HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_030676125.1)

Select a Genome:
BAKTA Annotations for GCA_030676125.1
Genome Selected: Porphyromonas gingivalis
ContigsBases CDSrRNA tmRNAtRNA
119 2358334 2005 4 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4138 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 4138 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 JAMZRD010000059.1 GCA030676125_00817 CDS open 12833-13816 _na     327_aa batA BatA protein
3002 JAMZRD010000059.1 GCA030676125_00818 CDS open 13813-14769 _na     318_aa batD Protein BatD
3003 JAMZRD010000059.1 GCA030676125_00819 CDS open 14766-15527 _na     253_aa mMP0362 DUF58 domain-containing protein
3004 JAMZRD010000059.1 GCA030676125_00820 CDS open 15649-16644 _na     331_aa mMP0363 ATPase%2C MoxR family
3005 JAMZRD010000059.1 GCA030676125_00821 CDS open 16745-17671 _na     308_aa nadA quinolinate synthase NadA
3006 JAMZRD010000059.1 GCA030676125_00822 CDS open 17691-18533 _na     280_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
3007 JAMZRD010000059.1 GCA030676125_00823 CDS open 18565-20121 _na     518_aa nadB L-aspartate oxidase
3008 JAMZRD010000059.1 GCA030676125_00824 CDS open 20484-24770 _na     1428_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
3009 JAMZRD010000059.1 GCA030676125_00825 CDS open 24783-25721 _na     312_aa cas1 type II CRISPR-associated endonuclease Cas1
3010 JAMZRD010000059.1 GCA030676125_00826 CDS open 25769-26062 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
3011 JAMZRD010000059.1 GCA030676125_00805 gene open 131-787 rpe
3012 JAMZRD010000059.1 GCA030676125_00806 gene open 794-2326 comEC
3013 JAMZRD010000059.1 GCA030676125_00807 gene open 2265-2825 aroK
3014 JAMZRD010000059.1 GCA030676125_00808 gene open 2873-4951 pgpH
3015 JAMZRD010000059.1 GCA030676125_00810 gene open 5750-6595 folP
3016 JAMZRD010000059.1 GCA030676125_00811 gene open 6655-7422 cdaA
3017 JAMZRD010000059.1 GCA030676125_00812 gene open 7438-8154 lpxF
3018 JAMZRD010000059.1 GCA030676125_00813 gene open 8175-9083 batE
3019 JAMZRD010000059.1 GCA030676125_00814 gene open 9080-10882 batD
3020 JAMZRD010000059.1 GCA030676125_00815 gene open 11063-11806 batC
3021 JAMZRD010000059.1 GCA030676125_00816 gene open 11803-12822 batB
3022 JAMZRD010000059.1 GCA030676125_00817 gene open 12833-13816 batA
3023 JAMZRD010000059.1 GCA030676125_00818 gene open 13813-14769 batD
3024 JAMZRD010000059.1 GCA030676125_00819 gene open 14766-15527 mMP0362
3025 JAMZRD010000059.1 GCA030676125_00820 gene open 15649-16644 mMP0363
3026 JAMZRD010000059.1 GCA030676125_00821 gene open 16745-17671 nadA
3027 JAMZRD010000059.1 GCA030676125_00822 gene open 17691-18533 nadC
3028 JAMZRD010000059.1 GCA030676125_00823 gene open 18565-20121 nadB
3029 JAMZRD010000059.1 GCA030676125_00824 gene open 20484-24770 cas9
3030 JAMZRD010000059.1 GCA030676125_00825 gene open 24783-25721 cas1
3031 JAMZRD010000059.1 GCA030676125_00826 gene open 25769-26062 cas2
3032 JAMZRD010000059.1 GCA030676125_00809 gene open 5155-5229 trnH
3033 JAMZRD010000059.1 GCA030676125_00809 tRNA open 5155-5229 trnH tRNA-His(gtg)
3034 JAMZRD010000060.1 GCA030676125_00827 CDS open 1214-1528 _na     104_aa HTH cro/C1-type domain-containing protein
3035 JAMZRD010000060.1 GCA030676125_00828 CDS open 1525-2640 _na     371_aa HipA-like C-terminal domain protein
3036 JAMZRD010000060.1 GCA030676125_00829 CDS open 2662-3288 _na     208_aa alkC DNA alkylation repair enzyme
3037 JAMZRD010000060.1 GCA030676125_00830 CDS open 3292-3828 _na     178_aa dfsB ClbS/DfsB family four-helix bundle protein
3038 JAMZRD010000060.1 GCA030676125_00831 CDS open 3833-4003 _na     56_aa hypothetical protein
3039 JAMZRD010000060.1 GCA030676125_00832 CDS open 3993-4244 _na     83_aa hypothetical protein
3040 JAMZRD010000060.1 GCA030676125_00833 CDS open 4319-5311 _na     330_aa Nitroreductase domain-containing protein
3041 JAMZRD010000060.1 GCA030676125_00834 CDS open 5470-7749 _na     759_aa dAP2 Prolyl oligopeptidase family protein
3042 JAMZRD010000060.1 GCA030676125_00835 CDS open 8308-8868 _na     186_aa hypothetical protein
3043 JAMZRD010000060.1 GCA030676125_00836 CDS open 8899-11403 _na     834_aa cirA TonB-dependent receptor
3044 JAMZRD010000060.1 GCA030676125_00837 CDS open 11510-11617 _na     35_aa hypothetical protein
3045 JAMZRD010000060.1 GCA030676125_00838 CDS open 11623-11994 _na     123_aa yhcF Putative transcriptional regulator
3046 JAMZRD010000060.1 GCA030676125_00839 CDS open 11991-12749 _na     252_aa ABC transporter permease
3047 JAMZRD010000060.1 GCA030676125_00840 CDS open 12746-13600 _na     284_aa ABC transporter permease
3048 JAMZRD010000060.1 GCA030676125_00841 CDS open 13614-14441 _na     275_aa rbbA ABC transporter%2C ATP-binding protein
3049 JAMZRD010000060.1 GCA030676125_00842 CDS open 14981-15094 _na     37_aa hypothetical protein
3050 JAMZRD010000060.1 GCA030676125_00843 CDS open 15194-16591 _na     465_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
3051 JAMZRD010000060.1 GCA030676125_00844 CDS open 16895-18391 _na     498_aa aCH1 Acetyl-CoA hydrolase/transferase family protein
3052 JAMZRD010000060.1 GCA030676125_00845 CDS open 18923-21538 _na     871_aa pilW type IV pilus biogenesis/stability protein PilW
3053 JAMZRD010000060.1 GCA030676125_00846 CDS open 21904-24630 _na     908_aa ppdK pyruvate%2C phosphate dikinase
3054 JAMZRD010000060.1 GCA030676125_00847 CDS open 24981-26162 _na     393_aa DUF4876 domain-containing protein
3055 JAMZRD010000060.1 GCA030676125_00848 CDS open 26334-29144 _na     936_aa cirA carboxypeptidase-like regulatory domain-containing protein
