HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Peptoniphilus indolicus (GCA_900454665.1)

Select a Genome:
BAKTA Annotations for GCA_900454665.1
Genome Selected: Peptoniphilus indolicus
ContigsBases CDSrRNA tmRNAtRNA
4 2247968 2149 10 1 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4439 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4439 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 UGTH01000001.1 GCA900454665_00480 gene open 441421-441763 ssrA
2 UGTH01000001.1 GCA900454665_00480 tmRNA open 441421-441763 ssrA transfer-messenger RNA%2C SsrA
3 UGTH01000001.1 GCA900454665_00210 gene open 132483-132598 rrf
4 UGTH01000001.1 GCA900454665_00211 gene open 132621-135482 rrl
5 UGTH01000001.1 GCA900454665_00213 gene open 135798-137326 rrs
6 UGTH01000001.1 GCA900454665_00612 gene open 580869-581135 Bacteria_large_SRP
7 UGTH01000001.1 GCA900454665_00613 gene open 580921-581020 Bacteria_small_SRP
8 UGTH01000001.1 GCA900454665_00896 gene open 869536-869651 rrf
9 UGTH01000001.1 GCA900454665_00897 gene open 869674-872535 rrl
10 UGTH01000001.1 GCA900454665_00899 gene open 872877-874405 rrs
11 UGTH01000001.1 GCA900454665_00905 gene open 878556-878733 6S
12 UGTH01000001.1 GCA900454665_01158 gene open 1153590-1153705 rrf
13 UGTH01000001.1 GCA900454665_01159 gene open 1153792-1153907 rrf
14 UGTH01000001.1 GCA900454665_01160 gene open 1153930-1156791 rrl
15 UGTH01000001.1 GCA900454665_01161 gene open 1157045-1158573 rrs
16 UGTH01000001.1 GCA900454665_01844 gene open 1864330-1864664 RNaseP_bact_a
17 UGTH01000001.1 GCA900454665_01849 gene open 1869497-1869597 n00280
18 UGTH01000001.1 GCA900454665_00612 ncRNA open 580869-581135 Bacterial large signal recognition particle RNA
19 UGTH01000001.1 GCA900454665_00613 ncRNA open 580921-581020 Bacterial small signal recognition particle RNA
20 UGTH01000001.1 GCA900454665_00905 ncRNA open 878556-878733 6S / SsrS RNA
21 UGTH01000001.1 GCA900454665_01844 ncRNA open 1864330-1864664 Bacterial RNase P class A
22 UGTH01000001.1 GCA900454665_01849 ncRNA open 1869497-1869597 Clostridioides difficile sRNA included into helicase gene
23 UGTH01000001.1 regulatory_region open 110822-110883 GP20-b RNA
24 UGTH01000001.1 regulatory_region open 229774-229940 T-box leader
25 UGTH01000001.1 regulatory_region open 259917-260101 T-box leader
26 UGTH01000001.1 regulatory_region open 343865-344093 T-box leader
27 UGTH01000001.1 regulatory_region open 345413-345643 T-box leader
28 UGTH01000001.1 regulatory_region open 526788-526912 Ribosomal protein L10 leader
29 UGTH01000001.1 regulatory_region open 842261-842353 TPP riboswitch aptamer (THI element)
30 UGTH01000001.1 regulatory_region open 1040802-1041039 T-box leader
31 UGTH01000001.1 regulatory_region open 1185098-1185161 pemK RNA
32 UGTH01000001.1 regulatory_region open 1231659-1231723 pemK RNA
33 UGTH01000001.1 regulatory_region open 1493684-1493780 Purine riboswitch aptamer
34 UGTH01000001.1 regulatory_region open 1521418-1521595 T-box leader
35 UGTH01000001.1 regulatory_region open 1551776-1552013 T-box leader
36 UGTH01000001.1 regulatory_region open 1553184-1553394 T-box leader
37 UGTH01000001.1 regulatory_region open 1594752-1594890 Lysine riboswitch aptamer
38 UGTH01000001.1 regulatory_region open 1659560-1659667 Glycine riboswitch aptamer
39 UGTH01000001.1 regulatory_region open 1788862-1789098 T-box leader
40 UGTH01000001.1 regulatory_region open 1789148-1789382 T-box leader
41 UGTH01000001.1 regulatory_region open 1808033-1808148 FMN riboswitch aptamer (RFN element)
42 UGTH01000001.1 regulatory_region open 1882844-1882891 uup RNA
43 UGTH01000001.1 regulatory_region open 2054909-2055052 glmS glucosamine-6-phosphate activated ribozyme aptamer
44 UGTH01000001.1 regulatory_region open 2132323-2132388 pemK RNA
45 UGTH01000001.1 regulatory_region open 2180652-2180772 FMN riboswitch aptamer (RFN element)
46 UGTH01000001.1 GCA900454665_00210 rRNA open 132483-132598 rrf 5S ribosomal RNA
47 UGTH01000001.1 GCA900454665_00211 rRNA open 132621-135482 rrl 23S ribosomal RNA
48 UGTH01000001.1 GCA900454665_00213 rRNA open 135798-137326 rrs 16S ribosomal RNA
49 UGTH01000001.1 GCA900454665_00896 rRNA open 869536-869651 rrf 5S ribosomal RNA
50 UGTH01000001.1 GCA900454665_00897 rRNA open 869674-872535 rrl 23S ribosomal RNA
51 UGTH01000001.1 GCA900454665_00899 rRNA open 872877-874405 rrs 16S ribosomal RNA
52 UGTH01000001.1 GCA900454665_01158 rRNA open 1153590-1153705 rrf 5S ribosomal RNA
53 UGTH01000001.1 GCA900454665_01159 rRNA open 1153792-1153907 rrf 5S ribosomal RNA
54 UGTH01000001.1 GCA900454665_01160 rRNA open 1153930-1156791 rrl 23S ribosomal RNA
55 UGTH01000001.1 GCA900454665_01161 rRNA open 1157045-1158573 rrs 16S ribosomal RNA
56 UGTH01000001.1 repeat_region open 909826-914182 CRISPR array with 66 repeats of length 30%2C consensus sequence ATTTACATTTCATTTTGATTCTATTAATAC and spacer length 36
57 UGTH01000001.1 repeat_region open 1319675-1320024 CRISPR array with 5 repeats of length 36%2C consensus sequence GTTTCCGTCCCCTGTCGGGGATTTTTTTGTTTTTTC and spacer length 40
58 UGTH01000001.1 GCA900454665_00036 CDS open 90-689 _na     199_aa Molybdenum cofactor biosynthesis protein A
59 UGTH01000001.1 GCA900454665_00037 CDS open 1559-2080 _na     173_aa epsC serine O-acetyltransferase EpsC
60 UGTH01000001.1 GCA900454665_00038 CDS open 2073-2963 _na     296_aa cysK cysteine synthase A
61 UGTH01000001.1 GCA900454665_00039 CDS open 3213-4193 _na     326_aa ISL3 family transposase
62 UGTH01000001.1 GCA900454665_00040 CDS open 4672-5526 _na     284_aa Copper amine oxidase domain protein
63 UGTH01000001.1 GCA900454665_00041 CDS open 5623-10509 _na     1628_aa SLH domain-containing protein
64 UGTH01000001.1 GCA900454665_00042 CDS open 10554-11192 _na     212_aa hypothetical protein
65 UGTH01000001.1 GCA900454665_00043 CDS open 11492-12010 _na     172_aa Flavodoxin-like domain-containing protein
66 UGTH01000001.1 GCA900454665_00044 CDS open 12011-12775 _na     254_aa Ferrichrome ABC superfamily ATP binding cassette transporter%2C ABC protein
