASPHD010000005.1 GCA030229195_01808 CDS open 44301-45128 _na     275_aa SDR family oxidoreductase
2958 JASPHD010000005.1 GCA030229195_01809 CDS open 45371-46291 _na     306_aa Band 7 domain-containing protein
2959 JASPHD010000005.1 GCA030229195_01810 CDS open 46295-47854 _na     519_aa adenosylmethionine--8-amino-7-oxononanoate transaminase
2960 JASPHD010000005.1 GCA030229195_01811 CDS open 47851-48528 _na     225_aa bioD ATP-dependent dethiobiotin synthetase BioD
2961 JASPHD010000005.1 GCA030229195_01812 CDS open 48533-48937 _na     134_aa holo-ACP synthase
2962 JASPHD010000005.1 GCA030229195_01813 CDS open 48975-49595 _na     206_aa HTH tetR-type domain-containing protein
2963 JASPHD010000005.1 GCA030229195_01814 CDS open 49671-50153 _na     160_aa bcp thioredoxin-dependent thiol peroxidase
2964 JASPHD010000005.1 GCA030229195_01815 CDS open 50378-50659 _na     93_aa DUF3618 domain-containing protein
2965 JASPHD010000005.1 GCA030229195_01816 CDS open 50699-51283 _na     194_aa nicotinamidase
2966 JASPHD010000005.1 GCA030229195_01817 CDS open 51392-52738 _na     448_aa glutaminase
2967 JASPHD010000005.1 GCA030229195_01818 CDS open 52804-53595 _na     263_aa Enoyl-CoA hydratase
2968 JASPHD010000005.1 GCA030229195_01819 CDS open 53592-53735 _na     47_aa hypothetical protein
2969 JASPHD010000005.1 GCA030229195_01821 CDS open 54260-55561 _na     433_aa L%2CD-TPase catalytic domain-containing protein
2970 JASPHD010000005.1 GCA030229195_01822 CDS open 55671-58121 _na     816_aa hrpB ATP-dependent helicase HrpB
2971 JASPHD010000005.1 GCA030229195_01823 CDS open 58125-58793 _na     222_aa HTH gntR-type domain-containing protein
2972 JASPHD010000005.1 GCA030229195_01824 CDS open 58817-59779 _na     320_aa ornithine cyclodeaminase family protein
2973 JASPHD010000005.1 GCA030229195_01825 CDS open 59939-60445 _na     168_aa branched-chain amino acid transport system II carrier protein
2974 JASPHD010000005.1 GCA030229195_01826 CDS open 60429-61130 _na     233_aa FAD-binding oxidoreductase
2975 JASPHD010000005.1 GCA030229195_01827 CDS open 61134-61403 _na     89_aa hypothetical protein
2976 JASPHD010000005.1 GCA030229195_01828 CDS open 61474-62997 _na     507_aa Molybdopterin-dependent oxidoreductase
2977 JASPHD010000005.1 GCA030229195_01830 CDS open 63429-64112 _na     227_aa orn oligoribonuclease
2978 JASPHD010000005.1 GCA030229195_01831 CDS open 64213-65010 _na     265_aa cmrA mycolate reductase
2979 JASPHD010000005.1 GCA030229195_01833 CDS open 65354-67618 _na     754_aa Copper resistance protein D domain-containing protein
2980 JASPHD010000005.1 GCA030229195_01834 CDS open 67685-68686 _na     333_aa SGNH hydrolase-type esterase domain-containing protein
2981 JASPHD010000005.1 GCA030229195_01835 CDS open 68934-69494 _na     186_aa Single-stranded DNA-binding protein
2982 JASPHD010000005.1 GCA030229195_01836 CDS open 69613-71283 _na     556_aa ettA energy-dependent translational throttle protein EttA
2983 JASPHD010000005.1 GCA030229195_01837 CDS open 71341-71949 _na     202_aa Thioesterase family protein
2984 JASPHD010000005.1 GCA030229195_01838 CDS open 71949-72650 _na     233_aa ACT domain-containing protein
2985 JASPHD010000005.1 GCA030229195_01839 CDS open 72847-73911 _na     354_aa DUF418 domain-containing protein
2986 JASPHD010000005.1 GCA030229195_01840 CDS open 73975-74907 _na     310_aa Trypsin-like serine protease
2987 JASPHD010000005.1 GCA030229195_01841 CDS open 74974-75714 _na     246_aa protein adenylyltransferase
2988 JASPHD010000005.1 GCA030229195_01842 CDS open 75714-75926 _na     70_aa vbhA Antitoxin VbhA domain-containing protein
2989 JASPHD010000005.1 GCA030229195_01843 CDS open 76094-77929 _na     611_aa thiC phosphomethylpyrimidine synthase ThiC
2990 JASPHD010000005.1 GCA030229195_01844 CDS open 78280-79368 _na     362_aa ald alanine dehydrogenase
2991 JASPHD010000005.1 GCA030229195_01845 CDS open 79476-80492 _na     338_aa LPXTG cell wall anchor domain-containing protein
2992 JASPHD010000005.1 GCA030229195_01846 CDS open 80751-81560 _na     269_aa Sortase
2993 JASPHD010000005.1 GCA030229195_01847 CDS open 81803-82357 _na     184_aa Hemoglobin-like protein
2994 JASPHD010000005.1 GCA030229195_01848 CDS open 82338-83387 _na     349_aa Small conductance mechanosensitive channel
2995 JASPHD010000005.1 GCA030229195_01849 CDS open 83526-84770 _na     414_aa cystathionine gamma-synthase
2996 JASPHD010000005.1 GCA030229195_01850 CDS open 84821-85567 _na     248_aa SDR family oxidoreductase
2997 JASPHD010000005.1 GCA030229195_01851 CDS open 85600-88155 _na     851_aa pepN aminopeptidase N
2998 JASPHD010000005.1 GCA030229195_01852 CDS open 88405-89016 _na     203_aa dsbA DsbA family protein
2999 JASPHD010000005.1 GCA030229195_01853 CDS open 89019-89291 _na     90_aa Secreted protein
3000 JASPHD010000005.1 GCA030229195_01854 CDS open 89375-89851 _na     158_aa ribose-5-phosphate isomerase