3056 JAMZRD010000060.1 GCA030676125_00849 CDS open 29141-30784 _na     547_aa DUF6850 domain-containing protein
3057 JAMZRD010000060.1 GCA030676125_00850 CDS open 30827-31426 _na     199_aa ilvE Aminotransferase%2C class IV
3058 JAMZRD010000060.1 GCA030676125_00851 CDS open 31433-32446 _na     337_aa trpE aminodeoxychorismate synthase component I
3059 JAMZRD010000060.1 GCA030676125_00852 CDS open 32907-33995 _na     362_aa Conserved domain protein
3060 JAMZRD010000060.1 GCA030676125_00853 CDS open 33970-34674 _na     234_aa DUF4276 domain-containing protein
3061 JAMZRD010000060.1 GCA030676125_00854 CDS open 35088-36785 _na     565_aa pilF Tetratricopeptide repeat protein
3062 JAMZRD010000060.1 GCA030676125_00855 CDS open 37169-38509 _na     446_aa cTD-A T9SS C-terminal target domain-containing protein
3063 JAMZRD010000060.1 GCA030676125_00856 CDS open 38746-39492 _na     248_aa mlaE ABC transporter permease
3064 JAMZRD010000060.1 GCA030676125_00857 CDS open 39511-40245 _na     244_aa mlaF Putative ABC transporter ATP-binding protein
3065 JAMZRD010000060.1 GCA030676125_00858 CDS open 40340-41719 _na     459_aa cTD-B PKD domain protein
3066 JAMZRD010000060.1 GCA030676125_00859 CDS open 41790-44693 _na     967_aa uvrA excinuclease ABC subunit UvrA
3067 JAMZRD010000060.1 GCA030676125_00860 CDS open 44719-46098 _na     459_aa SWIM-type domain-containing protein
3068 JAMZRD010000060.1 GCA030676125_00861 CDS open 46098-48395 _na     765_aa uvrD DNA 3'-5' helicase
3069 JAMZRD010000060.1 GCA030676125_00827 gene open 1214-1528
3070 JAMZRD010000060.1 GCA030676125_00828 gene open 1525-2640
3071 JAMZRD010000060.1 GCA030676125_00829 gene open 2662-3288 alkC
3072 JAMZRD010000060.1 GCA030676125_00830 gene open 3292-3828 dfsB
3073 JAMZRD010000060.1 GCA030676125_00831 gene open 3833-4003
3074 JAMZRD010000060.1 GCA030676125_00832 gene open 3993-4244
3075 JAMZRD010000060.1 GCA030676125_00833 gene open 4319-5311
3076 JAMZRD010000060.1 GCA030676125_00834 gene open 5470-7749 dAP2
3077 JAMZRD010000060.1 GCA030676125_00835 gene open 8308-8868
3078 JAMZRD010000060.1 GCA030676125_00836 gene open 8899-11403 cirA
3079 JAMZRD010000060.1 GCA030676125_00837 gene open 11510-11617
3080 JAMZRD010000060.1 GCA030676125_00838 gene open 11623-11994 yhcF
3081 JAMZRD010000060.1 GCA030676125_00839 gene open 11991-12749
3082 JAMZRD010000060.1 GCA030676125_00840 gene open 12746-13600
3083 JAMZRD010000060.1 GCA030676125_00841 gene open 13614-14441 rbbA
3084 JAMZRD010000060.1 GCA030676125_00842 gene open 14981-15094
3085 JAMZRD010000060.1 GCA030676125_00843 gene open 15194-16591 miaB
3086 JAMZRD010000060.1 GCA030676125_00844 gene open 16895-18391 aCH1
3087 JAMZRD010000060.1 GCA030676125_00845 gene open 18923-21538 pilW
3088 JAMZRD010000060.1 GCA030676125_00846 gene open 21904-24630 ppdK
3089 JAMZRD010000060.1 GCA030676125_00847 gene open 24981-26162
3090 JAMZRD010000060.1 GCA030676125_00848 gene open 26334-29144 cirA
3091 JAMZRD010000060.1 GCA030676125_00849 gene open 29141-30784
3092 JAMZRD010000060.1 GCA030676125_00850 gene open 30827-31426 ilvE
3093 JAMZRD010000060.1 GCA030676125_00851 gene open 31433-32446 trpE
3094 JAMZRD010000060.1 GCA030676125_00852 gene open 32907-33995
3095 JAMZRD010000060.1 GCA030676125_00853 gene open 33970-34674
3096 JAMZRD010000060.1 GCA030676125_00854 gene open 35088-36785 pilF
3097 JAMZRD010000060.1 GCA030676125_00855 gene open 37169-38509 cTD-A
3098 JAMZRD010000060.1 GCA030676125_00856 gene open 38746-39492 mlaE
3099 JAMZRD010000060.1 GCA030676125_00857 gene open 39511-40245 mlaF
3100 JAMZRD010000060.1 GCA030676125_00858 gene open 40340-41719 cTD-B
3101 JAMZRD010000060.1 GCA030676125_00859 gene open 41790-44693 uvrA
3102 JAMZRD010000060.1 GCA030676125_00860 gene open 44719-46098
3103 JAMZRD010000060.1 GCA030676125_00861 gene open 46098-48395 uvrD
3104 JAMZRD010000061.1 GCA030676125_01684 CDS open 271-2418 _na     715_aa scpA methylmalonyl-CoA mutase
3105 JAMZRD010000061.1 GCA030676125_01685 CDS open 2447-4303 _na     618_aa mutA methylmalonyl-CoA mutase small subunit
3106 JAMZRD010000061.1 GCA030676125_01686 CDS open 4577-6076 _na     499_aa T9SS C-terminal target domain-containing protein
3107 JAMZRD010000061.1 GCA030676125_01687 CDS open 7003-7470 _na     155_aa hupA Histidinol phosphate aminotransferase
3108 JAMZRD010000061.1 GCA030676125_01688 CDS open 7524-9680 _na     718_aa leucine-rich repeat domain-containing protein
3109 JAMZRD010000061.1 GCA030676125_01689 CDS open 9812-10483 _na     223_aa ddpX D-alanyl-D-alanine dipeptidase
3110 JAMZRD010000061.1 GCA030676125_01690 CDS open 10515-11738 _na     407_aa paaI Thioesterase domain-containing protein
3111 JAMZRD010000061.1 GCA030676125_01691 CDS open 11763-13532 _na     589_aa TonB-dependent receptor
3112 JAMZRD010000061.1 GCA030676125_01692 CDS open 13580-16567 _na     995_aa ybgF tol-pal system protein YbgF
3113 JAMZRD010000061.1 GCA030676125_01693 CDS open 16825-19065 _na     746_aa spoT GTP pyrophosphokinase
3114 JAMZRD010000061.1 GCA030676125_01694 CDS open 19133-20521 _na     462_aa cls cardiolipin synthase
3115 JAMZRD010000061.1 GCA030676125_01684 gene open 271-2418 scpA
3116 JAMZRD010000061.1 GCA030676125_01685 gene open 2447-4303 mutA
3117 JAMZRD010000061.1 GCA030676125_01686 gene open 4577-6076
3118 JAMZRD010000061.1 GCA030676125_01687 gene open 7003-7470 hupA
3119 JAMZRD010000061.1 GCA030676125_01688 gene open 7524-9680
3120 JAMZRD010000061.1 GCA030676125_01689 gene open 9812-10483 ddpX
3121 JAMZRD010000061.1 GCA030676125_01690 gene open 10515-11738 paaI
3122 JAMZRD010000061.1 GCA030676125_01691 gene open 11763-13532
3123 JAMZRD010000061.1 GCA030676125_01692 gene open 13580-16567 ybgF
3124 JAMZRD010000061.1 GCA030676125_01693 gene open 16825-19065 spoT