67 UGTH01000001.1 GCA900454665_00045 CDS open 12765-13754 _na     329_aa isdF putative heme-iron transport system permease protein IsdF
68 UGTH01000001.1 GCA900454665_00046 CDS open 13741-14613 _na     290_aa isdE heme ABC transporter substrate-binding protein IsdE
69 UGTH01000001.1 GCA900454665_00047 CDS open 14603-15553 _na     316_aa Cell surface protein Shp haem-binding domain-containing protein
70 UGTH01000001.1 GCA900454665_00048 CDS open 15543-16988 _na     481_aa Iron transport-associated domain protein
71 UGTH01000001.1 GCA900454665_00049 CDS open 17222-18055 _na     277_aa hypothetical protein
72 UGTH01000001.1 GCA900454665_00050 CDS open 18065-19723 _na     552_aa ABC superfamily ATP binding cassette transporter%2C ABC/membrane protein
73 UGTH01000001.1 GCA900454665_00051 CDS open 19716-21425 _na     569_aa cydD ATP-binding/permease protein CydD
74 UGTH01000001.1 GCA900454665_00052 CDS open 21418-21792 _na     124_aa ybaN Inner membrane protein ybaN
75 UGTH01000001.1 GCA900454665_00053 CDS open 22334-22957 _na     207_aa ISL3 family transposase
76 UGTH01000001.1 GCA900454665_00054 CDS open 23161-24135 _na     324_aa Oligopeptide ABC superfamily ATP binding cassette transporter%2C ABC protein
77 UGTH01000001.1 GCA900454665_00055 CDS open 24128-25126 _na     332_aa Oligopeptide ABC superfamily ATP binding cassette transporter%2C ABC protein
78 UGTH01000001.1 GCA900454665_00056 CDS open 25135-26073 _na     312_aa Oligopeptide ABC superfamily ATP binding cassette transporter%2C permease protein
79 UGTH01000001.1 GCA900454665_00057 CDS open 26073-27002 _na     309_aa Oligopeptide ABC superfamily ATP binding cassette transporter%2C permease protein
80 UGTH01000001.1 GCA900454665_00058 CDS open 27055-28851 _na     598_aa Oligopeptide ABC superfamily ATP binding cassette transporter%2C binding protein
81 UGTH01000001.1 GCA900454665_00059 CDS open 28959-30668 _na     569_aa Thioredoxin domain-containing protein
82 UGTH01000001.1 GCA900454665_00060 CDS open 30665-31585 _na     306_aa Thioredoxin-disulfide reductase
83 UGTH01000001.1 GCA900454665_00061 CDS open 31588-32349 _na     253_aa Iron-sulfur cluster carrier protein
84 UGTH01000001.1 GCA900454665_00062 CDS open 32412-33017 _na     201_aa Phosphoglycerate mutase
85 UGTH01000001.1 GCA900454665_00063 CDS open 33014-34669 _na     551_aa mutS MutS domain V
86 UGTH01000001.1 GCA900454665_00064 CDS open 34840-35781 _na     313_aa D-3-phosphoglycerate dehydrogenase
87 UGTH01000001.1 GCA900454665_00065 CDS open 36077-37393 _na     438_aa gumN GumN protein
88 UGTH01000001.1 GCA900454665_00066 CDS open 37466-38659 _na     397_aa Major facilitator superfamily (MFS) profile domain-containing protein
89 UGTH01000001.1 GCA900454665_00067 CDS open 39059-39364 _na     101_aa hypothetical protein
90 UGTH01000001.1 GCA900454665_00068 CDS open 39361-40053 _na     230_aa hypothetical protein
91 UGTH01000001.1 GCA900454665_00069 CDS open 40298-41653 _na     451_aa UPF0210 protein HMPREF9129_1570
92 UGTH01000001.1 GCA900454665_00070 CDS open 41661-41930 _na     89_aa ACT domain-containing protein
93 UGTH01000001.1 GCA900454665_00071 CDS open 42046-42369 _na     107_aa DsrE/DsrF-like family protein
94 UGTH01000001.1 GCA900454665_00072 CDS open 42418-43269 _na     283_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
95 UGTH01000001.1 GCA900454665_00073 CDS open 43299-44798 _na     499_aa nhaC Na+/H+ antiporter NhaC
96 UGTH01000001.1 GCA900454665_00074 CDS open 44867-46717 _na     616_aa herA Helicase HerA central domain-containing protein
97 UGTH01000001.1 GCA900454665_00075 CDS open 46714-47646 _na     310_aa nurA NurA domain protein
98 UGTH01000001.1 GCA900454665_00076 CDS open 47639-48448 _na     269_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
99 UGTH01000001.1 GCA900454665_00077 CDS open 48445-49140 _na     231_aa tRNA1(Val) (Adenine(37)-N6)-methyltransferase
100 UGTH01000001.1 GCA900454665_00078 CDS open 49193-49702 _na     169_aa Acyl-CoA thioester hydrolase
101 UGTH01000001.1 GCA900454665_00079 CDS open 49677-50606 _na     309_aa Pseudouridine-5'-phosphate glycosidase
102 UGTH01000001.1 GCA900454665_00080 CDS open 50596-51681 _na     361_aa pfkB PfkB family kinase
103 UGTH01000001.1 GCA900454665_00081 CDS open 51710-52297 _na     195_aa thymidine kinase
104 UGTH01000001.1 GCA900454665_00082 CDS open 52590-53207 _na     205_aa folE GTP cyclohydrolase I FolE
105 UGTH01000001.1 GCA900454665_00083 CDS open 53207-53680 _na     157_aa HD phosphohydrolase family protein
106 UGTH01000001.1 GCA900454665_00084 CDS open 53689-54513 _na     274_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
107 UGTH01000001.1 GCA900454665_00085 CDS open 54632-54820 _na     62_aa hypothetical protein
108 UGTH01000001.1 GCA900454665_00086 CDS open 54820-54996 _na     58_aa hypothetical protein
109 UGTH01000001.1 GCA900454665_00087 CDS open 55091-55318 _na     75_aa hypothetical protein
110 UGTH01000001.1 GCA900454665_00088 CDS open 55917-57266 _na     449_aa radA DNA repair protein RadA
111 UGTH01000001.1 GCA900454665_00089 CDS open 57238-59685 _na     815_aa clpC ATP-dependent Clp protease ATP-binding subunit ClpC
112 UGTH01000001.1 GCA900454665_00090 CDS open 59689-60660 _na     323_aa Arginine kinase
113 UGTH01000001.1 GCA900454665_00091 CDS open 60657-61157 _na     166_aa Transcriptional regulator
114 UGTH01000001.1 GCA900454665_00092 CDS open 61167-61622 _na     151_aa ctsR Transcriptional regulator CtsR
115 UGTH01000001.1 GCA900454665_00093 CDS open 61789-62832 _na     347_aa Spermidine/putrescine ABC superfamily ATP binding cassette transporter%2C binding protein
116 UGTH01000001.1 GCA900454665_00094 CDS open 62843-63622 _na     259_aa Spermidine/putrescine ABC superfamily ATP binding cassette transporter%2C permease protein
117 UGTH01000001.1 GCA900454665_00095 CDS open 63619-64446 _na     275_aa Spermidine/putrescine ABC superfamily ATP binding cassette transporter%2C permease protein
