HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter sputorum (GCA_900446595.1)

Select a Genome:
BAKTA Annotations for GCA_900446595.1
Genome Selected: Campylobacter sputorum
ContigsBases CDSrRNA tmRNAtRNA
2 1767425 1767 11 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3662 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 3662 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 UFVG01000001.1 GCA900446595_01648 gene open 1393137-1393898
3002 UFVG01000001.1 GCA900446595_01649 gene open 1393901-1395064 thiH
3003 UFVG01000001.1 GCA900446595_01650 gene open 1395061-1395609
3004 UFVG01000001.1 GCA900446595_01651 gene open 1395676-1396494
3005 UFVG01000001.1 GCA900446595_01652 gene open 1396491-1398413
3006 UFVG01000001.1 GCA900446595_01653 gene open 1398406-1399398 holA
3007 UFVG01000001.1 GCA900446595_01654 gene open 1399495-1399923 rpsF
3008 UFVG01000001.1 GCA900446595_01655 gene open 1399933-1400511
3009 UFVG01000001.1 GCA900446595_01656 gene open 1400526-1400786 rpsR
3010 UFVG01000001.1 GCA900446595_01657 gene open 1400795-1401844 hemW
3011 UFVG01000001.1 GCA900446595_01658 gene open 1401922-1402410
3012 UFVG01000001.1 GCA900446595_01659 gene open 1402410-1403609
3013 UFVG01000001.1 GCA900446595_01660 gene open 1403613-1404161
3014 UFVG01000001.1 GCA900446595_01661 gene open 1404162-1404773
3015 UFVG01000001.1 GCA900446595_01662 gene open 1404784-1405920 folP
3016 UFVG01000001.1 GCA900446595_01663 gene open 1405926-1407869 ligA
3017 UFVG01000001.1 GCA900446595_01664 gene open 1407859-1408560
3018 UFVG01000001.1 GCA900446595_01665 gene open 1408541-1409374
3019 UFVG01000001.1 GCA900446595_01666 gene open 1409393-1410094 cmoA
3020 UFVG01000001.1 GCA900446595_01671 gene open 1410737-1411936 tuf
3021 UFVG01000001.1 GCA900446595_01672 gene open 1411988-1412155 rpmG
3022 UFVG01000001.1 GCA900446595_01674 gene open 1412264-1412443 secE
3023 UFVG01000001.1 GCA900446595_01675 gene open 1412462-1412992 nusG
3024 UFVG01000001.1 GCA900446595_01676 gene open 1413005-1413430 rplK
3025 UFVG01000001.1 GCA900446595_01677 gene open 1413493-1414194 rplA
3026 UFVG01000001.1 GCA900446595_01678 gene open 1414297-1414782 rplJ
3027 UFVG01000001.1 GCA900446595_01679 gene open 1414799-1415269
3028 UFVG01000001.1 GCA900446595_01680 gene open 1415263-1419402 rpoB
3029 UFVG01000001.1 GCA900446595_01681 gene open 1419395-1423915 rpoC
3030 UFVG01000001.1 GCA900446595_01682 gene open 1423989-1424555 efp
3031 UFVG01000001.1 GCA900446595_01683 gene open 1424607-1424780
3032 UFVG01000001.1 GCA900446595_01684 gene open 1424936-1425478
3033 UFVG01000001.1 GCA900446595_01685 gene open 1425543-1425854
3034 UFVG01000001.1 GCA900446595_01686 gene open 1426376-1427164
3035 UFVG01000001.1 GCA900446595_01687 gene open 1427181-1427426
3036 UFVG01000001.1 GCA900446595_01688 gene open 1427448-1428029
3037 UFVG01000001.1 GCA900446595_01689 gene open 1428166-1430019
3038 UFVG01000001.1 GCA900446595_01690 gene open 1430150-1431826
3039 UFVG01000001.1 GCA900446595_01691 gene open 1431828-1432508
3040 UFVG01000001.1 GCA900446595_01692 gene open 1432577-1434856 phsA
3041 UFVG01000001.1 GCA900446595_01693 gene open 1434867-1435433
3042 UFVG01000001.1 GCA900446595_01694 gene open 1435426-1436397 nrfD
3043 UFVG01000001.1 GCA900446595_01695 gene open 1436369-1437058
3044 UFVG01000001.1 GCA900446595_01696 gene open 1437051-1438181
3045 UFVG01000001.1 GCA900446595_01697 gene open 1438183-1439037
3046 UFVG01000001.1 GCA900446595_01698 gene open 1439021-1439401
3047 UFVG01000001.1 GCA900446595_01699 gene open 1439553-1442393
3048 UFVG01000001.1 GCA900446595_01700 gene open 1442581-1443372 rpsB
3049 UFVG01000001.1 GCA900446595_01701 gene open 1443372-1444430 tsf
3050 UFVG01000001.1 GCA900446595_01702 gene open 1444433-1445077 lolD
3051 UFVG01000001.1 GCA900446595_01703 gene open 1445068-1445841 fliR
3052 UFVG01000001.1 GCA900446595_01704 gene open 1445900-1447312
3053 UFVG01000001.1 GCA900446595_01705 gene open 1447315-1447926 gmk
3054 UFVG01000001.1 GCA900446595_01706 gene open 1447950-1448144 tatA
3055 UFVG01000001.1 GCA900446595_01707 gene open 1448163-1449758 argS
3056 UFVG01000001.1 GCA900446595_01708 gene open 1449830-1449997
3057 UFVG01000001.1 GCA900446595_01709 gene open 1450007-1450723 dsbB
3058 UFVG01000001.1 GCA900446595_01710 gene open 1450732-1451613 dsbB
3059 UFVG01000001.1 GCA900446595_01711 gene open 1451899-1452951
3060 UFVG01000001.1 GCA900446595_01712 gene open 1453049-1453366
3061 UFVG01000001.1 GCA900446595_01713 gene open 1453387-1453818
3062 UFVG01000001.1 GCA900446595_01714 gene open 1453820-1454053 ccoS
3063 UFVG01000001.1 GCA900446595_01715 gene open 1454050-1456443
3064 UFVG01000001.1 GCA900446595_01716 gene open 1456525-1457208
3065 UFVG01000001.1 GCA900446595_01717 gene open 1457205-1458413
3066 UFVG01000001.1 GCA900446595_01718 gene open 1458413-1459423 gap
3067 UFVG01000001.1 GCA900446595_01719 gene open 1459485-1460024 nadD
3068 UFVG01000001.1 GCA900446595_01720 gene open 1460021-1460356 rsfS
3069 UFVG01000001.1 GCA900446595_01721 gene open 1460353-1461885 ubiB
3070 UFVG01000001.1 GCA900446595_01722 gene open 1461869-1462144
3071 UFVG01000001.1 GCA900446595_01723 gene open 1462392-1465163
3072 UFVG01000001.1 GCA900446595_01724 gene open 1465415-1466875
3073 UFVG01000001.1 GCA900446595_01725 gene open 1466904-1467323 modE
3074 UFVG01000001.1 GCA900446595_01726 gene open 1467419-1468288