3125 JAMZRD010000061.1 GCA030676125_01694 gene open 19133-20521 cls
3126 JAMZRD010000062.1 repeat_region open 15096-21925 CRISPR array with 104 repeats of length 30%2C consensus sequence ATTTCAATTGCACCATACAGGAATTAAAAC and spacer length 35
3127 JAMZRD010000062.1 GCA030676125_00862 CDS open 54-359 _na     101_aa hypothetical protein
3128 JAMZRD010000062.1 GCA030676125_00864 CDS open 905-1876 _na     323_aa fmt methionyl-tRNA formyltransferase
3129 JAMZRD010000062.1 GCA030676125_00865 CDS open 2039-4582 _na     847_aa yfhO YfhO family protein
3130 JAMZRD010000062.1 GCA030676125_00866 CDS open 4586-6517 _na     643_aa mdoB Sulfatase N-terminal domain-containing protein
3131 JAMZRD010000062.1 GCA030676125_00867 CDS open 7166-7831 _na     221_aa cas6 CRISPR-associated endoribonuclease Cas6
3132 JAMZRD010000062.1 GCA030676125_00868 CDS open 7838-8425 _na     195_aa CRISPR-associated protein Cas5
3133 JAMZRD010000062.1 GCA030676125_00869 CDS open 8442-10562 _na     706_aa putative CRISPR-associated helicase Cas3 core
3134 JAMZRD010000062.1 GCA030676125_00870 CDS open 10573-11868 _na     431_aa hypothetical protein
3135 JAMZRD010000062.1 GCA030676125_00871 CDS open 11889-12947 _na     352_aa CRISPR-associated protein Cas7
3136 JAMZRD010000062.1 GCA030676125_00872 CDS open 13065-13574 _na     169_aa cas4 CRISPR-associated protein Cas4
3137 JAMZRD010000062.1 GCA030676125_00873 CDS open 13571-14587 _na     338_aa cas1b type I-B CRISPR-associated endonuclease Cas1b
3138 JAMZRD010000062.1 GCA030676125_00874 CDS open 14587-14850 _na     87_aa cas2 CRISPR-associated endonuclease Cas2
3139 JAMZRD010000062.1 GCA030676125_00862 gene open 54-359
3140 JAMZRD010000062.1 GCA030676125_00864 gene open 905-1876 fmt
3141 JAMZRD010000062.1 GCA030676125_00865 gene open 2039-4582 yfhO
3142 JAMZRD010000062.1 GCA030676125_00866 gene open 4586-6517 mdoB
3143 JAMZRD010000062.1 GCA030676125_00867 gene open 7166-7831 cas6
3144 JAMZRD010000062.1 GCA030676125_00868 gene open 7838-8425
3145 JAMZRD010000062.1 GCA030676125_00869 gene open 8442-10562
3146 JAMZRD010000062.1 GCA030676125_00870 gene open 10573-11868
3147 JAMZRD010000062.1 GCA030676125_00871 gene open 11889-12947
3148 JAMZRD010000062.1 GCA030676125_00872 gene open 13065-13574 cas4
3149 JAMZRD010000062.1 GCA030676125_00873 gene open 13571-14587 cas1b
3150 JAMZRD010000062.1 GCA030676125_00874 gene open 14587-14850 cas2
3151 JAMZRD010000062.1 GCA030676125_00863 gene open 605-678 trnD
3152 JAMZRD010000062.1 GCA030676125_00863 tRNA open 605-678 trnD tRNA-Asp(gtc)
3153 JAMZRD010000063.1 GCA030676125_01695 CDS open 30-266 _na     78_aa traJ Conjugative transposon TraJ C-terminal domain-containing protein
3154 JAMZRD010000063.1 GCA030676125_01696 CDS open 291-914 _na     207_aa traK conjugative transposon protein TraK
3155 JAMZRD010000063.1 GCA030676125_01697 CDS open 919-1215 _na     98_aa hypothetical protein
3156 JAMZRD010000063.1 GCA030676125_01698 CDS open 1187-2413 _na     408_aa traM conjugative transposon protein TraM
3157 JAMZRD010000063.1 GCA030676125_01699 CDS open 2440-3390 _na     316_aa traN conjugative transposon protein TraN
3158 JAMZRD010000063.1 GCA030676125_01700 CDS open 3390-3962 _na     190_aa traO Conjugative transposon protein TraO
3159 JAMZRD010000063.1 GCA030676125_01701 CDS open 3975-4412 _na     145_aa DUF3872 domain-containing protein
3160 JAMZRD010000063.1 GCA030676125_01702 CDS open 5019-5645 _na     208_aa DUF6879 domain-containing protein
3161 JAMZRD010000063.1 GCA030676125_01703 CDS open 5642-6118 _na     158_aa hypothetical protein
3162 JAMZRD010000063.1 GCA030676125_01695 gene open 30-266 traJ
3163 JAMZRD010000063.1 GCA030676125_01696 gene open 291-914 traK
3164 JAMZRD010000063.1 GCA030676125_01697 gene open 919-1215
3165 JAMZRD010000063.1 GCA030676125_01698 gene open 1187-2413 traM
3166 JAMZRD010000063.1 GCA030676125_01699 gene open 2440-3390 traN
3167 JAMZRD010000063.1 GCA030676125_01700 gene open 3390-3962 traO
3168 JAMZRD010000063.1 GCA030676125_01701 gene open 3975-4412
3169 JAMZRD010000063.1 GCA030676125_01702 gene open 5019-5645
3170 JAMZRD010000063.1 GCA030676125_01703 gene open 5642-6118
3171 JAMZRD010000064.1 GCA030676125_00875 CDS open 176-1795 _na     539_aa pyrG CTP synthase
3172 JAMZRD010000064.1 GCA030676125_00876 CDS open 1922-3805 _na     627_aa yidC membrane protein insertase YidC
3173 JAMZRD010000064.1 GCA030676125_00877 CDS open 3896-5779 _na     627_aa purF Amidophosphoribosyltransferase%2C putative
3174 JAMZRD010000064.1 GCA030676125_00878 CDS open 5813-6886 _na     357_aa carA carbamoyl phosphate synthase small subunit
3175 JAMZRD010000064.1 GCA030676125_00879 CDS open 6905-10132 _na     1075_aa carB carbamoyl-phosphate synthase large subunit
3176 JAMZRD010000064.1 GCA030676125_00880 CDS open 10329-12272 _na     647_aa nit1 NAD(+) synthase
3177 JAMZRD010000064.1 GCA030676125_00881 CDS open 12382-13230 _na     282_aa yoaR Putative vancomycin B-type resistance protein VanW
3178 JAMZRD010000064.1 GCA030676125_00875 gene open 176-1795 pyrG
3179 JAMZRD010000064.1 GCA030676125_00876 gene open 1922-3805 yidC
3180 JAMZRD010000064.1 GCA030676125_00877 gene open 3896-5779 purF
3181 JAMZRD010000064.1 GCA030676125_00878 gene open 5813-6886 carA
3182 JAMZRD010000064.1 GCA030676125_00879 gene open 6905-10132 carB
3183 JAMZRD010000064.1 GCA030676125_00880 gene open 10329-12272 nit1
3184 JAMZRD010000064.1 GCA030676125_00881 gene open 12382-13230 yoaR
3185 JAMZRD010000065.1 regulatory_region open 67-279 Cobalamin riboswitch aptamer
3186 JAMZRD010000065.1 GCA030676125_00882 CDS open 806-2485 _na     559_aa ybjL putative transporter