118 UGTH01000001.1 GCA900454665_00096 CDS open 64443-65474 _na     343_aa potA Spermidine/putrescine import ATP-binding protein PotA
119 UGTH01000001.1 GCA900454665_00097 CDS open 65484-66014 _na     176_aa DNA-binding protein
120 UGTH01000001.1 GCA900454665_00098 CDS open 66205-66882 _na     225_aa DNA alkylation repair enzyme
121 UGTH01000001.1 GCA900454665_00099 CDS open 66955-67755 _na     266_aa Beta-propeller domain protein
122 UGTH01000001.1 GCA900454665_00100 CDS open 67767-68321 _na     184_aa lemA LemA family protein
123 UGTH01000001.1 GCA900454665_00101 CDS open 68326-69495 _na     389_aa putative tRNA sulfurtransferase
124 UGTH01000001.1 GCA900454665_00102 CDS open 69496-70641 _na     381_aa Cysteine desulfurase
125 UGTH01000001.1 GCA900454665_00103 CDS open 70714-71625 _na     303_aa putative exonuclease
126 UGTH01000001.1 GCA900454665_00104 CDS open 71618-72847 _na     409_aa pepS Aminopeptidase PepS
127 UGTH01000001.1 GCA900454665_00105 CDS open 72925-73620 _na     231_aa deoD purine-nucleoside phosphorylase
128 UGTH01000001.1 GCA900454665_00106 CDS open 73629-74216 _na     195_aa celA Competence protein CelA
129 UGTH01000001.1 GCA900454665_00108 CDS open 74608-75114 _na     168_aa putative acetyltransferase
130 UGTH01000001.1 GCA900454665_00109 CDS open 75248-76123 _na     291_aa Transcriptional regulator
131 UGTH01000001.1 GCA900454665_00110 CDS open 76245-77249 _na     334_aa Sulfate exporter family transporter
132 UGTH01000001.1 GCA900454665_00111 CDS open 77323-78123 _na     266_aa folD Bifunctional protein FolD
133 UGTH01000001.1 GCA900454665_00112 CDS open 78150-79634 _na     494_aa potassium/proton antiporter
134 UGTH01000001.1 GCA900454665_00113 CDS open 79750-80583 _na     277_aa putative metallophosphoesterase Cj0846
135 UGTH01000001.1 GCA900454665_00114 CDS open 80534-81271 _na     245_aa lgt prolipoprotein diacylglyceryl transferase
136 UGTH01000001.1 GCA900454665_00115 CDS open 81261-81920 _na     219_aa deoC deoxyribose-phosphate aldolase
137 UGTH01000001.1 GCA900454665_00116 CDS open 82066-82800 _na     244_aa YebC/PmpR family DNA-binding transcriptional regulator
138 UGTH01000001.1 GCA900454665_00117 CDS open 82940-83119 _na     59_aa rpmF 50S ribosomal protein L32
139 UGTH01000001.1 GCA900454665_00118 CDS open 83122-83637 _na     171_aa DUF177 domain-containing protein
140 UGTH01000001.1 GCA900454665_00119 CDS open 83773-84975 _na     400_aa Acetate kinase
141 UGTH01000001.1 GCA900454665_00120 CDS open 85075-86232 _na     385_aa tRNA(Met) cytidine acetate ligase
142 UGTH01000001.1 GCA900454665_00121 CDS open 86281-86652 _na     123_aa Aldoketomutase
143 UGTH01000001.1 GCA900454665_00122 CDS open 86667-87323 _na     218_aa 7-carboxy-7-deazaguanine synthase
144 UGTH01000001.1 GCA900454665_00123 CDS open 87292-87687 _na     131_aa queD 6-carboxytetrahydropterin synthase QueD
145 UGTH01000001.1 GCA900454665_00124 CDS open 87996-88430 _na     144_aa secB Preprotein translocase subunit SecB
146 UGTH01000001.1 GCA900454665_00125 CDS open 88431-88763 _na     110_aa hypothetical protein
147 UGTH01000001.1 GCA900454665_00126 CDS open 88764-89315 _na     183_aa hypothetical protein
148 UGTH01000001.1 GCA900454665_00127 CDS open 89504-89857 _na     117_aa Phage holin
149 UGTH01000001.1 GCA900454665_00128 CDS open 89976-90275 _na     99_aa 2TM domain-containing protein
150 UGTH01000001.1 GCA900454665_00129 CDS open 90242-91048 _na     268_aa N-acetylmuramoyl-L-alanine amidase
151 UGTH01000001.1 GCA900454665_00130 CDS open 91058-91312 _na     84_aa Membrane protein
152 UGTH01000001.1 GCA900454665_00131 CDS open 91368-91643 _na     91_aa RelE/StbE family addiction module toxin
153 UGTH01000001.1 GCA900454665_00132 CDS open 91640-91861 _na     73_aa DNA damage-inducible protein
154 UGTH01000001.1 GCA900454665_00133 CDS open 91990-93648 _na     552_aa Major tropism determinant N-terminal domain-containing protein
155 UGTH01000001.1 GCA900454665_00134 CDS open 93649-93792 _na     47_aa hypothetical protein
156 UGTH01000001.1 GCA900454665_00135 CDS open 93785-93949 _na     54_aa hypothetical protein
157 UGTH01000001.1 GCA900454665_00136 CDS open 93942-94178 _na     78_aa hypothetical protein
158 UGTH01000001.1 GCA900454665_00137 CDS open 94175-95845 _na     556_aa TNFR-Cys domain-containing protein
159 UGTH01000001.1 GCA900454665_00138 CDS open 95845-96951 _na     368_aa Radical SAM core domain-containing protein
160 UGTH01000001.1 GCA900454665_00139 CDS open 96951-97424 _na     157_aa DNA primase
161 UGTH01000001.1 GCA900454665_00140 CDS open 97417-97761 _na     114_aa hypothetical protein
162 UGTH01000001.1 GCA900454665_00141 CDS open 97751-98578 _na     275_aa DUF2313 domain-containing protein
163 UGTH01000001.1 GCA900454665_00142 CDS open 98571-99668 _na     365_aa Bacteriophage baseplate assembly protein J
164 UGTH01000001.1 GCA900454665_00143 CDS open 99684-100115 _na     143_aa PBSX prophage protein
165 UGTH01000001.1 GCA900454665_00144 CDS open 100112-100567 _na     151_aa Phage protein Gp138 N-terminal domain-containing protein
166 UGTH01000001.1 GCA900454665_00145 CDS open 100569-101987 _na     472_aa NlpC/P60 domain-containing protein
167 UGTH01000001.1 GCA900454665_00146 CDS open 101984-102571 _na     195_aa hypothetical protein
168 UGTH01000001.1 GCA900454665_00147 CDS open 102564-104642 _na     692_aa Phage membrane protein
169 UGTH01000001.1 GCA900454665_00148 CDS open 104803-105210 _na     135_aa Phage protein
170 UGTH01000001.1 GCA900454665_00149 CDS open 105212-105694 _na     160_aa PBSX prophage protein
171 UGTH01000001.1 GCA900454665_00150 CDS open 105708-107048 _na     446_aa Phage protein
172 UGTH01000001.1 GCA900454665_00151 CDS open 107048-107239 _na     63_aa hypothetical protein
173 UGTH01000001.1 GCA900454665_00152 CDS open 107226-107810 _na     194_aa Phage protein
174 UGTH01000001.1 GCA900454665_00153 CDS open 107807-108280 _na     157_aa Phage protein
175 UGTH01000001.1 GCA900454665_00154 CDS open 108282-108674 _na     130_aa Phage protein