3075 UFVG01000001.1 GCA900446595_01727 gene open 1468211-1469467
3076 UFVG01000001.1 GCA900446595_01728 gene open 1469470-1470873
3077 UFVG01000001.1 GCA900446595_01729 gene open 1470863-1471927 ispG
3078 UFVG01000001.1 GCA900446595_01730 gene open 1472174-1472647
3079 UFVG01000001.1 GCA900446595_01731 gene open 1472647-1473312 copR
3080 UFVG01000001.1 GCA900446595_01732 gene open 1473302-1474471
3081 UFVG01000001.1 GCA900446595_01733 gene open 1474538-1474732 rpmI
3082 UFVG01000001.1 GCA900446595_01734 gene open 1474816-1475169 rplT
3083 UFVG01000001.1 GCA900446595_01735 gene open 1475324-1478110 napA
3084 UFVG01000001.1 GCA900446595_01736 gene open 1478113-1478865 napG
3085 UFVG01000001.1 GCA900446595_01737 gene open 1478862-1479653 napH
3086 UFVG01000001.1 GCA900446595_01738 gene open 1479654-1480166
3087 UFVG01000001.1 GCA900446595_01739 gene open 1480170-1480616
3088 UFVG01000001.1 GCA900446595_01740 gene open 1480616-1481545
3089 UFVG01000001.1 GCA900446595_01741 gene open 1481542-1481868 napD
3090 UFVG01000001.1 GCA900446595_01743 gene open 1482100-1483239 pilZ
3091 UFVG01000001.1 GCA900446595_01744 gene open 1483317-1484114 cheR
3092 UFVG01000001.1 GCA900446595_01745 gene open 1484107-1484688
3093 UFVG01000001.1 GCA900446595_01746 gene open 1484782-1485045 flhB
3094 UFVG01000001.1 GCA900446595_01747 gene open 1485046-1487052 fliK
3095 UFVG01000001.1 GCA900446595_01748 gene open 1487071-1487511
3096 UFVG01000001.1 GCA900446595_01749 gene open 1487501-1487779 argJ
3097 UFVG01000001.1 GCA900446595_01750 gene open 1487782-1489059 hemL
3098 UFVG01000001.1 GCA900446595_01751 gene open 1489049-1489432
3099 UFVG01000001.1 GCA900446595_01752 gene open 1489514-1490368 folD
3100 UFVG01000001.1 GCA900446595_01753 gene open 1490370-1491215 lepB
3101 UFVG01000001.1 GCA900446595_01754 gene open 1491249-1492301
3102 UFVG01000001.1 GCA900446595_01755 gene open 1492315-1492791
3103 UFVG01000001.1 GCA900446595_01756 gene open 1492806-1493540
3104 UFVG01000001.1 GCA900446595_01757 gene open 1493530-1495332 recG
3105 UFVG01000001.1 GCA900446595_01758 gene open 1495346-1497385
3106 UFVG01000001.1 GCA900446595_01759 gene open 1497445-1498548
3107 UFVG01000001.1 GCA900446595_01760 gene open 1498551-1499156
3108 UFVG01000001.1 GCA900446595_01761 gene open 1499211-1500443
3109 UFVG01000001.1 GCA900446595_01762 gene open 1500515-1501309 hypB
3110 UFVG01000001.1 GCA900446595_01763 gene open 1501309-1501590
3111 UFVG01000001.1 GCA900446595_01764 gene open 1501600-1502688 hypD
3112 UFVG01000001.1 GCA900446595_01765 gene open 1502690-1503682 hypE
3113 UFVG01000001.1 GCA900446595_01766 gene open 1503682-1504023 hypA
3114 UFVG01000001.1 GCA900446595_01767 gene open 1504086-1504805
3115 UFVG01000001.1 GCA900446595_01768 gene open 1504809-1505300
3116 UFVG01000001.1 GCA900446595_01769 gene open 1505357-1506454
3117 UFVG01000001.1 GCA900446595_01770 gene open 1506444-1507097 bioG
3118 UFVG01000001.1 GCA900446595_01771 gene open 1507087-1507779
3119 UFVG01000001.1 GCA900446595_01773 gene open 1508259-1509527
3120 UFVG01000001.1 GCA900446595_01774 gene open 1509564-1509869
3121 UFVG01000001.1 GCA900446595_01775 gene open 1509922-1510938 mnmA
3122 UFVG01000001.1 GCA900446595_01776 gene open 1510987-1511586
3123 UFVG01000001.1 GCA900446595_01777 gene open 1511583-1512425 fliY
3124 UFVG01000001.1 GCA900446595_01778 gene open 1512422-1513531 fliM
3125 UFVG01000001.1 GCA900446595_01779 gene open 1513532-1514239
3126 UFVG01000001.1 GCA900446595_01780 gene open 1514208-1514567
3127 UFVG01000001.1 GCA900446595_01781 gene open 1514584-1515450
3128 UFVG01000001.1 GCA900446595_01782 gene open 1515431-1516747 flhF
3129 UFVG01000001.1 GCA900446595_01783 gene open 1516759-1517259 folK
3130 UFVG01000001.1 GCA900446595_01784 gene open 1517240-1518262
3131 UFVG01000001.1 GCA900446595_01785 gene open 1518252-1518731 aroQ
3132 UFVG01000001.1 GCA900446595_01786 gene open 1518886-1519440
3133 UFVG01000001.1 GCA900446595_01787 gene open 1519437-1519631
3134 UFVG01000001.1 GCA900446595_01788 gene open 1519633-1521798
3135 UFVG01000001.1 GCA900446595_01789 gene open 1521807-1522979
3136 UFVG01000001.1 GCA900446595_01790 gene open 1523043-1523585
3137 UFVG01000001.1 GCA900446595_01791 gene open 1523587-1524408 lgt
3138 UFVG01000001.1 GCA900446595_01792 gene open 1524418-1525611
3139 UFVG01000001.1 GCA900446595_01793 gene open 1525785-1526501
3140 UFVG01000001.1 GCA900446595_01794 gene open 1526517-1528505
3141 UFVG01000001.1 GCA900446595_01795 gene open 1528498-1529217
3142 UFVG01000001.1 GCA900446595_01796 gene open 1529307-1531397
3143 UFVG01000001.1 GCA900446595_01797 gene open 1531391-1533193
3144 UFVG01000001.1 GCA900446595_01798 gene open 1533289-1536741
3145 UFVG01000001.1 GCA900446595_01799 gene open 1536769-1538517 putP
3146 UFVG01000001.1 GCA900446595_01800 gene open 1538510-1539283
3147 UFVG01000001.1 GCA900446595_01801 gene open 1539280-1539936
3148 UFVG01000001.1 GCA900446595_01802 gene open 1539936-1540802
3149 UFVG01000001.1 GCA900446595_01803 gene open 1540826-1541047
3150 UFVG01000001.1 GCA900446595_01804 gene open 1541241-1543082 htpG
3151 UFVG01000001.1 GCA900446595_01805 gene open 1543136-1543855
3152 UFVG01000001.1 GCA900446595_01806 gene open 1543962-1545008
3153 UFVG01000001.1 GCA900446595_01807 gene open 1545088-1545768 phoP
3154 UFVG01000001.1 GCA900446595_01808 gene open 1545765-1547006 arsS