3187 JAMZRD010000065.1 GCA030676125_00883 CDS open 2578-3093 _na     171_aa GyrI-like small molecule binding domain-containing protein
3188 JAMZRD010000065.1 GCA030676125_00884 CDS open 3090-4055 _na     321_aa czcD Heavy metal efflux pump%2C CzcD family
3189 JAMZRD010000065.1 GCA030676125_00885 CDS open 4111-4854 _na     247_aa hypothetical protein
3190 JAMZRD010000065.1 GCA030676125_00886 CDS open 5125-5331 _na     68_aa hypothetical protein
3191 JAMZRD010000065.1 GCA030676125_00887 CDS open 5348-8203 _na     951_aa lptD LPS-assembly protein LptD central domain-containing protein
3192 JAMZRD010000065.1 GCA030676125_00888 CDS open 8230-8946 _na     238_aa glpG Rhomboid family protein
3193 JAMZRD010000065.1 GCA030676125_00889 CDS open 8930-9844 _na     304_aa glpG Rhomboid family intramembrane serine protease
3194 JAMZRD010000065.1 GCA030676125_00890 CDS open 9841-10986 _na     381_aa elsH Endonuclease/exonuclease/phosphatase domain-containing protein
3195 JAMZRD010000065.1 GCA030676125_00891 CDS open 11239-12618 _na     459_aa tnaA Beta-eliminating lyase
3196 JAMZRD010000065.1 GCA030676125_00892 CDS open 12874-13110 _na     78_aa IS5/IS1182 family transposase
3197 JAMZRD010000065.1 GCA030676125_00882 gene open 806-2485 ybjL
3198 JAMZRD010000065.1 GCA030676125_00883 gene open 2578-3093
3199 JAMZRD010000065.1 GCA030676125_00884 gene open 3090-4055 czcD
3200 JAMZRD010000065.1 GCA030676125_00885 gene open 4111-4854
3201 JAMZRD010000065.1 GCA030676125_00886 gene open 5125-5331
3202 JAMZRD010000065.1 GCA030676125_00887 gene open 5348-8203 lptD
3203 JAMZRD010000065.1 GCA030676125_00888 gene open 8230-8946 glpG
3204 JAMZRD010000065.1 GCA030676125_00889 gene open 8930-9844 glpG
3205 JAMZRD010000065.1 GCA030676125_00890 gene open 9841-10986 elsH
3206 JAMZRD010000065.1 GCA030676125_00891 gene open 11239-12618 tnaA
3207 JAMZRD010000065.1 GCA030676125_00892 gene open 12874-13110
3208 JAMZRD010000066.1 GCA030676125_00893 CDS open 825-2342 _na     505_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
3209 JAMZRD010000066.1 GCA030676125_00894 CDS open 2445-3464 _na     339_aa mreB Cell shape-determining protein MreB
3210 JAMZRD010000066.1 GCA030676125_00895 CDS open 3502-4389 _na     295_aa mreC rod shape-determining protein MreC
3211 JAMZRD010000066.1 GCA030676125_00896 CDS open 4389-4907 _na     172_aa mreD rod shape-determining protein MreD
3212 JAMZRD010000066.1 GCA030676125_00897 CDS open 4900-6765 _na     621_aa mrdA penicillin-binding protein 2
3213 JAMZRD010000066.1 GCA030676125_00898 CDS open 6755-8212 _na     485_aa ftsW Rod shape-determining protein RodA
3214 JAMZRD010000066.1 GCA030676125_00899 CDS open 8240-9451 _na     403_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
3215 JAMZRD010000066.1 GCA030676125_00893 gene open 825-2342 purH
3216 JAMZRD010000066.1 GCA030676125_00894 gene open 2445-3464 mreB
3217 JAMZRD010000066.1 GCA030676125_00895 gene open 3502-4389 mreC
3218 JAMZRD010000066.1 GCA030676125_00896 gene open 4389-4907 mreD
3219 JAMZRD010000066.1 GCA030676125_00897 gene open 4900-6765 mrdA
3220 JAMZRD010000066.1 GCA030676125_00898 gene open 6755-8212 ftsW
3221 JAMZRD010000066.1 GCA030676125_00899 gene open 8240-9451
3222 JAMZRD010000067.1 GCA030676125_00900 CDS open 132-842 _na     236_aa hypothetical protein
3223 JAMZRD010000067.1 GCA030676125_00901 CDS open 881-1840 _na     319_aa ldhA D-isomer specific 2-hydroxyacid dehydrogenase family protein
3224 JAMZRD010000067.1 GCA030676125_00902 CDS open 2059-2778 _na     239_aa T9SS C-terminal target domain-containing protein
3225 JAMZRD010000067.1 GCA030676125_00903 CDS open 2801-3673 _na     290_aa omp28 outer membrane lipoprotein Omp28
3226 JAMZRD010000067.1 GCA030676125_00904 CDS open 3693-5438 _na     581_aa DUF5723 domain-containing protein
3227 JAMZRD010000067.1 GCA030676125_00905 CDS open 5494-5976 _na     160_aa bcp Thioredoxin domain-containing protein
3228 JAMZRD010000067.1 GCA030676125_00907 CDS open 7062-8300 _na     412_aa nqrF NADH:ubiquinone reductase (Na(+)-transporting) subunit F
3229 JAMZRD010000067.1 GCA030676125_00908 CDS open 8319-8933 _na     204_aa nqrE NADH:ubiquinone reductase (Na(+)-transporting) subunit E
3230 JAMZRD010000067.1 GCA030676125_00909 CDS open 8973-9602 _na     209_aa nqrD NADH:ubiquinone reductase (Na(+)-transporting) subunit D
3231 JAMZRD010000067.1 GCA030676125_00910 CDS open 9608-10342 _na     244_aa nqrC Na(+)-translocating NADH-quinone reductase subunit C
3232 JAMZRD010000067.1 GCA030676125_00911 CDS open 10366-11565 _na     399_aa nqrB NADH:ubiquinone reductase (Na(+)-transporting) subunit B
3233 JAMZRD010000067.1 GCA030676125_00912 CDS open 11596-12951 _na     451_aa nqrA NADH:ubiquinone reductase (Na(+)-transporting) subunit A
3234 JAMZRD010000067.1 GCA030676125_00913 CDS open 13447-13599 _na     50_aa hypothetical protein
3235 JAMZRD010000067.1 GCA030676125_00914 CDS open 13732-15048 _na     438_aa mecR1 Putative TonB
3236 JAMZRD010000067.1 GCA030676125_00915 CDS open 15083-15463 _na     126_aa copY Transcriptional regulator%2C putative
3237 JAMZRD010000067.1 GCA030676125_00916 CDS open 15555-16442 _na     295_aa menA 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase
3238 JAMZRD010000067.1 GCA030676125_00917 CDS open 16432-17625 _na     397_aa lysA diaminopimelate decarboxylase
3239 JAMZRD010000067.1 GCA030676125_00918 CDS open 17609-18949 _na     446_aa metL1 Aspartokinase
3240 JAMZRD010000067.1 GCA030676125_00919 CDS open 18967-19707 _na     246_aa ftsE Cell-division ATP-binding protein
3241 JAMZRD010000067.1 GCA030676125_00920 CDS open 19777-19974 _na     65_aa hypothetical protein