176 UGTH01000001.1 GCA900454665_00155 CDS open 108632-109057 _na     141_aa hypothetical protein
177 UGTH01000001.1 GCA900454665_00156 CDS open 109067-109318 _na     83_aa HeH/LEM domain-containing protein
178 UGTH01000001.1 GCA900454665_00157 CDS open 109333-110250 _na     305_aa Lj928 prophage protein
179 UGTH01000001.1 GCA900454665_00158 CDS open 110267-110809 _na     180_aa Phage minor structural protein GP20
180 UGTH01000001.1 GCA900454665_00159 CDS open 110963-111313 _na     116_aa PemK-like protein
181 UGTH01000001.1 GCA900454665_00160 CDS open 111501-111941 _na     146_aa Integrase catalytic domain-containing protein
182 UGTH01000001.1 GCA900454665_00161 CDS open 111934-113580 _na     548_aa ADP-ribosyltransferase exoenzyme
183 UGTH01000001.1 GCA900454665_00162 CDS open 113543-114946 _na     467_aa SPP1 family phage portal protein
184 UGTH01000001.1 GCA900454665_00163 CDS open 114958-116211 _na     417_aa PBSX family phage terminase large subunit
185 UGTH01000001.1 GCA900454665_00164 CDS open 116195-116662 _na     155_aa Prophage LambdaCh01 protein
186 UGTH01000001.1 GCA900454665_00165 CDS open 116682-116867 _na     61_aa hypothetical protein
187 UGTH01000001.1 GCA900454665_00166 CDS open 117038-117526 _na     162_aa DUF4411 domain-containing protein
188 UGTH01000001.1 GCA900454665_00167 CDS open 117516-118664 _na     382_aa DUF955 domain-containing protein
189 UGTH01000001.1 GCA900454665_00168 CDS open 118774-119178 _na     134_aa Sigma-70%2C region 4
190 UGTH01000001.1 GCA900454665_00169 CDS open 119572-119709 _na     45_aa Ankyrin repeat protein
191 UGTH01000001.1 GCA900454665_00170 CDS open 119709-119900 _na     63_aa SPOR domain-containing protein
192 UGTH01000001.1 GCA900454665_00171 CDS open 119900-120133 _na     77_aa Phage antirepressor protein
193 UGTH01000001.1 GCA900454665_00172 CDS open 120312-120674 _na     120_aa Prophage Lp2 protein 24
194 UGTH01000001.1 GCA900454665_00173 CDS open 120671-120892 _na     73_aa Ankyrin repeat protein
195 UGTH01000001.1 GCA900454665_00174 CDS open 120889-121749 _na     286_aa Prophage Lp1 protein 20
196 UGTH01000001.1 GCA900454665_00175 CDS open 121795-122385 _na     196_aa hypothetical protein
197 UGTH01000001.1 GCA900454665_00176 CDS open 122388-123041 _na     217_aa Phage protein
198 UGTH01000001.1 GCA900454665_00177 CDS open 123054-123524 _na     156_aa Siphovirus superfamily protein
199 UGTH01000001.1 GCA900454665_00178 CDS open 123525-123683 _na     52_aa Competence protein comEB
200 UGTH01000001.1 GCA900454665_00179 CDS open 123783-123908 _na     41_aa hypothetical protein
201 UGTH01000001.1 GCA900454665_00180 CDS open 123895-124083 _na     62_aa sinI Modification methylase SinI
202 UGTH01000001.1 GCA900454665_00181 CDS open 124087-124575 _na     162_aa XRE family transcriptional regulator
203 UGTH01000001.1 GCA900454665_00182 CDS open 124728-125072 _na     114_aa Transposase
204 UGTH01000001.1 GCA900454665_00183 CDS open 125181-125408 _na     75_aa 3-hydroxyacyl-CoA dehydrogenase
205 UGTH01000001.1 GCA900454665_00184 CDS open 125378-125563 _na     61_aa hypothetical protein
206 UGTH01000001.1 GCA900454665_00185 CDS open 125625-125840 _na     71_aa hypothetical protein
207 UGTH01000001.1 GCA900454665_00186 CDS open 125830-125982 _na     50_aa hypothetical protein
208 UGTH01000001.1 GCA900454665_00187 CDS open 126043-126246 _na     67_aa Family 39 glycosyl transferase
209 UGTH01000001.1 GCA900454665_00188 CDS open 126216-126404 _na     62_aa hypothetical protein
210 UGTH01000001.1 GCA900454665_00189 CDS open 126417-126560 _na     47_aa hypothetical protein
211 UGTH01000001.1 GCA900454665_00190 CDS open 126664-126828 _na     54_aa Regulatory protein
212 UGTH01000001.1 GCA900454665_00191 CDS open 126795-126959 _na     54_aa hicB HicB family toxin-antitoxin system
213 UGTH01000001.1 GCA900454665_00192 CDS open 127051-127218 _na     55_aa Arc-like DNA binding domain-containing protein
214 UGTH01000001.1 GCA900454665_00193 CDS open 127332-127502 _na     56_aa putative DNA-binding protein ribbon-helix-helix domain-containing protein
215 UGTH01000001.1 GCA900454665_00194 CDS open 127417-127587 _na     56_aa hypothetical protein
216 UGTH01000001.1 GCA900454665_00195 CDS open 127716-127901 _na     61_aa XRE family transcriptional regulator
217 UGTH01000001.1 GCA900454665_00196 CDS open 128018-128638 _na     206_aa XRE family transcriptional regulator
218 UGTH01000001.1 GCA900454665_00197 CDS open 128698-129147 _na     149_aa DUF6978 domain-containing protein
219 UGTH01000001.1 GCA900454665_00198 CDS open 129156-129923 _na     255_aa DUF1828 domain-containing protein
220 UGTH01000001.1 GCA900454665_00199 CDS open 130018-130467 _na     149_aa irrE IrrE N-terminal-like domain-containing protein
221 UGTH01000001.1 GCA900454665_00200 CDS open 130469-131488 _na     339_aa Phage integrase family site-specific recombinase
222 UGTH01000001.1 GCA900454665_00214 CDS open 137624-138709 _na     361_aa hypothetical protein
223 UGTH01000001.1 GCA900454665_00215 CDS open 138706-139443 _na     245_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
224 UGTH01000001.1 GCA900454665_00216 CDS open 139526-141589 _na     687_aa BBRPI
225 UGTH01000001.1 GCA900454665_00217 CDS open 141745-141957 _na     70_aa Integrase catalytic domain-containing protein
226 UGTH01000001.1 GCA900454665_00218 CDS open 142108-142506 _na     132_aa ISPsy9 transposase
227 UGTH01000001.1 GCA900454665_00219 CDS open 142682-142924 _na     80_aa Insertion element IS150 protein InsJ-like helix-turn-helix domain-containing protein
228 UGTH01000001.1 GCA900454665_00220 CDS open 143281-143454 _na     57_aa Transposase
229 UGTH01000001.1 GCA900454665_00221 CDS open 143484-143708 _na     74_aa Transposase IS116/IS110/IS902 family
230 UGTH01000001.1 GCA900454665_00222 CDS open 143842-144339 _na     165_aa Transposase IS110-like N-terminal domain-containing protein
231 UGTH01000001.1 GCA900454665_00223 CDS open 144355-144501 _na     48_aa Transposase