3155 UFVG01000001.1 GCA900446595_01809 gene open 1547017-1549044
3156 UFVG01000001.1 GCA900446595_01810 gene open 1549031-1549636 dedA
3157 UFVG01000001.1 GCA900446595_01811 gene open 1549649-1550764 dnaJ
3158 UFVG01000001.1 GCA900446595_01812 gene open 1550898-1551569 baeR
3159 UFVG01000001.1 GCA900446595_01813 gene open 1551566-1552819 arsS
3160 UFVG01000001.1 GCA900446595_01814 gene open 1552803-1553375 recR
3161 UFVG01000001.1 GCA900446595_01815 gene open 1553540-1554811
3162 UFVG01000001.1 GCA900446595_01816 gene open 1554811-1555224
3163 UFVG01000001.1 GCA900446595_01817 gene open 1555236-1556144 cysK
3164 UFVG01000001.1 GCA900446595_01818 gene open 1556234-1557676
3165 UFVG01000001.1 GCA900446595_01819 gene open 1557663-1558217
3166 UFVG01000001.1 GCA900446595_01820 gene open 1558372-1560186 glmS
3167 UFVG01000001.1 GCA900446595_01821 gene open 1560317-1561393 mqnE
3168 UFVG01000001.1 GCA900446595_01822 gene open 1561409-1562695
3169 UFVG01000001.1 GCA900446595_01823 gene open 1562706-1563146
3170 UFVG01000001.1 GCA900446595_01824 gene open 1563154-1564389
3171 UFVG01000001.1 GCA900446595_01825 gene open 1564428-1565120
3172 UFVG01000001.1 GCA900446595_00218 gene open 15391-15466 trnV
3173 UFVG01000001.1 GCA900446595_00219 gene open 15483-15559 trnD
3174 UFVG01000001.1 GCA900446595_00220 gene open 15566-15638 trnK
3175 UFVG01000001.1 GCA900446595_00221 gene open 15642-15716 trnE
3176 UFVG01000001.1 GCA900446595_00254 gene open 43449-43525 trnM
3177 UFVG01000001.1 GCA900446595_00439 gene open 213587-213661 trnQ
3178 UFVG01000001.1 GCA900446595_00440 gene open 213690-213764 trnfM
3179 UFVG01000001.1 GCA900446595_00490 gene open 255221-255298 trnP
3180 UFVG01000001.1 GCA900446595_00491 gene open 255306-255381 trnH
3181 UFVG01000001.1 GCA900446595_00492 gene open 255391-255467 trnR
3182 UFVG01000001.1 GCA900446595_00493 gene open 255481-255557 trnR
3183 UFVG01000001.1 GCA900446595_00494 gene open 255568-255652 trnL
3184 UFVG01000001.1 GCA900446595_00536 gene open 295536-295612 trnR
3185 UFVG01000001.1 GCA900446595_00557 gene open 312876-312950 trnE
3186 UFVG01000001.1 GCA900446595_00597 gene open 353580-353653 trnQ
3187 UFVG01000001.1 GCA900446595_00625 gene open 379392-379467 trnF
3188 UFVG01000001.1 GCA900446595_00669 gene open 421851-421924 trnR
3189 UFVG01000001.1 GCA900446595_00791 gene open 539011-539087 trnI
3190 UFVG01000001.1 GCA900446595_00833 gene open 582094-582169 trnA
3191 UFVG01000001.1 GCA900446595_00834 gene open 582210-582286 trnI
3192 UFVG01000001.1 GCA900446595_00956 gene open 705545-705621 trnI
3193 UFVG01000001.1 GCA900446595_00957 gene open 705662-705737 trnA
3194 UFVG01000001.1 GCA900446595_01064 gene open 814246-814320 trnG
3195 UFVG01000001.1 GCA900446595_01065 gene open 814348-814435 trnL
3196 UFVG01000001.1 GCA900446595_01066 gene open 814454-814527 trnC
3197 UFVG01000001.1 GCA900446595_01068 gene open 814718-814805 trnS
3198 UFVG01000001.1 GCA900446595_01185 gene open 924984-925071 trnS
3199 UFVG01000001.1 GCA900446595_01287 gene open 1026698-1026773 trnA
3200 UFVG01000001.1 GCA900446595_01345 gene open 1081138-1081235 trnU
3201 UFVG01000001.1 GCA900446595_01483 gene open 1222447-1222521 trnN
3202 UFVG01000001.1 GCA900446595_01574 gene open 1309701-1309791 trnS
3203 UFVG01000001.1 GCA900446595_01613 gene open 1354088-1354163 trnV
3204 UFVG01000001.1 GCA900446595_01667 gene open 1410186-1410261 trnT
3205 UFVG01000001.1 GCA900446595_01668 gene open 1410307-1410391 trnY
3206 UFVG01000001.1 GCA900446595_01669 gene open 1410401-1410477 trnG
3207 UFVG01000001.1 GCA900446595_01670 gene open 1410597-1410671 trnT
3208 UFVG01000001.1 GCA900446595_01673 gene open 1412172-1412247 trnW
3209 UFVG01000001.1 GCA900446595_01742 gene open 1481946-1482022 trnI
3210 UFVG01000001.1 GCA900446595_01827 gene open 1567750-1567825 trnA
3211 UFVG01000001.1 GCA900446595_01828 gene open 1567866-1567942 trnI
3212 UFVG01000001.1 GCA900446595_00218 tRNA open 15391-15466 trnV tRNA-Val(tac)
3213 UFVG01000001.1 GCA900446595_00219 tRNA open 15483-15559 trnD tRNA-Asp(gtc)
3214 UFVG01000001.1 GCA900446595_00220 tRNA open 15566-15638 trnK tRNA-Lys(ctt)
3215 UFVG01000001.1 GCA900446595_00221 tRNA open 15642-15716 trnE tRNA-Glu(ctc)
3216 UFVG01000001.1 GCA900446595_00254 tRNA open 43449-43525 trnM tRNA-Met(cat)
3217 UFVG01000001.1 GCA900446595_00439 tRNA open 213587-213661 trnQ tRNA-Gln(ttg)
3218 UFVG01000001.1 GCA900446595_00440 tRNA open 213690-213764 trnfM tRNA-fMet(cat)
3219 UFVG01000001.1 GCA900446595_00490 tRNA open 255221-255298 trnP tRNA-Pro(tgg)
3220 UFVG01000001.1 GCA900446595_00491 tRNA open 255306-255381 trnH tRNA-His(gtg)
3221 UFVG01000001.1 GCA900446595_00492 tRNA open 255391-255467 trnR tRNA-Arg(tcg)
3222 UFVG01000001.1 GCA900446595_00493 tRNA open 255481-255557 trnR tRNA-Arg(tct)
3223 UFVG01000001.1 GCA900446595_00494 tRNA open 255568-255652 trnL tRNA-Leu(tag)
3224 UFVG01000001.1 GCA900446595_00536 tRNA open 295536-295612 trnR tRNA-Arg(gcg)
3225 UFVG01000001.1 GCA900446595_00557 tRNA open 312876-312950 trnE tRNA-Glu(ttc)
3226 UFVG01000001.1 GCA900446595_00597 tRNA open 353580-353653 trnQ tRNA-Gln(ctg)
3227 UFVG01000001.1 GCA900446595_00625 tRNA open 379392-379467 trnF tRNA-Phe(gaa)
3228 UFVG01000001.1 GCA900446595_00669 tRNA open 421851-421924 trnR tRNA-Arg(cct)
3229 UFVG01000001.1 GCA900446595_00791 tRNA open 539011-539087 trnI tRNA-Ile2(cat)
3230 UFVG01000001.1 GCA900446595_00833 tRNA open 582094-582169 trnA tRNA-Ala(tgc)