3242 JAMZRD010000067.1 GCA030676125_00921 CDS open 20103-21116 _na     337_aa lysM Peptidase M24
3243 JAMZRD010000067.1 GCA030676125_00922 CDS open 21596-22699 _na     367_aa ychF redox-regulated ATPase YchF
3244 JAMZRD010000067.1 GCA030676125_00923 CDS open 22904-24925 _na     673_aa ftsH ATP-dependent zinc metalloprotease FtsH
3245 JAMZRD010000067.1 GCA030676125_00924 CDS open 24954-25808 _na     284_aa cdsA Phosphatidate cytidylyltransferase
3246 JAMZRD010000067.1 GCA030676125_00925 CDS open 25990-28044 _na     684_aa htpG molecular chaperone HtpG
3247 JAMZRD010000067.1 GCA030676125_00926 CDS open 28041-28298 _na     85_aa hypothetical protein
3248 JAMZRD010000067.1 GCA030676125_00900 gene open 132-842
3249 JAMZRD010000067.1 GCA030676125_00901 gene open 881-1840 ldhA
3250 JAMZRD010000067.1 GCA030676125_00902 gene open 2059-2778
3251 JAMZRD010000067.1 GCA030676125_00903 gene open 2801-3673 omp28
3252 JAMZRD010000067.1 GCA030676125_00904 gene open 3693-5438
3253 JAMZRD010000067.1 GCA030676125_00905 gene open 5494-5976 bcp
3254 JAMZRD010000067.1 GCA030676125_00907 gene open 7062-8300 nqrF
3255 JAMZRD010000067.1 GCA030676125_00908 gene open 8319-8933 nqrE
3256 JAMZRD010000067.1 GCA030676125_00909 gene open 8973-9602 nqrD
3257 JAMZRD010000067.1 GCA030676125_00910 gene open 9608-10342 nqrC
3258 JAMZRD010000067.1 GCA030676125_00911 gene open 10366-11565 nqrB
3259 JAMZRD010000067.1 GCA030676125_00912 gene open 11596-12951 nqrA
3260 JAMZRD010000067.1 GCA030676125_00913 gene open 13447-13599
3261 JAMZRD010000067.1 GCA030676125_00914 gene open 13732-15048 mecR1
3262 JAMZRD010000067.1 GCA030676125_00915 gene open 15083-15463 copY
3263 JAMZRD010000067.1 GCA030676125_00916 gene open 15555-16442 menA
3264 JAMZRD010000067.1 GCA030676125_00917 gene open 16432-17625 lysA
3265 JAMZRD010000067.1 GCA030676125_00918 gene open 17609-18949 metL1
3266 JAMZRD010000067.1 GCA030676125_00919 gene open 18967-19707 ftsE
3267 JAMZRD010000067.1 GCA030676125_00920 gene open 19777-19974
3268 JAMZRD010000067.1 GCA030676125_00921 gene open 20103-21116 lysM
3269 JAMZRD010000067.1 GCA030676125_00922 gene open 21596-22699 ychF
3270 JAMZRD010000067.1 GCA030676125_00923 gene open 22904-24925 ftsH
3271 JAMZRD010000067.1 GCA030676125_00924 gene open 24954-25808 cdsA
3272 JAMZRD010000067.1 GCA030676125_00925 gene open 25990-28044 htpG
3273 JAMZRD010000067.1 GCA030676125_00926 gene open 28041-28298
3274 JAMZRD010000067.1 GCA030676125_00906 gene open 6656-6727 trnfM
3275 JAMZRD010000067.1 GCA030676125_00906 tRNA open 6656-6727 trnfM tRNA-fMet(cat)
3276 JAMZRD010000068.1 GCA030676125_02051 CDS open 266-952 _na     228_aa DUF452 domain-containing protein
3277 JAMZRD010000068.1 GCA030676125_02052 CDS open 931-1698 _na     255_aa bioC malonyl-ACP O-methyltransferase BioC
3278 JAMZRD010000068.1 GCA030676125_02053 CDS open 1728-2789 _na     353_aa ctpA Tail specific protease domain-containing protein
3279 JAMZRD010000068.1 GCA030676125_02054 CDS open 2797-3750 _na     317_aa DUF3316 domain-containing protein
3280 JAMZRD010000068.1 GCA030676125_02055 CDS open 3731-6427 _na     898_aa gyrA DNA gyrase/topoisomerase IV subunit A
3281 JAMZRD010000068.1 GCA030676125_02056 CDS open 6484-7677 _na     397_aa rnfG FMN-binding domain-containing protein
3282 JAMZRD010000068.1 GCA030676125_02057 CDS open 7767-8300 _na     177_aa hypothetical protein
3283 JAMZRD010000068.1 GCA030676125_02058 CDS open 8454-9656 _na     400_aa Secreted protein
3284 JAMZRD010000068.1 GCA030676125_02059 CDS open 9761-11425 _na     554_aa Transporter
3285 JAMZRD010000068.1 GCA030676125_02060 CDS open 11391-11588 _na     65_aa hypothetical protein
3286 JAMZRD010000068.1 GCA030676125_02061 CDS open 11717-11956 _na     79_aa hypothetical protein
3287 JAMZRD010000068.1 GCA030676125_02051 gene open 266-952
3288 JAMZRD010000068.1 GCA030676125_02052 gene open 931-1698 bioC
3289 JAMZRD010000068.1 GCA030676125_02053 gene open 1728-2789 ctpA
3290 JAMZRD010000068.1 GCA030676125_02054 gene open 2797-3750
3291 JAMZRD010000068.1 GCA030676125_02055 gene open 3731-6427 gyrA
3292 JAMZRD010000068.1 GCA030676125_02056 gene open 6484-7677 rnfG
3293 JAMZRD010000068.1 GCA030676125_02057 gene open 7767-8300
3294 JAMZRD010000068.1 GCA030676125_02058 gene open 8454-9656
3295 JAMZRD010000068.1 GCA030676125_02059 gene open 9761-11425
3296 JAMZRD010000068.1 GCA030676125_02060 gene open 11391-11588
3297 JAMZRD010000068.1 GCA030676125_02061 gene open 11717-11956
3298 JAMZRD010000069.1 GCA030676125_00927 CDS open 134-706 _na     190_aa greA transcription elongation factor GreA
3299 JAMZRD010000069.1 GCA030676125_00928 CDS open 721-1110 _na     129_aa hinT HIT family protein
3300 JAMZRD010000069.1 GCA030676125_00929 CDS open 1486-1650 _na     54_aa hypothetical protein
3301 JAMZRD010000069.1 GCA030676125_00930 CDS open 1740-2216 _na     158_aa Outer membrane protein beta-barrel domain-containing protein
3302 JAMZRD010000069.1 GCA030676125_00931 CDS open 2213-3499 _na     428_aa Glycoside hydrolase family 57 N-terminal domain-containing protein
3303 JAMZRD010000069.1 GCA030676125_00932 CDS open 3496-4758 _na     420_aa rfaB Glycosyl transferase%2C group 1 family protein
3304 JAMZRD010000069.1 GCA030676125_00933 CDS open 4755-6731 _na     658_aa gDB1 Putative 4-alpha-glucanotransferase
3305 JAMZRD010000069.1 GCA030676125_00934 CDS open 6861-7007 _na     48_aa hypothetical protein
3306 JAMZRD010000069.1 GCA030676125_00935 CDS open 7218-7919 _na     233_aa Putative ATP-binding component of ABC transporter protein
3307 JAMZRD010000069.1 GCA030676125_00936 CDS open 7954-9426 _na     490_aa DUF5687 domain-containing protein
3308 JAMZRD010000069.1 GCA030676125_00937 CDS open 9546-10802 _na     418_aa pgk Phosphoglycerate kinase