232 UGTH01000001.1 GCA900454665_00224 CDS open 145208-146554 _na     448_aa MATE efflux family protein
233 UGTH01000001.1 GCA900454665_00225 CDS open 146634-148034 _na     466_aa ABC superfamily ATP binding cassette transporter ABC protein
234 UGTH01000001.1 GCA900454665_00226 CDS open 148027-148737 _na     236_aa cbiQ ABC-type cobalt transport system%2C permease component CbiQ and related transporters
235 UGTH01000001.1 GCA900454665_00227 CDS open 148741-149334 _na     197_aa Hypothetical bacterial integral membrane protein (Trep_Strep)
236 UGTH01000001.1 GCA900454665_00228 CDS open 149344-151041 _na     565_aa ABC superfamily ATP binding cassette transporter%2C ABC/membrane protein
237 UGTH01000001.1 GCA900454665_00229 CDS open 151063-152037 _na     324_aa ABC superfamily ATP binding cassette transporter%2C ABC/membrane protein
238 UGTH01000001.1 GCA900454665_00230 CDS open 152010-152834 _na     274_aa ABC transmembrane type-1 domain-containing protein
239 UGTH01000001.1 GCA900454665_00231 CDS open 153055-154050 _na     331_aa araC AraC family transcriptional regulator
240 UGTH01000001.1 GCA900454665_00232 CDS open 154888-156036 _na     382_aa IS110 family transposase
241 UGTH01000001.1 GCA900454665_00233 CDS open 156480-157064 _na     194_aa Trep-Strep domain-containing protein
242 UGTH01000001.1 GCA900454665_00234 CDS open 157075-157779 _na     234_aa ecfT Cobalt transport protein
243 UGTH01000001.1 GCA900454665_00235 CDS open 157769-159286 _na     505_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
244 UGTH01000001.1 GCA900454665_00236 CDS open 159289-160998 _na     569_aa mdlB ABC transporter
245 UGTH01000001.1 GCA900454665_00237 CDS open 160991-162778 _na     595_aa mdlB ABC transporter
246 UGTH01000001.1 GCA900454665_00238 CDS open 162892-163407 _na     171_aa DUF1579 domain-containing protein
247 UGTH01000001.1 GCA900454665_00239 CDS open 163448-164020 _na     190_aa acrR HTH tetR-type domain-containing protein
248 UGTH01000001.1 GCA900454665_00240 CDS open 164285-164572 _na     95_aa SnoaL-like domain-containing protein
249 UGTH01000001.1 GCA900454665_00241 CDS open 164805-166163 _na     452_aa mepA Multidrug export protein MepA
250 UGTH01000001.1 GCA900454665_00242 CDS open 166770-167363 _na     197_aa yfiR putative HTH-type transcriptional regulator yfiR
251 UGTH01000001.1 GCA900454665_00243 CDS open 167595-168113 _na     172_aa Transposase and inactivated derivatives
252 UGTH01000001.1 GCA900454665_00244 CDS open 168119-168613 _na     164_aa IS630 family transposase
253 UGTH01000001.1 GCA900454665_00245 CDS open 168682-170388 _na     568_aa argS arginine--tRNA ligase
254 UGTH01000001.1 GCA900454665_00246 CDS open 170399-172768 _na     789_aa mutS2 endonuclease MutS2
255 UGTH01000001.1 GCA900454665_00247 CDS open 172761-175106 _na     781_aa yhbU putative protease yhbU
256 UGTH01000001.1 GCA900454665_00248 CDS open 175096-175635 _na     179_aa zapA Cell division protein ZapA
257 UGTH01000001.1 GCA900454665_00249 CDS open 175646-178030 _na     794_aa pheT phenylalanine--tRNA ligase subunit beta
258 UGTH01000001.1 GCA900454665_00250 CDS open 178043-179065 _na     340_aa pheS phenylalanine--tRNA ligase subunit alpha
259 UGTH01000001.1 GCA900454665_00251 CDS open 179219-180619 _na     466_aa Xanthine/uracil permease
260 UGTH01000001.1 GCA900454665_00253 CDS open 181265-182608 _na     447_aa butyryl-CoA:acetate CoA-transferase
261 UGTH01000001.1 GCA900454665_00254 CDS open 182684-185698 _na     1004_aa DNA 3'-5' helicase
262 UGTH01000001.1 GCA900454665_00255 CDS open 185700-188360 _na     886_aa hypothetical protein
263 UGTH01000001.1 GCA900454665_00256 CDS open 188362-189324 _na     320_aa Pseudouridine synthase
264 UGTH01000001.1 GCA900454665_00257 CDS open 189394-190077 _na     227_aa YceG-like family
265 UGTH01000001.1 GCA900454665_00258 CDS open 190109-190426 _na     105_aa TIGR04076 family protein
266 UGTH01000001.1 GCA900454665_00259 CDS open 190589-190732 _na     47_aa Peptide deformylase
267 UGTH01000001.1 GCA900454665_00260 CDS open 191003-191350 _na     115_aa hypothetical protein
268 UGTH01000001.1 GCA900454665_00261 CDS open 191366-191677 _na     103_aa hypothetical protein
269 UGTH01000001.1 GCA900454665_00262 CDS open 191748-192194 _na     148_aa Flavodoxin
270 UGTH01000001.1 GCA900454665_00263 CDS open 192243-194981 _na     912_aa Transglutaminase domain protein
271 UGTH01000001.1 GCA900454665_00264 CDS open 196472-197695 _na     407_aa IS110 family transposase
272 UGTH01000001.1 GCA900454665_00265 CDS open 197871-198470 _na     199_aa Peptidyl-prolyl cis-trans isomerase
273 UGTH01000001.1 GCA900454665_00266 CDS open 198487-199164 _na     225_aa Hemolysin III
274 UGTH01000001.1 GCA900454665_00267 CDS open 199158-199913 _na     251_aa map type I methionyl aminopeptidase
275 UGTH01000001.1 GCA900454665_00268 CDS open 199970-200848 _na     292_aa TIGR01212 family radical SAM protein
276 UGTH01000001.1 GCA900454665_00269 CDS open 200921-202711 _na     596_aa DUF4153 domain-containing protein
277 UGTH01000001.1 GCA900454665_00270 CDS open 202824-203555 _na     243_aa truA tRNA pseudouridine(38-40) synthase TruA
278 UGTH01000001.1 GCA900454665_00271 CDS open 203552-204364 _na     270_aa ecfT Energy-coupling factor transporter transmembrane protein EcfT
279 UGTH01000001.1 GCA900454665_00272 CDS open 204357-205220 _na     287_aa energy-coupling factor transporter ATPase
280 UGTH01000001.1 GCA900454665_00273 CDS open 205211-206029 _na     272_aa energy-coupling factor transporter ATPase
281 UGTH01000001.1 GCA900454665_00274 CDS open 206173-207360 _na     395_aa M20D family peptidase
282 UGTH01000001.1 GCA900454665_00275 CDS open 207378-208589 _na     403_aa Membrane protein
283 UGTH01000001.1 GCA900454665_00276 CDS open 208790-210538 _na     582_aa Multidrug export ATP-binding/permease protein SAV1866
284 UGTH01000001.1 GCA900454665_00277 CDS open 210654-212231 _na     525_aa murJ murein biosynthesis integral membrane protein MurJ