3231 UFVG01000001.1 GCA900446595_00834 tRNA open 582210-582286 trnI tRNA-Ile(gat)
3232 UFVG01000001.1 GCA900446595_00956 tRNA open 705545-705621 trnI tRNA-Ile(gat)
3233 UFVG01000001.1 GCA900446595_00957 tRNA open 705662-705737 trnA tRNA-Ala(tgc)
3234 UFVG01000001.1 GCA900446595_01064 tRNA open 814246-814320 trnG tRNA-Gly(gcc)
3235 UFVG01000001.1 GCA900446595_01065 tRNA open 814348-814435 trnL tRNA-Leu(taa)
3236 UFVG01000001.1 GCA900446595_01066 tRNA open 814454-814527 trnC tRNA-Cys(gca)
3237 UFVG01000001.1 GCA900446595_01068 tRNA open 814718-814805 trnS tRNA-Ser(tga)
3238 UFVG01000001.1 GCA900446595_01185 tRNA open 924984-925071 trnS tRNA-Ser(gga)
3239 UFVG01000001.1 GCA900446595_01287 tRNA open 1026698-1026773 trnA tRNA-Ala(ggc)
3240 UFVG01000001.1 GCA900446595_01345 tRNA open 1081138-1081235 trnU tRNA-SeC(tca)
3241 UFVG01000001.1 GCA900446595_01483 tRNA open 1222447-1222521 trnN tRNA-Asn(gtt)
3242 UFVG01000001.1 GCA900446595_01574 tRNA open 1309701-1309791 trnS tRNA-Ser(gct)
3243 UFVG01000001.1 GCA900446595_01613 tRNA open 1354088-1354163 trnV tRNA-Val(gac)
3244 UFVG01000001.1 GCA900446595_01667 tRNA open 1410186-1410261 trnT tRNA-Thr(tgt)
3245 UFVG01000001.1 GCA900446595_01668 tRNA open 1410307-1410391 trnY tRNA-Tyr(gta)
3246 UFVG01000001.1 GCA900446595_01669 tRNA open 1410401-1410477 trnG tRNA-Gly(tcc)
3247 UFVG01000001.1 GCA900446595_01670 tRNA open 1410597-1410671 trnT tRNA-Thr(ggt)
3248 UFVG01000001.1 GCA900446595_01673 tRNA open 1412172-1412247 trnW tRNA-Trp(cca)
3249 UFVG01000001.1 GCA900446595_01742 tRNA open 1481946-1482022 trnI tRNA-Ile2(cat)
3250 UFVG01000001.1 GCA900446595_01827 tRNA open 1567750-1567825 trnA tRNA-Ala(tgc)
3251 UFVG01000001.1 GCA900446595_01828 tRNA open 1567866-1567942 trnI tRNA-Ile(gat)
3252 UFVG01000002.1 GCA900446595_00096 gene open 97204-97564 ssrA
3253 UFVG01000002.1 GCA900446595_00096 tmRNA open 97204-97564 ssrA transfer-messenger RNA%2C SsrA
3254 UFVG01000002.1 GCA900446595_00001 gene open 1-2496 rrl
3255 UFVG01000002.1 GCA900446595_00204 gene open 194256-194373 rrf
3256 UFVG01000002.1 GCA900446595_00205 gene open 194961-196246 rrl
3257 UFVG01000002.1 GCA900446595_00001 rRNA open 1-2496 rrl 23S ribosomal RNA
3258 UFVG01000002.1 GCA900446595_00204 rRNA open 194256-194373 rrf 5S ribosomal RNA
3259 UFVG01000002.1 GCA900446595_00205 rRNA open 194961-196246 rrl 23S ribosomal RNA
3260 UFVG01000002.1 repeat_region open 11685-14277 CRISPR array with 40 repeats of length 30%2C consensus sequence GTTAAAATTTGATCCTATGGATTTTGAAAC and spacer length 35
3261 UFVG01000002.1 GCA900446595_00002 CDS open 3253-3924 _na     223_aa putative protein putative to be involved in DNA repair (RAMP superfamily)
3262 UFVG01000002.1 GCA900446595_00003 CDS open 4097-5860 _na     587_aa CRISPR-associated protein TM1802 (Cas_TM1802)
3263 UFVG01000002.1 GCA900446595_00004 CDS open 5853-6788 _na     311_aa cas7b type I-B CRISPR-associated protein Cas7/Csh2
3264 UFVG01000002.1 GCA900446595_00005 CDS open 6772-7476 _na     234_aa CRISPR-associated protein Cas5
3265 UFVG01000002.1 GCA900446595_00006 CDS open 7418-9655 _na     745_aa CRISPR-associated helicase Cas3 domain-containing protein
3266 UFVG01000002.1 GCA900446595_00007 CDS open 9652-10149 _na     165_aa cas4 CRISPR-associated protein Cas4
3267 UFVG01000002.1 GCA900446595_00008 CDS open 10159-10437 _na     92_aa cas2 CRISPR-associated endonuclease Cas2
3268 UFVG01000002.1 GCA900446595_00009 CDS open 10447-11439 _na     330_aa cas1 CRISPR-associated endonuclease Cas1
3269 UFVG01000002.1 GCA900446595_00010 CDS open 14388-14669 _na     93_aa Peptidase S24
3270 UFVG01000002.1 GCA900446595_00011 CDS open 15145-15507 _na     120_aa hypothetical protein
3271 UFVG01000002.1 GCA900446595_00012 CDS open 16049-16255 _na     68_aa Dihydroorotase (DHOase)
3272 UFVG01000002.1 GCA900446595_00013 CDS open 16690-16959 _na     89_aa hypothetical protein
3273 UFVG01000002.1 GCA900446595_00014 CDS open 16947-17150 _na     67_aa hypothetical protein
3274 UFVG01000002.1 GCA900446595_00015 CDS open 17132-17974 _na     280_aa IS110 family transposase
3275 UFVG01000002.1 GCA900446595_00016 CDS open 18389-18760 _na     123_aa Nucleotidyltransferase family protein
3276 UFVG01000002.1 GCA900446595_00017 CDS open 18936-19574 _na     212_aa hypothetical protein
3277 UFVG01000002.1 GCA900446595_00018 CDS open 19624-20346 _na     240_aa truA tRNA pseudouridine(38-40) synthase TruA
3278 UFVG01000002.1 GCA900446595_00019 CDS open 20351-21382 _na     343_aa YjgP/YjgQ permease
3279 UFVG01000002.1 GCA900446595_00020 CDS open 21395-22213 _na     272_aa Peptidase A24 N- domain-containing protein
3280 UFVG01000002.1 GCA900446595_00021 CDS open 22213-22890 _na     225_aa uppS polyprenyl diphosphate synthase
3281 UFVG01000002.1 GCA900446595_00022 CDS open 22896-23531 _na     211_aa hypothetical protein
3282 UFVG01000002.1 GCA900446595_00023 CDS open 23528-24703 _na     391_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
3283 UFVG01000002.1 GCA900446595_00024 CDS open 24690-25997 _na     435_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
3284 UFVG01000002.1 GCA900446595_00025 CDS open 26159-27973 _na     604_aa Biotin/lipoyl attachment
3285 UFVG01000002.1 GCA900446595_00026 CDS open 27989-29566 _na     525_aa pckA phosphoenolpyruvate carboxykinase (ATP)
3286 UFVG01000002.1 GCA900446595_00027 CDS open 29941-32202 _na     753_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