3309 JAMZRD010000069.1 GCA030676125_00938 CDS open 11098-12705 _na     535_aa pckA phosphoenolpyruvate carboxykinase (ATP)
3310 JAMZRD010000069.1 GCA030676125_00939 CDS open 12895-13161 _na     88_aa putative partial hemagglutinin-related protein
3311 JAMZRD010000069.1 GCA030676125_00940 CDS open 13107-13469 _na     120_aa putative partial hemagglutinin-related protein
3312 JAMZRD010000069.1 GCA030676125_00927 gene open 134-706 greA
3313 JAMZRD010000069.1 GCA030676125_00928 gene open 721-1110 hinT
3314 JAMZRD010000069.1 GCA030676125_00929 gene open 1486-1650
3315 JAMZRD010000069.1 GCA030676125_00930 gene open 1740-2216
3316 JAMZRD010000069.1 GCA030676125_00931 gene open 2213-3499
3317 JAMZRD010000069.1 GCA030676125_00932 gene open 3496-4758 rfaB
3318 JAMZRD010000069.1 GCA030676125_00933 gene open 4755-6731 gDB1
3319 JAMZRD010000069.1 GCA030676125_00934 gene open 6861-7007
3320 JAMZRD010000069.1 GCA030676125_00935 gene open 7218-7919
3321 JAMZRD010000069.1 GCA030676125_00936 gene open 7954-9426
3322 JAMZRD010000069.1 GCA030676125_00937 gene open 9546-10802 pgk
3323 JAMZRD010000069.1 GCA030676125_00938 gene open 11098-12705 pckA
3324 JAMZRD010000069.1 GCA030676125_00939 gene open 12895-13161
3325 JAMZRD010000069.1 GCA030676125_00940 gene open 13107-13469
3326 JAMZRD010000070.1 GCA030676125_01713 CDS open 113-511 _na     132_aa hypothetical protein
3327 JAMZRD010000070.1 GCA030676125_01714 CDS open 1646-2320 _na     224_aa hypothetical protein
3328 JAMZRD010000070.1 GCA030676125_01715 CDS open 2656-2829 _na     57_aa hypothetical protein
3329 JAMZRD010000070.1 GCA030676125_01713 gene open 113-511
3330 JAMZRD010000070.1 GCA030676125_01714 gene open 1646-2320
3331 JAMZRD010000070.1 GCA030676125_01715 gene open 2656-2829
3332 JAMZRD010000071.1 GCA030676125_01716 CDS open 183-1592 _na     469_aa DUF3945 domain-containing protein
3333 JAMZRD010000071.1 GCA030676125_01717 CDS open 1681-3774 _na     697_aa topA DNA topoisomerase
3334 JAMZRD010000071.1 GCA030676125_01718 CDS open 3780-9641 _na     1953_aa DUF2958 domain-containing protein
3335 JAMZRD010000071.1 GCA030676125_01719 CDS open 9723-10967 _na     414_aa helicase C-terminal domain-containing protein
3336 JAMZRD010000071.1 GCA030676125_01716 gene open 183-1592
3337 JAMZRD010000071.1 GCA030676125_01717 gene open 1681-3774 topA
3338 JAMZRD010000071.1 GCA030676125_01718 gene open 3780-9641
3339 JAMZRD010000071.1 GCA030676125_01719 gene open 9723-10967
3340 JAMZRD010000072.1 GCA030676125_01720 CDS open 348-560 _na     70_aa hypothetical protein
3341 JAMZRD010000072.1 GCA030676125_01721 CDS open 454-1107 _na     217_aa impB/mucB/samB family
3342 JAMZRD010000072.1 GCA030676125_01722 CDS open 1115-1540 _na     141_aa lexA Translesion error-prone DNA polymerase V autoproteolytic subunit
3343 JAMZRD010000072.1 GCA030676125_01723 CDS open 1604-1789 _na     61_aa hypothetical protein
3344 JAMZRD010000072.1 GCA030676125_01724 CDS open 1853-2026 _na     57_aa hypothetical protein
3345 JAMZRD010000072.1 GCA030676125_01725 CDS open 2549-3013 _na     154_aa ybbJ Membrane protein%2C putative
3346 JAMZRD010000072.1 GCA030676125_01726 CDS open 3041-4021 _na     326_aa hflC Band 7/Mec-2 family protein
3347 JAMZRD010000072.1 GCA030676125_01727 CDS open 4018-5217 _na     399_aa lipid A deacylase
3348 JAMZRD010000072.1 GCA030676125_01728 CDS open 5610-7049 _na     479_aa NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta
3349 JAMZRD010000072.1 GCA030676125_01729 CDS open 7046-7360 _na     104_aa pntA proton-translocating NAD(P)(+) transhydrogenase
3350 JAMZRD010000072.1 GCA030676125_01730 CDS open 7474-8631 _na     385_aa pntA proton-translocating NAD(P)(+) transhydrogenase
3351 JAMZRD010000072.1 GCA030676125_01731 CDS open 9010-9429 _na     139_aa mscL large-conductance mechanosensitive channel protein MscL
3352 JAMZRD010000072.1 GCA030676125_01732 CDS open 10369-12525 _na     718_aa patZN Acetyltransferase
3353 JAMZRD010000072.1 GCA030676125_01733 CDS open 12568-13878 _na     436_aa aspB Aminotransferase class I/classII large domain-containing protein
3354 JAMZRD010000072.1 GCA030676125_01734 CDS open 14007-15116 _na     369_aa cTD-A Cleaved adhesin domain-containing protein
3355 JAMZRD010000072.1 GCA030676125_01735 CDS open 15337-15645 _na     102_aa DUF4286 domain-containing protein
3356 JAMZRD010000072.1 GCA030676125_01736 CDS open 15718-16287 _na     189_aa ruvC crossover junction endodeoxyribonuclease RuvC
3357 JAMZRD010000072.1 GCA030676125_01737 CDS open 16335-17669 _na     444_aa ylaK PhoH family protein
3358 JAMZRD010000072.1 GCA030676125_01738 CDS open 17826-19493 _na     555_aa fhs formate--tetrahydrofolate ligase
3359 JAMZRD010000072.1 GCA030676125_01720 gene open 348-560
3360 JAMZRD010000072.1 GCA030676125_01721 gene open 454-1107
3361 JAMZRD010000072.1 GCA030676125_01722 gene open 1115-1540 lexA
3362 JAMZRD010000072.1 GCA030676125_01723 gene open 1604-1789
3363 JAMZRD010000072.1 GCA030676125_01724 gene open 1853-2026
3364 JAMZRD010000072.1 GCA030676125_01725 gene open 2549-3013 ybbJ
3365 JAMZRD010000072.1 GCA030676125_01726 gene open 3041-4021 hflC
3366 JAMZRD010000072.1 GCA030676125_01727 gene open 4018-5217
3367 JAMZRD010000072.1 GCA030676125_01728 gene open 5610-7049
3368 JAMZRD010000072.1 GCA030676125_01729 gene open 7046-7360 pntA
3369 JAMZRD010000072.1 GCA030676125_01730 gene open 7474-8631 pntA
3370 JAMZRD010000072.1 GCA030676125_01731 gene open 9010-9429 mscL
3371 JAMZRD010000072.1 GCA030676125_01732 gene open 10369-12525 patZN
3372 JAMZRD010000072.1 GCA030676125_01733 gene open 12568-13878 aspB
3373 JAMZRD010000072.1 GCA030676125_01734 gene open 14007-15116 cTD-A