285 UGTH01000001.1 GCA900454665_00278 CDS open 212245-212856 _na     203_aa Phosphoserine phosphatase
286 UGTH01000001.1 GCA900454665_00279 CDS open 212938-213987 _na     349_aa DNA polymerase IV
287 UGTH01000001.1 GCA900454665_00280 CDS open 214941-215198 _na     85_aa hypothetical protein
288 UGTH01000001.1 GCA900454665_00281 CDS open 215204-216556 _na     450_aa Xanthine/uracil/vitamin C permease
289 UGTH01000001.1 GCA900454665_00282 CDS open 216571-217872 _na     433_aa 4-hydroxybutyrate CoA-transferase
290 UGTH01000001.1 GCA900454665_00283 CDS open 217884-218177 _na     97_aa nifU NIF system FeS cluster assembly NifU C-terminal domain-containing protein
291 UGTH01000001.1 GCA900454665_00284 CDS open 218189-219649 _na     486_aa Gamma-aminobutyrate metabolism dehydratase/isomerase
292 UGTH01000001.1 GCA900454665_00285 CDS open 219914-221341 _na     475_aa Sigma-54-dependent transcriptional regulator
293 UGTH01000001.1 GCA900454665_00288 CDS open 222433-222840 _na     135_aa Zn-finger containing protein
294 UGTH01000001.1 GCA900454665_00289 CDS open 222937-223896 _na     319_aa bioB biotin synthase BioB
295 UGTH01000001.1 GCA900454665_00290 CDS open 223936-224445 _na     169_aa adenine phosphoribosyltransferase
296 UGTH01000001.1 GCA900454665_00291 CDS open 224512-225888 _na     458_aa hydA dihydropyrimidinase
297 UGTH01000001.1 GCA900454665_00292 CDS open 226147-226662 _na     171_aa hypothetical protein
298 UGTH01000001.1 GCA900454665_00293 CDS open 226720-227073 _na     117_aa arsC ArsC family protein
299 UGTH01000001.1 GCA900454665_00294 CDS open 227157-227447 _na     96_aa hypothetical protein
300 UGTH01000001.1 GCA900454665_00295 CDS open 227627-228238 _na     203_aa Glutathione S-transferase GST-4-5
301 UGTH01000001.1 GCA900454665_00296 CDS open 228445-229731 _na     428_aa serS serine--tRNA ligase
302 UGTH01000001.1 GCA900454665_00297 CDS open 230090-231205 _na     371_aa YibE/F family protein
303 UGTH01000001.1 GCA900454665_00298 CDS open 231246-232187 _na     313_aa trxB thioredoxin-disulfide reductase
304 UGTH01000001.1 GCA900454665_00299 CDS open 232314-233171 _na     285_aa putative membrane protein YciQ-like C-terminal domain-containing protein
305 UGTH01000001.1 GCA900454665_00300 CDS open 233190-234206 _na     338_aa fni type 2 isopentenyl-diphosphate Delta-isomerase
306 UGTH01000001.1 GCA900454665_00301 CDS open 234250-235092 _na     280_aa rapZ RNase adapter RapZ
307 UGTH01000001.1 GCA900454665_00302 CDS open 235092-235979 _na     295_aa murB UDP-N-acetylmuramate dehydrogenase
308 UGTH01000001.1 GCA900454665_00303 CDS open 236111-237118 _na     335_aa Electron transfer flavoprotein alpha subunit
309 UGTH01000001.1 GCA900454665_00304 CDS open 237132-237926 _na     264_aa Electron transfer flavoprotein small subunit
310 UGTH01000001.1 GCA900454665_00305 CDS open 237942-239084 _na     380_aa Butyryl-CoA dehydrogenase
311 UGTH01000001.1 GCA900454665_00306 CDS open 239493-239624 _na     43_aa hypothetical protein
312 UGTH01000001.1 GCA900454665_00307 CDS open 239676-239951 _na     91_aa hypothetical protein
313 UGTH01000001.1 GCA900454665_00308 CDS open 239948-240415 _na     155_aa hypothetical protein
314 UGTH01000001.1 GCA900454665_00309 CDS open 240434-243013 _na     859_aa clpB ATP-dependent chaperone ClpB
315 UGTH01000001.1 GCA900454665_00310 CDS open 243018-243929 _na     303_aa dnaJ Chaperone protein DnaJ
316 UGTH01000001.1 GCA900454665_00311 CDS open 244202-244903 _na     233_aa CAAX amino protease
317 UGTH01000001.1 GCA900454665_00312 CDS open 244929-245546 _na     205_aa ABC-2 transporter permease
318 UGTH01000001.1 GCA900454665_00313 CDS open 245539-246165 _na     208_aa ABC-2 family transporter protein
319 UGTH01000001.1 GCA900454665_00314 CDS open 246146-247003 _na     285_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
320 UGTH01000001.1 GCA900454665_00315 CDS open 246984-247367 _na     127_aa gntR GntR family transcriptional regulator
321 UGTH01000001.1 GCA900454665_00316 CDS open 247827-249149 _na     440_aa CBS domain protein
322 UGTH01000001.1 GCA900454665_00317 CDS open 249658-251961 _na     767_aa xdhA xanthine dehydrogenase subunit XdhA
323 UGTH01000001.1 GCA900454665_00318 CDS open 251975-252859 _na     294_aa xdhB xanthine dehydrogenase subunit XdhB
324 UGTH01000001.1 GCA900454665_00319 CDS open 252852-253391 _na     179_aa xdhC xanthine dehydrogenase subunit XdhC
325 UGTH01000001.1 GCA900454665_00320 CDS open 253657-254310 _na     217_aa Zinc-binding lipoprotein
326 UGTH01000001.1 GCA900454665_00321 CDS open 254325-255617 _na     430_aa adcA putative zinc transport system zinc-binding lipoprotein AdcA
327 UGTH01000001.1 GCA900454665_00322 CDS open 255633-256295 _na     220_aa Zinc ABC superfamily ATP binding cassette transporter%2C ABC protein
328 UGTH01000001.1 GCA900454665_00323 CDS open 256289-257092 _na     267_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
329 UGTH01000001.1 GCA900454665_00324 CDS open 257189-259834 _na     881_aa valine--tRNA ligase
330 UGTH01000001.1 GCA900454665_00325 CDS open 260316-260921 _na     201_aa coaE dephospho-CoA kinase
331 UGTH01000001.1 GCA900454665_00326 CDS open 260908-263556 _na     882_aa polA DNA polymerase I
332 UGTH01000001.1 GCA900454665_00328 CDS open 264093-265157 _na     354_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
333 UGTH01000001.1 GCA900454665_00329 CDS open 265141-265710 _na     189_aa tetR Bacterial regulatory proteins%2C tetR family
334 UGTH01000001.1 GCA900454665_00330 CDS open 266128-266826 _na     232_aa CAAX amino protease
335 UGTH01000001.1 GCA900454665_00331 CDS open 267519-273251 _na     1910_aa PII-type proteinase
336 UGTH01000001.1 GCA900454665_00332 CDS open 273283-274464 _na     393_aa AhpC/TSA family antioxidant
337 UGTH01000001.1 GCA900454665_00333 CDS open 274668-278849 _na     1393_aa SLH domain-containing protein
338 UGTH01000001.1 GCA900454665_00334 CDS open 279956-280114 _na     52_aa recR Recombinase RecR