3287 UFVG01000002.1 GCA900446595_00028 CDS open 32204-33046 _na     280_aa metF methylenetetrahydrofolate reductase [NAD(P)H]
3288 UFVG01000002.1 GCA900446595_00029 CDS open 33112-34545 _na     477_aa dcuD Putative cryptic C4-dicarboxylate transporter DcuD
3289 UFVG01000002.1 GCA900446595_00030 CDS open 34721-35593 _na     290_aa Protein translation intiation inhibitor
3290 UFVG01000002.1 GCA900446595_00031 CDS open 35603-35986 _na     127_aa hspR heat shock protein transcriptional repressor HspR
3291 UFVG01000002.1 GCA900446595_00032 CDS open 36002-37459 _na     485_aa potassium/proton antiporter
3292 UFVG01000002.1 GCA900446595_00033 CDS open 37524-38087 _na     187_aa beta-lactamase
3293 UFVG01000002.1 GCA900446595_00034 CDS open 38089-38418 _na     109_aa hypothetical protein
3294 UFVG01000002.1 GCA900446595_00035 CDS open 38402-39037 _na     211_aa Periplasmic protein
3295 UFVG01000002.1 GCA900446595_00036 CDS open 39124-39384 _na     86_aa DUF2018 domain-containing protein
3296 UFVG01000002.1 GCA900446595_00037 CDS open 39387-39839 _na     150_aa Exporting protein
3297 UFVG01000002.1 GCA900446595_00038 CDS open 39842-40735 _na     297_aa Bifunctional short chain isoprenyl diphosphate synthase
3298 UFVG01000002.1 GCA900446595_00039 CDS open 40735-42042 _na     435_aa hemA glutamyl-tRNA reductase
3299 UFVG01000002.1 GCA900446595_00040 CDS open 42032-43744 _na     570_aa proline--tRNA ligase
3300 UFVG01000002.1 GCA900446595_00041 CDS open 43729-44106 _na     125_aa 2-isopropylmalate synthase
3301 UFVG01000002.1 GCA900446595_00042 CDS open 44103-45056 _na     317_aa hemC hydroxymethylbilane synthase
3302 UFVG01000002.1 GCA900446595_00043 CDS open 45111-46262 _na     383_aa Iron-containing alcohol dehydrogenase
3303 UFVG01000002.1 GCA900446595_00044 CDS open 46303-46596 _na     97_aa Redox-active disulfide protein 2
3304 UFVG01000002.1 GCA900446595_00045 CDS open 46608-47603 _na     331_aa Permease
3305 UFVG01000002.1 GCA900446595_00046 CDS open 47669-47944 _na     91_aa Cadmium efflux system accessory protein
3306 UFVG01000002.1 GCA900446595_00047 CDS open 47999-51019 _na     1006_aa RND pump protein
3307 UFVG01000002.1 GCA900446595_00048 CDS open 51022-51789 _na     255_aa Membrane fusion component of efflux system
3308 UFVG01000002.1 GCA900446595_00049 CDS open 51773-52996 _na     407_aa putative outer membrane component of multidrug efflux pump
3309 UFVG01000002.1 GCA900446595_00050 CDS open 53305-53985 _na     226_aa Carboxylate/amino acid/amine transporter
3310 UFVG01000002.1 GCA900446595_00051 CDS open 53902-54633 _na     243_aa fliP flagellar type III secretion system pore protein FliP
3311 UFVG01000002.1 GCA900446595_00052 CDS open 54753-55157 _na     134_aa Nucleotidyl-binding protein
3312 UFVG01000002.1 GCA900446595_00053 CDS open 55154-55819 _na     221_aa 3-methyladenine DNA glycosylase
3313 UFVG01000002.1 GCA900446595_00054 CDS open 55809-56615 _na     268_aa Metallophosphoesterase
3314 UFVG01000002.1 GCA900446595_00055 CDS open 56625-57401 _na     258_aa ABC transporter ATPase
3315 UFVG01000002.1 GCA900446595_00056 CDS open 57398-60358 _na     986_aa mfd transcription-repair coupling factor
3316 UFVG01000002.1 GCA900446595_00057 CDS open 60383-60784 _na     133_aa DUF583 domain-containing protein
3317 UFVG01000002.1 GCA900446595_00058 CDS open 60733-61623 _na     296_aa M24/M37 family peptidase
3318 UFVG01000002.1 GCA900446595_00059 CDS open 61613-62764 _na     383_aa Folylpolyglutamate synthase
3319 UFVG01000002.1 GCA900446595_00060 CDS open 62751-64313 _na     520_aa Diguanylate cyclase
3320 UFVG01000002.1 GCA900446595_00061 CDS open 64303-64836 _na     177_aa Penicillin-binding protein
3321 UFVG01000002.1 GCA900446595_00062 CDS open 64846-67302 _na     818_aa leuS leucine--tRNA ligase
3322 UFVG01000002.1 GCA900446595_00063 CDS open 67311-67649 _na     112_aa macA MacA
3323 UFVG01000002.1 GCA900446595_00064 CDS open 67659-68630 _na     323_aa secF Protein-export membrane protein SecF
3324 UFVG01000002.1 GCA900446595_00065 CDS open 68617-70281 _na     554_aa secD Protein translocase subunit SecD
3325 UFVG01000002.1 GCA900446595_00066 CDS open 70274-70501 _na     75_aa yajC preprotein translocase subunit YajC
3326 UFVG01000002.1 GCA900446595_00067 CDS open 70516-71823 _na     435_aa apolipoprotein N-acyltransferase
3327 UFVG01000002.1 GCA900446595_00068 CDS open 71820-72377 _na     185_aa Fe-S-containing hydro-lyase
3328 UFVG01000002.1 GCA900446595_00069 CDS open 72388-73233 _na     281_aa fumarate hydratase
3329 UFVG01000002.1 GCA900446595_00070 CDS open 73291-74673 _na     460_aa dcuB C4-dicarboxylate transporter DcuB
3330 UFVG01000002.1 GCA900446595_00071 CDS open 74910-75713 _na     267_aa LarA-like N-terminal domain-containing protein
3331 UFVG01000002.1 GCA900446595_00072 CDS open 75680-76159 _na     159_aa hypothetical protein
3332 UFVG01000002.1 GCA900446595_00073 CDS open 76156-77328 _na     390_aa larC nickel pincer cofactor biosynthesis protein LarC
3333 UFVG01000002.1 GCA900446595_00074 CDS open 77300-78082 _na     260_aa larE ATP-dependent sacrificial sulfur transferase LarE
3334 UFVG01000002.1 GCA900446595_00075 CDS open 78079-78819 _na     246_aa larB nickel pincer cofactor biosynthesis protein LarB
3335 UFVG01000002.1 GCA900446595_00076 CDS open 78914-79570 _na     218_aa Glycosyltransferase