3374 JAMZRD010000072.1 GCA030676125_01735 gene open 15337-15645
3375 JAMZRD010000072.1 GCA030676125_01736 gene open 15718-16287 ruvC
3376 JAMZRD010000072.1 GCA030676125_01737 gene open 16335-17669 ylaK
3377 JAMZRD010000072.1 GCA030676125_01738 gene open 17826-19493 fhs
3378 JAMZRD010000073.1 GCA030676125_01739 CDS open 616-2136 _na     506_aa guaA glutamine-hydrolyzing GMP synthase
3379 JAMZRD010000073.1 GCA030676125_01740 CDS open 2206-3027 _na     273_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
3380 JAMZRD010000073.1 GCA030676125_01741 CDS open 3079-3711 _na     210_aa yadS YadS protein
3381 JAMZRD010000073.1 GCA030676125_01742 CDS open 4120-4569 _na     149_aa yqeY Glutamyl-tRNA amidotransferase
3382 JAMZRD010000073.1 GCA030676125_01743 CDS open 4601-5974 _na     457_aa ftsZ cell division protein FtsZ
3383 JAMZRD010000073.1 GCA030676125_01744 CDS open 5977-7407 _na     476_aa ftsA Cell division protein FtsA
3384 JAMZRD010000073.1 GCA030676125_01745 CDS open 7465-8241 _na     258_aa ftsQ FtsQ
3385 JAMZRD010000073.1 GCA030676125_01746 CDS open 8235-9605 _na     456_aa murC UDP-N-acetylmuramate--L-alanine ligase
3386 JAMZRD010000073.1 GCA030676125_01747 CDS open 9605-10744 _na     379_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
3387 JAMZRD010000073.1 GCA030676125_01748 CDS open 10741-11997 _na     418_aa ftsW putative peptidoglycan glycosyltransferase FtsW
3388 JAMZRD010000073.1 GCA030676125_01749 CDS open 12009-13361 _na     450_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
3389 JAMZRD010000073.1 GCA030676125_01750 CDS open 13385-14644 _na     419_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
3390 JAMZRD010000073.1 GCA030676125_01751 CDS open 14659-16122 _na     487_aa murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
3391 JAMZRD010000073.1 GCA030676125_01752 CDS open 16133-18334 _na     733_aa ftsI Penicillin-binding protein 2%2C putative
3392 JAMZRD010000073.1 GCA030676125_01753 CDS open 18344-18817 _na     157_aa ftsL Cell division protein FtsL
3393 JAMZRD010000073.1 GCA030676125_01754 CDS open 18817-19752 _na     311_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
3394 JAMZRD010000073.1 GCA030676125_01755 CDS open 20435-21451 _na     338_aa asd aspartate-semialdehyde dehydrogenase
3395 JAMZRD010000073.1 GCA030676125_01756 CDS open 21647-23203 _na     518_aa LTD domain-containing protein
3396 JAMZRD010000073.1 GCA030676125_01739 gene open 616-2136 guaA
3397 JAMZRD010000073.1 GCA030676125_01740 gene open 2206-3027 panB
3398 JAMZRD010000073.1 GCA030676125_01741 gene open 3079-3711 yadS
3399 JAMZRD010000073.1 GCA030676125_01742 gene open 4120-4569 yqeY
3400 JAMZRD010000073.1 GCA030676125_01743 gene open 4601-5974 ftsZ
3401 JAMZRD010000073.1 GCA030676125_01744 gene open 5977-7407 ftsA
3402 JAMZRD010000073.1 GCA030676125_01745 gene open 7465-8241 ftsQ
3403 JAMZRD010000073.1 GCA030676125_01746 gene open 8235-9605 murC
3404 JAMZRD010000073.1 GCA030676125_01747 gene open 9605-10744 murG
3405 JAMZRD010000073.1 GCA030676125_01748 gene open 10741-11997 ftsW
3406 JAMZRD010000073.1 GCA030676125_01749 gene open 12009-13361 murD
3407 JAMZRD010000073.1 GCA030676125_01750 gene open 13385-14644 mraY
3408 JAMZRD010000073.1 GCA030676125_01751 gene open 14659-16122 murE
3409 JAMZRD010000073.1 GCA030676125_01752 gene open 16133-18334 ftsI
3410 JAMZRD010000073.1 GCA030676125_01753 gene open 18344-18817 ftsL
3411 JAMZRD010000073.1 GCA030676125_01754 gene open 18817-19752 rsmH
3412 JAMZRD010000073.1 GCA030676125_01755 gene open 20435-21451 asd
3413 JAMZRD010000073.1 GCA030676125_01756 gene open 21647-23203
3414 JAMZRD010000074.1 GCA030676125_00941 CDS open 233-334 _na     33_aa hypothetical protein
3415 JAMZRD010000074.1 GCA030676125_00942 CDS open 340-885 _na     181_aa hypothetical protein
3416 JAMZRD010000074.1 GCA030676125_00943 CDS open 1003-2370 _na     455_aa tolC Outer membrane efflux protein
3417 JAMZRD010000074.1 GCA030676125_00944 CDS open 2367-3473 _na     368_aa acrA Membrane fusion efflux protein
3418 JAMZRD010000074.1 GCA030676125_00945 CDS open 3543-4805 _na     420_aa salY Putative ABC transporter ATP-binding protein
3419 JAMZRD010000074.1 GCA030676125_00946 CDS open 4828-6102 _na     424_aa salY ABC transporter%2C permease protein%2C putative
3420 JAMZRD010000074.1 GCA030676125_00947 CDS open 6127-6786 _na     219_aa lolD ABC transporter%2C ATP-binding protein
3421 JAMZRD010000074.1 GCA030676125_00948 CDS open 6805-7212 _na     135_aa DUF6249 domain-containing protein
3422 JAMZRD010000074.1 GCA030676125_00949 CDS open 7697-8221 _na     174_aa rpoE RNA polymerase sigma-70 factor%2C ECF subfamily
3423 JAMZRD010000074.1 GCA030676125_00950 CDS open 8218-8610 _na     130_aa DUF3333 domain-containing protein
3424 JAMZRD010000074.1 GCA030676125_00951 CDS open 8807-9061 _na     84_aa Transposase
3425 JAMZRD010000074.1 GCA030676125_00941 gene open 233-334
3426 JAMZRD010000074.1 GCA030676125_00942 gene open 340-885
3427 JAMZRD010000074.1 GCA030676125_00943 gene open 1003-2370 tolC
3428 JAMZRD010000074.1 GCA030676125_00944 gene open 2367-3473 acrA
3429 JAMZRD010000074.1 GCA030676125_00945 gene open 3543-4805 salY
3430 JAMZRD010000074.1 GCA030676125_00946 gene open 4828-6102 salY
3431 JAMZRD010000074.1 GCA030676125_00947 gene open 6127-6786 lolD
3432 JAMZRD010000074.1 GCA030676125_00948 gene open 6805-7212
3433 JAMZRD010000074.1 GCA030676125_00949 gene open 7697-8221 rpoE
3434 JAMZRD010000074.1 GCA030676125_00950 gene open 8218-8610
3435 JAMZRD010000074.1 GCA030676125_00951 gene open 8807-9061
3436 JAMZRD010000075.1 GCA030676125_00952 CDS open 511-900 _na     129_aa ridA Putative YjgF-like protein