339 UGTH01000001.1 GCA900454665_00335 CDS open 280274-281497 _na     407_aa IS110 family transposase
340 UGTH01000001.1 GCA900454665_00336 CDS open 281792-282862 _na     356_aa yhcG YhcG PDDEXK nuclease domain-containing protein
341 UGTH01000001.1 GCA900454665_00337 CDS open 283277-283423 _na     48_aa hypothetical protein
342 UGTH01000001.1 GCA900454665_00338 CDS open 283461-283730 _na     89_aa Tetratricopeptide (TPR) domain protein
343 UGTH01000001.1 GCA900454665_00339 CDS open 283818-284414 _na     198_aa rpsD 30S ribosomal protein S4
344 UGTH01000001.1 GCA900454665_00340 CDS open 284546-285805 _na     419_aa 5-methylthioadenosine/S-adenosylhomocysteine deaminase
345 UGTH01000001.1 GCA900454665_00341 CDS open 285805-286794 _na     329_aa trpS tryptophan--tRNA ligase
346 UGTH01000001.1 GCA900454665_00342 CDS open 287919-288914 _na     331_aa KilA-N DNA-binding domain-containing protein
347 UGTH01000001.1 GCA900454665_00343 CDS open 289762-291660 _na     632_aa Copper amine oxidase-like N-terminal domain-containing protein
348 UGTH01000001.1 GCA900454665_00344 CDS open 292213-295482 _na     1089_aa Beta antigen
349 UGTH01000001.1 GCA900454665_00345 CDS open 297100-297363 _na     87_aa Plasmid stabilization system protein
350 UGTH01000001.1 GCA900454665_00346 CDS open 297360-297584 _na     74_aa relB type II toxin-antitoxin system RelB family antitoxin
351 UGTH01000001.1 GCA900454665_00347 CDS open 298893-300251 _na     452_aa Gram-positive signal peptide%2C YSIRK family
352 UGTH01000001.1 GCA900454665_00348 CDS open 300731-301465 _na     244_aa CAAX amino protease
353 UGTH01000001.1 GCA900454665_00349 CDS open 301467-302384 _na     305_aa Abortive infection protein
354 UGTH01000001.1 GCA900454665_00350 CDS open 302481-303380 _na     299_aa Iron-sulfur cluster-binding protein
355 UGTH01000001.1 GCA900454665_00351 CDS open 303389-303532 _na     47_aa Thioredoxin
356 UGTH01000001.1 GCA900454665_00352 CDS open 303541-304167 _na     208_aa Thioredoxin family protein
357 UGTH01000001.1 GCA900454665_00353 CDS open 304359-304877 _na     172_aa putative conserved protein
358 UGTH01000001.1 GCA900454665_00354 CDS open 304989-305669 _na     226_aa cutR Transcriptional regulatory protein CutR
359 UGTH01000001.1 GCA900454665_00355 CDS open 305679-306782 _na     367_aa histidine kinase
360 UGTH01000001.1 GCA900454665_00356 CDS open 306985-307209 _na     74_aa rpsR 30S ribosomal protein S18
361 UGTH01000001.1 GCA900454665_00357 CDS open 307222-307728 _na     168_aa Single-stranded DNA-binding protein
362 UGTH01000001.1 GCA900454665_00358 CDS open 307738-308022 _na     94_aa rpsF 30S ribosomal protein S6
363 UGTH01000001.1 GCA900454665_00359 CDS open 308182-308661 _na     159_aa methylglyoxal synthase
364 UGTH01000001.1 GCA900454665_00360 CDS open 308767-308991 _na     74_aa DUF951 domain-containing protein
365 UGTH01000001.1 GCA900454665_00361 CDS open 309000-309830 _na     276_aa Mechanosensitive ion channel family protein
366 UGTH01000001.1 GCA900454665_00362 CDS open 309827-310873 _na     348_aa hypothetical protein
367 UGTH01000001.1 GCA900454665_00363 CDS open 312040-314391 _na     783_aa Internalin-A
368 UGTH01000001.1 GCA900454665_00364 CDS open 314632-315111 _na     159_aa N-acetylmuramoyl-L-alanine amidase
369 UGTH01000001.1 GCA900454665_00365 CDS open 315098-315646 _na     182_aa ECF subfamily RNA polymerase sigma-24 factor
370 UGTH01000001.1 GCA900454665_00366 CDS open 315933-316085 _na     50_aa yvrJ YvrJ family protein
371 UGTH01000001.1 GCA900454665_00367 CDS open 316236-316676 _na     146_aa Transposase and inactivated derivatives
372 UGTH01000001.1 GCA900454665_00368 CDS open 317595-317816 _na     73_aa DUF2922 domain-containing protein
373 UGTH01000001.1 GCA900454665_00369 CDS open 317838-318056 _na     72_aa DUF1659 domain-containing protein
374 UGTH01000001.1 GCA900454665_00370 CDS open 318210-320555 _na     781_aa Surface layer protein
375 UGTH01000001.1 GCA900454665_00371 CDS open 321028-321678 _na     216_aa DUF3793 domain-containing protein
376 UGTH01000001.1 GCA900454665_00372 CDS open 321629-322051 _na     140_aa flavodoxin
377 UGTH01000001.1 GCA900454665_00373 CDS open 322491-323282 _na     263_aa DUF4367 domain-containing protein
378 UGTH01000001.1 GCA900454665_00374 CDS open 323275-323844 _na     189_aa RNA polymerase sigma factor
379 UGTH01000001.1 GCA900454665_00375 CDS open 323986-324651 _na     221_aa SLH domain-containing protein
380 UGTH01000001.1 GCA900454665_00376 CDS open 324824-325741 _na     305_aa Nitric oxide reductase
381 UGTH01000001.1 GCA900454665_00377 CDS open 325734-327422 _na     562_aa VWFA domain-containing protein
382 UGTH01000001.1 GCA900454665_00378 CDS open 327452-327889 _na     145_aa hypothetical protein
383 UGTH01000001.1 GCA900454665_00379 CDS open 328174-329553 _na     459_aa gntP Gluconate:H+ symporter family transporter GntP
384 UGTH01000001.1 GCA900454665_00380 CDS open 329553-330557 _na     334_aa pdxA 4-hydroxythreonine-4-phosphate dehydrogenase PdxA
385 UGTH01000001.1 GCA900454665_00381 CDS open 330569-331846 _na     425_aa Four-carbon acid sugar kinase family protein
386 UGTH01000001.1 GCA900454665_00382 CDS open 331854-332621 _na     255_aa deoR DeoR family transcriptional regulator
387 UGTH01000001.1 GCA900454665_00383 CDS open 332785-334695 _na     636_aa ftsH ATP-dependent zinc metalloprotease FtsH
388 UGTH01000001.1 GCA900454665_00384 CDS open 334840-335451 _na     203_aa recR recombination mediator RecR
389 UGTH01000001.1 GCA900454665_00385 CDS open 335454-335792 _na     112_aa YbaB/EbfC family nucleoid-associated protein
390 UGTH01000001.1 GCA900454665_00386 CDS open 335818-337455 _na     545_aa dnaX DNA polymerase III subunit gamma/tau
391 UGTH01000001.1 GCA900454665_00387 CDS open 337607-337909 _na     100_aa Lipoprotein
392 UGTH01000001.1 GCA900454665_00388 CDS open 338010-339581 _na     523_aa Zinc-ribbon domain-containing protein
393 UGTH01000001.1 GCA900454665_00389 CDS open 339788-340117 _na     109_aa Na+/H+ antiporter