3336 UFVG01000002.1 GCA900446595_00077 CDS open 79635-80624 _na     329_aa Anthranilate synthase component II
3337 UFVG01000002.1 GCA900446595_00078 CDS open 80767-81429 _na     220_aa Citrate transporter
3338 UFVG01000002.1 GCA900446595_00079 CDS open 81477-82037 _na     186_aa Citrate transporter
3339 UFVG01000002.1 GCA900446595_00080 CDS open 82515-83636 _na     373_aa ftsZ cell division protein FtsZ
3340 UFVG01000002.1 GCA900446595_00081 CDS open 83650-85122 _na     490_aa ftsA cell division protein FtsA
3341 UFVG01000002.1 GCA900446595_00082 CDS open 85129-86583 _na     484_aa Putative peptidyl-prolyl cis-trans isomerase D-like protein
3342 UFVG01000002.1 GCA900446595_00083 CDS open 86715-87284 _na     189_aa Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases
3343 UFVG01000002.1 GCA900446595_00084 CDS open 87351-88298 _na     315_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
3344 UFVG01000002.1 GCA900446595_00085 CDS open 88282-88587 _na     101_aa Membrane protein
3345 UFVG01000002.1 GCA900446595_00086 CDS open 88590-89081 _na     163_aa Membrane protein
3346 UFVG01000002.1 GCA900446595_00087 CDS open 89192-90058 _na     288_aa D-alanine aminotransferase
3347 UFVG01000002.1 GCA900446595_00088 CDS open 91498-91800 _na     100_aa F0F1 ATP synthase subunit C
3348 UFVG01000002.1 GCA900446595_00090 CDS open 91928-92971 _na     347_aa Acid membrane antigen A
3349 UFVG01000002.1 GCA900446595_00091 CDS open 92955-93968 _na     337_aa ruvB Holliday junction branch migration DNA helicase RuvB
3350 UFVG01000002.1 GCA900446595_00092 CDS open 93956-94651 _na     231_aa beta-lactamase
3351 UFVG01000002.1 GCA900446595_00093 CDS open 94662-95456 _na     264_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
3352 UFVG01000002.1 GCA900446595_00094 CDS open 95524-96597 _na     357_aa Integral membrane protein
3353 UFVG01000002.1 GCA900446595_00095 CDS open 96764-97171 _na     135_aa Hpt domain-containing protein
3354 UFVG01000002.1 GCA900446595_00102 CDS open 98759-99964 _na     401_aa Diguanylate cyclase
3355 UFVG01000002.1 GCA900446595_00103 CDS open 100003-100761 _na     252_aa Flagellin
3356 UFVG01000002.1 GCA900446595_00104 CDS open 100812-102101 _na     429_aa Histidinol dehydrogenase
3357 UFVG01000002.1 GCA900446595_00105 CDS open 102128-102922 _na     264_aa 1-aminocyclopropane-1-carboxylate deaminase
3358 UFVG01000002.1 GCA900446595_00106 CDS open 102975-104003 _na     342_aa motB Chemotaxis protein MotB
3359 UFVG01000002.1 GCA900446595_00107 CDS open 104000-105337 _na     445_aa Membrane protein
3360 UFVG01000002.1 GCA900446595_00108 CDS open 105347-106411 _na     354_aa fbaA class II fructose-bisphosphate aldolase
3361 UFVG01000002.1 GCA900446595_00109 CDS open 106423-107235 _na     270_aa peptidylprolyl isomerase
3362 UFVG01000002.1 GCA900446595_00110 CDS open 107362-107991 _na     209_aa nth endonuclease III
3363 UFVG01000002.1 GCA900446595_00111 CDS open 108002-109279 _na     425_aa Aminoacyl-histidine dipeptidase
3364 UFVG01000002.1 GCA900446595_00112 CDS open 109318-110421 _na     367_aa ychF redox-regulated ATPase YchF
3365 UFVG01000002.1 GCA900446595_00113 CDS open 110421-111872 _na     483_aa leucyl aminopeptidase
3366 UFVG01000002.1 GCA900446595_00114 CDS open 111856-112467 _na     203_aa dedA DedA family protein
3367 UFVG01000002.1 GCA900446595_00115 CDS open 112470-113018 _na     182_aa adenine phosphoribosyltransferase
3368 UFVG01000002.1 GCA900446595_00116 CDS open 113029-113361 _na     110_aa Membrane protein
3369 UFVG01000002.1 GCA900446595_00117 CDS open 113364-113801 _na     145_aa rpiB ribose 5-phosphate isomerase B
3370 UFVG01000002.1 GCA900446595_00118 CDS open 113885-114310 _na     141_aa Surface antigen
3371 UFVG01000002.1 GCA900446595_00119 CDS open 114367-115485 _na     372_aa truD tRNA pseudouridine(13) synthase TruD
3372 UFVG01000002.1 GCA900446595_00120 CDS open 115463-116326 _na     287_aa thiamine-phosphate kinase
3373 UFVG01000002.1 GCA900446595_00121 CDS open 116378-117475 _na     365_aa Succinate dehydrogenase/fumarate reductase%2C Fe-S protein subunit
3374 UFVG01000002.1 GCA900446595_00122 CDS open 117508-118842 _na     444_aa hcp hydroxylamine reductase
3375 UFVG01000002.1 GCA900446595_00123 CDS open 118955-120763 _na     602_aa menaquinone biosynthesis decarboxylase
3376 UFVG01000002.1 GCA900446595_00124 CDS open 120867-122288 _na     473_aa Protease htpx
3377 UFVG01000002.1 GCA900446595_00125 CDS open 122375-122776 _na     133_aa Cache 3/Cache 2 fusion domain-containing protein
3378 UFVG01000002.1 GCA900446595_00126 CDS open 122884-125058 _na     724_aa ftsK DNA translocase FtsK
3379 UFVG01000002.1 GCA900446595_00127 CDS open 125098-127224 _na     708_aa flgL flagellar hook-associated protein FlgL
3380 UFVG01000002.1 GCA900446595_00128 CDS open 127353-127550 _na     65_aa hypothetical protein
3381 UFVG01000002.1 GCA900446595_00130 CDS open 128242-128739 _na     165_aa Lipoprotein
3382 UFVG01000002.1 GCA900446595_00131 CDS open 128876-129442 _na     188_aa Periplasmic protein
3383 UFVG01000002.1 GCA900446595_00132 CDS open 129459-129617 _na     52_aa Hydrolase in agr operon (ORF 5)
3384 UFVG01000002.1 GCA900446595_00133 CDS open 129629-130261 _na     210_aa nitrilase-related carbon-nitrogen hydrolase
3385 UFVG01000002.1 GCA900446595_00134 CDS open 130258-132186 _na     642_aa abc-f ribosomal protection-like ABC-F family protein