3437 JAMZRD010000075.1 GCA030676125_00953 CDS open 926-1675 _na     249_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
3438 JAMZRD010000075.1 GCA030676125_00954 CDS open 1672-3327 _na     551_aa recN DNA repair protein RecN
3439 JAMZRD010000075.1 GCA030676125_00955 CDS open 3342-4250 _na     302_aa DUF4835 domain-containing protein
3440 JAMZRD010000075.1 GCA030676125_00956 CDS open 4247-5461 _na     404_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
3441 JAMZRD010000075.1 GCA030676125_00957 CDS open 5487-6266 _na     259_aa dnaQ DNA polymerase III subunit epsilon
3442 JAMZRD010000075.1 GCA030676125_00958 CDS open 6279-7412 _na     377_aa dnaN DNA polymerase III subunit beta
3443 JAMZRD010000075.1 GCA030676125_00952 gene open 511-900 ridA
3444 JAMZRD010000075.1 GCA030676125_00953 gene open 926-1675 rlmB
3445 JAMZRD010000075.1 GCA030676125_00954 gene open 1672-3327 recN
3446 JAMZRD010000075.1 GCA030676125_00955 gene open 3342-4250
3447 JAMZRD010000075.1 GCA030676125_00956 gene open 4247-5461 coaBC
3448 JAMZRD010000075.1 GCA030676125_00957 gene open 5487-6266 dnaQ
3449 JAMZRD010000075.1 GCA030676125_00958 gene open 6279-7412 dnaN
3450 JAMZRD010000076.1 GCA030676125_00959 CDS open 440-1705 _na     421_aa wecC UDP-glucose 6-dehydrogenase
3451 JAMZRD010000076.1 GCA030676125_00960 CDS open 2041-3123 _na     360_aa serC phosphoserine transaminase
3452 JAMZRD010000076.1 GCA030676125_00961 CDS open 3224-4144 _na     306_aa serA D-3-phosphoglycerate dehydrogenase
3453 JAMZRD010000076.1 GCA030676125_00962 CDS open 4163-5410 _na     415_aa DUF1015 domain-containing protein
3454 JAMZRD010000076.1 GCA030676125_00963 CDS open 5576-6700 _na     374_aa Smr domain-containing protein
3455 JAMZRD010000076.1 GCA030676125_00964 CDS open 6724-7179 _na     151_aa cYTH CYTH domain-containing protein
3456 JAMZRD010000076.1 GCA030676125_00965 CDS open 7242-9404 _na     720_aa dpp11 Asp/Glu-specific dipeptidyl-peptidase
3457 JAMZRD010000076.1 GCA030676125_00966 CDS open 9561-11549 _na     662_aa lmbE Glucosamine-6-phosphate deaminase
3458 JAMZRD010000076.1 GCA030676125_00967 CDS open 11657-12139 _na     160_aa ftnA Ferritin
3459 JAMZRD010000076.1 GCA030676125_00968 CDS open 12593-13690 _na     365_aa gmd GDP-mannose 4%2C6-dehydratase
3460 JAMZRD010000076.1 GCA030676125_00969 CDS open 13683-14756 _na     357_aa wcaG GDP-L-fucose synthase
3461 JAMZRD010000076.1 GCA030676125_00970 CDS open 14895-15914 _na     339_aa ilvE branched-chain amino acid aminotransferase
3462 JAMZRD010000076.1 GCA030676125_00971 CDS open 16043-17764 _na     573_aa cls phospholipase D
3463 JAMZRD010000076.1 GCA030676125_00972 CDS open 17817-18023 _na     68_aa hypothetical protein
3464 JAMZRD010000076.1 GCA030676125_00959 gene open 440-1705 wecC
3465 JAMZRD010000076.1 GCA030676125_00960 gene open 2041-3123 serC
3466 JAMZRD010000076.1 GCA030676125_00961 gene open 3224-4144 serA
3467 JAMZRD010000076.1 GCA030676125_00962 gene open 4163-5410
3468 JAMZRD010000076.1 GCA030676125_00963 gene open 5576-6700
3469 JAMZRD010000076.1 GCA030676125_00964 gene open 6724-7179 cYTH
3470 JAMZRD010000076.1 GCA030676125_00965 gene open 7242-9404 dpp11
3471 JAMZRD010000076.1 GCA030676125_00966 gene open 9561-11549 lmbE
3472 JAMZRD010000076.1 GCA030676125_00967 gene open 11657-12139 ftnA
3473 JAMZRD010000076.1 GCA030676125_00968 gene open 12593-13690 gmd
3474 JAMZRD010000076.1 GCA030676125_00969 gene open 13683-14756 wcaG
3475 JAMZRD010000076.1 GCA030676125_00970 gene open 14895-15914 ilvE
3476 JAMZRD010000076.1 GCA030676125_00971 gene open 16043-17764 cls
3477 JAMZRD010000076.1 GCA030676125_00972 gene open 17817-18023
3478 JAMZRD010000077.1 GCA030676125_00973 CDS open 448-1770 _na     440_aa SIR2 family protein
3479 JAMZRD010000077.1 GCA030676125_00974 CDS open 2611-3171 _na     186_aa fldA Flavodoxin-like domain-containing protein
3480 JAMZRD010000077.1 GCA030676125_00975 CDS open 3390-5981 _na     863_aa clpB ATP-dependent chaperone ClpB
3481 JAMZRD010000077.1 GCA030676125_00973 gene open 448-1770
3482 JAMZRD010000077.1 GCA030676125_00974 gene open 2611-3171 fldA
3483 JAMZRD010000077.1 GCA030676125_00975 gene open 3390-5981 clpB
3484 JAMZRD010000078.1 GCA030676125_01757 CDS open 63-461 _na     132_aa hypothetical protein
3485 JAMZRD010000078.1 GCA030676125_01757 gene open 63-461
3486 JAMZRD010000079.1 GCA030676125_00976 CDS open 90-866 _na     258_aa hypothetical protein
3487 JAMZRD010000079.1 GCA030676125_00977 CDS open 1053-2183 _na     376_aa hypothetical protein
3488 JAMZRD010000079.1 GCA030676125_00978 CDS open 2400-2567 _na     55_aa hypothetical protein
3489 JAMZRD010000079.1 GCA030676125_00979 CDS open 2832-3851 _na     339_aa eis GNAT family N-acetyltransferase
3490 JAMZRD010000079.1 GCA030676125_00980 CDS open 3832-4761 _na     309_aa Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein
3491 JAMZRD010000079.1 GCA030676125_00981 CDS open 5411-6043 _na     210_aa Cleaved adhesin domain-containing protein
3492 JAMZRD010000079.1 GCA030676125_00976 gene open 90-866
3493 JAMZRD010000079.1 GCA030676125_00977 gene open 1053-2183
3494 JAMZRD010000079.1 GCA030676125_00978 gene open 2400-2567
3495 JAMZRD010000079.1 GCA030676125_00979 gene open 2832-3851 eis
3496 JAMZRD010000079.1 GCA030676125_00980 gene open 3832-4761
3497 JAMZRD010000079.1 GCA030676125_00981 gene open 5411-6043
3498 JAMZRD010000080.1 GCA030676125_01758 CDS open 893-1255 _na     120_aa hypothetical protein
3499 JAMZRD010000080.1 GCA030676125_01759 CDS open 1317-1841 _na     174_aa hypothetical protein
3500 JAMZRD010000080.1 GCA030676125_01760 CDS open 2042-3274 _na     410_aa nupG Nucleoside permease NupG