3386 UFVG01000002.1 GCA900446595_00135 CDS open 132307-132972 _na     221_aa copR Transcriptional activator protein CopR
3387 UFVG01000002.1 GCA900446595_00136 CDS open 132966-134303 _na     445_aa Sensory trasnduction histidine kinase
3388 UFVG01000002.1 GCA900446595_00137 CDS open 134340-135662 _na     440_aa Mate efflux family protein
3389 UFVG01000002.1 GCA900446595_00138 CDS open 135638-136273 _na     211_aa Zinc metalloprotease
3390 UFVG01000002.1 GCA900446595_00139 CDS open 136288-137757 _na     489_aa Putative phosphoglycerol transferase I (Phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase)
3391 UFVG01000002.1 GCA900446595_00140 CDS open 138006-138218 _na     70_aa hypothetical protein
3392 UFVG01000002.1 GCA900446595_00141 CDS open 138211-138366 _na     51_aa Putative RelE/StbE family addiction module toxin
3393 UFVG01000002.1 GCA900446595_00142 CDS open 138807-139367 _na     186_aa N-terminal methylation domain-containing protein
3394 UFVG01000002.1 GCA900446595_00143 CDS open 139521-140198 _na     225_aa Putative secreted protein
3395 UFVG01000002.1 GCA900446595_00144 CDS open 140318-140689 _na     123_aa fluC Fluoride-specific ion channel FluC
3396 UFVG01000002.1 GCA900446595_00145 CDS open 140686-141363 _na     225_aa 1-acyl-sn-glycerol-3-phosphate acyltransferase
3397 UFVG01000002.1 GCA900446595_00146 CDS open 141341-142636 _na     431_aa Periplasmic protein
3398 UFVG01000002.1 GCA900446595_00147 CDS open 142633-143298 _na     221_aa purQ phosphoribosylformylglycinamidine synthase subunit PurQ
3399 UFVG01000002.1 GCA900446595_00148 CDS open 143295-143531 _na     78_aa purS phosphoribosylformylglycinamidine synthase subunit PurS
3400 UFVG01000002.1 GCA900446595_00149 CDS open 143540-144259 _na     239_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
3401 UFVG01000002.1 GCA900446595_00150 CDS open 144276-145583 _na     435_aa Peptidoglycan associated lipoprotein
3402 UFVG01000002.1 GCA900446595_00151 CDS open 145776-148349 _na     857_aa clpB Chaperone protein ClpB
3403 UFVG01000002.1 GCA900446595_00152 CDS open 148354-149223 _na     289_aa Ppx/GppA family phosphatase
3404 UFVG01000002.1 GCA900446595_00153 CDS open 149278-151242 _na     654_aa bioA adenosylmethionine--8-amino-7-oxononanoate transaminase
3405 UFVG01000002.1 GCA900446595_00154 CDS open 151237-151851 _na     204_aa hisG ATP phosphoribosyltransferase
3406 UFVG01000002.1 GCA900446595_00155 CDS open 151851-152471 _na     206_aa type III pantothenate kinase
3407 UFVG01000002.1 GCA900446595_00156 CDS open 152458-152790 _na     110_aa TRAM-like protein
3408 UFVG01000002.1 GCA900446595_00157 CDS open 152796-153800 _na     334_aa pgbB Plasminogen-binding protein PgbB
3409 UFVG01000002.1 GCA900446595_00158 CDS open 153797-154357 _na     186_aa Tetratricopeptide repeat-like domain-containing protein
3410 UFVG01000002.1 GCA900446595_00159 CDS open 154478-154768 _na     96_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
3411 UFVG01000002.1 GCA900446595_00160 CDS open 154780-155865 _na     361_aa Putative type II/IV secretion system protein
3412 UFVG01000002.1 GCA900446595_00161 CDS open 155862-156455 _na     197_aa cvpA CvpA family protein
3413 UFVG01000002.1 GCA900446595_00162 CDS open 156455-156922 _na     155_aa Iron-regulated membrane protein
3414 UFVG01000002.1 GCA900446595_00163 CDS open 156919-158439 _na     506_aa lysS lysine--tRNA ligase
3415 UFVG01000002.1 GCA900446595_00164 CDS open 158439-159686 _na     415_aa Serine hydroxymethyltransferase
3416 UFVG01000002.1 GCA900446595_00165 CDS open 159686-160228 _na     180_aa ABC-type transporter involved in multi-copper enzyme maturation%2C permease
3417 UFVG01000002.1 GCA900446595_00166 CDS open 160241-161077 _na     278_aa ABC transporter ATP-binding protein
3418 UFVG01000002.1 GCA900446595_00167 CDS open 161077-161859 _na     260_aa shikimate dehydrogenase
3419 UFVG01000002.1 GCA900446595_00168 CDS open 161876-163258 _na     460_aa glcD Glycolate oxidase subunit GlcD
3420 UFVG01000002.1 GCA900446595_00169 CDS open 163261-163977 _na     238_aa pgbA Plasminogen-binding protein pgbA
3421 UFVG01000002.1 GCA900446595_00170 CDS open 164131-169149 _na     1672_aa Calx-beta domain-containing protein
3422 UFVG01000002.1 GCA900446595_00171 CDS open 169149-169871 _na     240_aa Prepilin-type N-terminal cleavage/methylation domain-containing protein
3423 UFVG01000002.1 GCA900446595_00172 CDS open 169875-170813 _na     312_aa Prepilin-type N- terminal cleavage/methylation domain-containing protein
3424 UFVG01000002.1 GCA900446595_00173 CDS open 170813-171328 _na     171_aa hypothetical protein
3425 UFVG01000002.1 GCA900446595_00174 CDS open 171383-171910 _na     175_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
3426 UFVG01000002.1 GCA900446595_00175 CDS open 171949-172878 _na     309_aa Ribose-phosphate pyrophosphokinase
3427 UFVG01000002.1 GCA900446595_00176 CDS open 172943-174442 _na     499_aa putP sodium/proline symporter PutP
3428 UFVG01000002.1 GCA900446595_00177 CDS open 174623-175330 _na     235_aa His/Glu/Gln/Arg/opine amino acid ABC transporter permease
3429 UFVG01000002.1 GCA900446595_00178 CDS open 175323-176051 _na     242_aa ABC transporter ATP-binding protein
3430 UFVG01000002.1 GCA900446595_00179 CDS open 176065-176793 _na     242_aa Arginine-binding periplasmic protein 1
3431 UFVG01000002.1 GCA900446595_00180 CDS open 176826-177440 _na     204_aa Thiamine-phosphate synthase
3432 UFVG01000002.1 GCA900446595_00181 CDS open 177431-178207 _na     258_aa undecaprenyl-diphosphate phosphatase
3433 UFVG01000002.1 GCA900446595_00182 CDS open 178202-178681 _na     159_aa hypothetical protein
3434 UFVG01000002.1 GCA900446595_00183 CDS open 178691-181753 _na     1020_aa CcmF/CcyK/CcsA family cytochrome c biogenesis protein
3435 UFVG01000002.1 GCA900446595_00184 CDS open 181949-182377 _na     142_aa Lipoprotein
3436 UFVG01000002.1 GCA900446595_00185 CDS open 182361-183023 _na     220_aa Hydrogenase-4 component G
3437 UFVG01000002.1 GCA900446595_00186 CDS open 183075-184295 _na     406_aa glucose-6-phosphate isomerase
3438 UFVG01000002.1 GCA900446595_00187 CDS open 184282-185112 _na     276_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
3439 UFVG01000002.1 GCA900446595_00188 CDS open 185239-185883 _na     214_aa Enolase (2-phosphoglycerate dehydratase 2-phospho-D-glycerate hydro-lyase)
3440 UFVG01000002.1 GCA900446595_00189 CDS open 185945-186142 _na     65_aa ClpX-type ZB domain-containing protein
3441 UFVG01000002.1 GCA900446595_00190 CDS open 186232-186954 _na     240_aa Putative integral membrane protein
3442 UFVG01000002.1 GCA900446595_00191 CDS open 186954-187631 _na     225_aa Deoxyuridine triphosphatase domain-containing protein
3443 UFVG01000002.1 GCA900446595_00192 CDS open 187709-188224 _na     171_aa Diacylglycerol kinase
3444 UFVG01000002.1 GCA900446595_00193 CDS open 188321-188728 _na     135_aa yhbP Protein YhbP
3445 UFVG01000002.1 GCA900446595_00194 CDS open 188771-188965 _na     64_aa Transcriptional regulator
3446 UFVG01000002.1 GCA900446595_00195 CDS open 189100-189558 _na     152_aa Lipoprotein
3447 UFVG01000002.1 GCA900446595_00196 CDS open 189570-190301 _na     243_aa DUF2971 domain-containing protein
3448 UFVG01000002.1 GCA900446595_00197 CDS open 190298-190576 _na     92_aa hypothetical protein
3449 UFVG01000002.1 GCA900446595_00198 CDS open 190579-190968 _na     129_aa hypothetical protein
3450 UFVG01000002.1 GCA900446595_00199 CDS open 190988-191221 _na     77_aa Transformation system protein
3451 UFVG01000002.1 GCA900446595_00200 CDS open 191247-191672 _na     141_aa DUF2628 domain-containing protein
3452 UFVG01000002.1 GCA900446595_00201 CDS open 191703-192038 _na     111_aa hypothetical protein
3453 UFVG01000002.1 GCA900446595_00202 CDS open 192047-192604 _na     185_aa hypothetical protein
3454 UFVG01000002.1 GCA900446595_00203 CDS open 192829-193113 _na     94_aa Competence protein ComEA
3455 UFVG01000002.1 GCA900446595_00002 gene open 3253-3924
3456 UFVG01000002.1 GCA900446595_00003 gene open 4097-5860
3457 UFVG01000002.1 GCA900446595_00004 gene open 5853-6788 cas7b
3458 UFVG01000002.1 GCA900446595_00005 gene open 6772-7476
3459 UFVG01000002.1 GCA900446595_00006 gene open 7418-9655
3460 UFVG01000002.1 GCA900446595_00007 gene open 9652-10149 cas4
3461 UFVG01000002.1 GCA900446595_00008 gene open 10159-10437 cas2
3462 UFVG01000002.1 GCA900446595_00009 gene open 10447-11439 cas1
3463 UFVG01000002.1 GCA900446595_00010 gene open 14388-14669
3464 UFVG01000002.1 GCA900446595_00011 gene open 15145-15507
3465 UFVG01000002.1 GCA900446595_00012 gene open 16049-16255
3466 UFVG01000002.1 GCA900446595_00013 gene open 16690-16959
3467 UFVG01000002.1 GCA900446595_00014 gene open 16947-17150
3468 UFVG01000002.1 GCA900446595_00015 gene open 17132-17974
3469 UFVG01000002.1 GCA900446595_00016 gene open 18389-18760
3470 UFVG01000002.1 GCA900446595_00017 gene open 18936-19574
3471 UFVG01000002.1 GCA900446595_00018 gene open 19624-20346 truA
3472 UFVG01000002.1 GCA900446595_00019 gene open 20351-21382
3473 UFVG01000002.1 GCA900446595_00020 gene open 21395-22213
3474 UFVG01000002.1 GCA900446595_00021 gene open 22213-22890 uppS
3475 UFVG01000002.1 GCA900446595_00022 gene open 22896-23531
3476 UFVG01000002.1 GCA900446595_00023 gene open 23528-24703 coaBC
3477 UFVG01000002.1 GCA900446595_00024 gene open 24690-25997 glmU
3478 UFVG01000002.1 GCA900446595_00025 gene open 26159-27973
3479 UFVG01000002.1 GCA900446595_00026 gene open 27989-29566 pckA
3480 UFVG01000002.1 GCA900446595_00027 gene open 29941-32202 metE
3481 UFVG01000002.1 GCA900446595_00028 gene open 32204-33046 metF
3482 UFVG01000002.1 GCA900446595_00029 gene open 33112-34545 dcuD
3483 UFVG01000002.1 GCA900446595_00030 gene open 34721-35593
3484 UFVG01000002.1 GCA900446595_00031 gene open 35603-35986 hspR
3485 UFVG01000002.1 GCA900446595_00032 gene open 36002-37459
3486 UFVG01000002.1 GCA900446595_00033 gene open 37524-38087
3487 UFVG01000002.1 GCA900446595_00034 gene open 38089-38418
3488 UFVG01000002.1 GCA900446595_00035 gene open 38402-39037
3489 UFVG01000002.1 GCA900446595_00036 gene open 39124-39384
3490 UFVG01000002.1 GCA900446595_00037 gene open 39387-39839
3491 UFVG01000002.1 GCA900446595_00038 gene open 39842-40735
3492 UFVG01000002.1 GCA900446595_00039 gene open 40735-42042 hemA
3493 UFVG01000002.1 GCA900446595_00040 gene open 42032-43744
3494 UFVG01000002.1 GCA900446595_00041 gene open 43729-44106
3495 UFVG01000002.1 GCA900446595_00042 gene open 44103-45056 hemC
3496 UFVG01000002.1 GCA900446595_00043 gene open 45111-46262
3497 UFVG01000002.1 GCA900446595_00044 gene open 46303-46596
3498 UFVG01000002.1 GCA900446595_00045 gene open 46608-47603
3499 UFVG01000002.1 GCA900446595_00046 gene open 47669-47944
3500 UFVG01000002.1 GCA900446595_00047 gene open 47999-51019