394 UGTH01000001.1 GCA900454665_00390 CDS open 340392-341501 _na     369_aa Glycerol dehydrogenase
395 UGTH01000001.1 GCA900454665_00391 CDS open 341547-342608 _na     353_aa branched-chain amino acid aminotransferase
396 UGTH01000001.1 GCA900454665_00392 CDS open 342624-343790 _na     388_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
397 UGTH01000001.1 GCA900454665_00393 CDS open 344165-345349 _na     394_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
398 UGTH01000001.1 GCA900454665_00394 CDS open 345981-346922 _na     313_aa dusB tRNA dihydrouridine synthase DusB
399 UGTH01000001.1 GCA900454665_00395 CDS open 346912-347703 _na     263_aa type III pantothenate kinase
400 UGTH01000001.1 GCA900454665_00396 CDS open 347902-348444 _na     180_aa Biotin transporter
401 UGTH01000001.1 GCA900454665_00397 CDS open 348503-349804 _na     433_aa Transporter
402 UGTH01000001.1 GCA900454665_00399 CDS open 350301-351587 _na     428_aa CCS family citrate carrier protein
403 UGTH01000001.1 GCA900454665_00400 CDS open 351606-352286 _na     226_aa gntR GntR family transcriptional regulator
404 UGTH01000001.1 GCA900454665_00401 CDS open 352358-353905 _na     515_aa citF citrate lyase subunit alpha
405 UGTH01000001.1 GCA900454665_00402 CDS open 353902-354795 _na     297_aa Citrate lyase%2C beta subunit
406 UGTH01000001.1 GCA900454665_00403 CDS open 354792-355085 _na     97_aa citD citrate lyase acyl carrier protein
407 UGTH01000001.1 GCA900454665_00404 CDS open 355345-355887 _na     180_aa citrate lyase holo-[acyl-carrier protein] synthase
408 UGTH01000001.1 GCA900454665_00405 CDS open 355947-356726 _na     259_aa triphosphoribosyl-dephospho-CoA synthase
409 UGTH01000001.1 GCA900454665_00406 CDS open 356707-357765 _na     352_aa citC [citrate (pro-3S)-lyase] ligase
410 UGTH01000001.1 GCA900454665_00407 CDS open 357815-359353 _na     512_aa hutH histidine ammonia-lyase
411 UGTH01000001.1 GCA900454665_00408 CDS open 359459-360778 _na     439_aa Na+/H+ antiporter family protein
412 UGTH01000001.1 GCA900454665_00409 CDS open 361482-364490 _na     1002_aa Serine/threonine kinase
413 UGTH01000001.1 GCA900454665_00410 CDS open 364610-364792 _na     60_aa hypothetical protein
414 UGTH01000001.1 GCA900454665_00411 CDS open 364856-366202 _na     448_aa glmL methylaspartate mutase accessory protein GlmL
415 UGTH01000001.1 GCA900454665_00412 CDS open 366265-366891 _na     208_aa Methenyltetrahydrofolate cyclohydrolase
416 UGTH01000001.1 GCA900454665_00413 CDS open 366901-368577 _na     558_aa formate--tetrahydrofolate ligase
417 UGTH01000001.1 GCA900454665_00414 CDS open 368585-369478 _na     297_aa ftcD glutamate formimidoyltransferase
418 UGTH01000001.1 GCA900454665_00415 CDS open 369579-370460 _na     293_aa ftcD glutamate formimidoyltransferase
419 UGTH01000001.1 GCA900454665_00416 CDS open 370472-372007 _na     511_aa hutH histidine ammonia-lyase
420 UGTH01000001.1 GCA900454665_00417 CDS open 372063-372617 _na     184_aa Formimidoyltetrahydrofolate cyclodeaminase
421 UGTH01000001.1 GCA900454665_00418 CDS open 372630-373847 _na     405_aa hutI imidazolonepropionase
422 UGTH01000001.1 GCA900454665_00419 CDS open 373858-375159 _na     433_aa Na+/H+ antiporter family protein
423 UGTH01000001.1 GCA900454665_00420 CDS open 375301-376593 _na     430_aa Nucleoside recognition domain protein
424 UGTH01000001.1 GCA900454665_00421 CDS open 376671-378425 _na     584_aa urocanate hydratase
425 UGTH01000001.1 GCA900454665_00422 CDS open 378645-380006 _na     453_aa glmL methylaspartate mutase accessory protein GlmL
426 UGTH01000001.1 GCA900454665_00423 CDS open 380017-383058 _na     1013_aa putative ATPase
427 UGTH01000001.1 GCA900454665_00424 CDS open 383073-384011 _na     312_aa Putative cytoplasmic protein
428 UGTH01000001.1 GCA900454665_00425 CDS open 384236-385459 _na     407_aa IS110 family transposase
429 UGTH01000001.1 GCA900454665_00426 CDS open 385747-387012 _na     421_aa hutI imidazolonepropionase
430 UGTH01000001.1 GCA900454665_00427 CDS open 387218-389242 _na     674_aa urocanate hydratase
431 UGTH01000001.1 GCA900454665_00428 CDS open 389399-390346 _na     315_aa hypothetical protein
432 UGTH01000001.1 GCA900454665_00429 CDS open 390354-391313 _na     319_aa hypothetical protein
433 UGTH01000001.1 GCA900454665_00430 CDS open 391834-392268 _na     144_aa IS30 family transposase
434 UGTH01000001.1 GCA900454665_00431 CDS open 392701-393579 _na     292_aa Integral membrane protein
435 UGTH01000001.1 GCA900454665_00432 CDS open 393583-394992 _na     469_aa MFS family major facilitator transporter
436 UGTH01000001.1 GCA900454665_00433 CDS open 395081-395734 _na     217_aa tetR TetR family transcriptional regulator
437 UGTH01000001.1 GCA900454665_00434 CDS open 395737-397158 _na     473_aa Aminoacyl-histidine dipeptidase
438 UGTH01000001.1 GCA900454665_00435 CDS open 397441-398769 _na     442_aa mgtE magnesium transporter
439 UGTH01000001.1 GCA900454665_00436 CDS open 398812-399234 _na     140_aa hypothetical protein
440 UGTH01000001.1 GCA900454665_00437 CDS open 399282-400877 _na     531_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
441 UGTH01000001.1 GCA900454665_00438 CDS open 400958-402910 _na     650_aa YcdB/YcdC repeated domain-containing protein
442 UGTH01000001.1 GCA900454665_00439 CDS open 403415-404224 _na     269_aa (R)-stereoselective amidase
443 UGTH01000001.1 GCA900454665_00440 CDS open 404301-405524 _na     407_aa Tryptophan permease
444 UGTH01000001.1 GCA900454665_00441 CDS open 405533-406342 _na     269_aa Amidohydrolase
445 UGTH01000001.1 GCA900454665_00442 CDS open 406496-407491 _na     331_aa Thermophilic metalloprotease (M29)
446 UGTH01000001.1 GCA900454665_00443 CDS open 407505-408785 _na     426_aa Glutamate-aspartate carrier protein
447 UGTH01000001.1 GCA900454665_00444 CDS open 409014-409886 _na     290_aa hexR DNA-binding transcriptional regulator HexR
448 UGTH01000001.1 GCA900454665_00445 CDS open 410347-411384 _na     345_aa pdaA putative polysaccharide deacetylase pdaA
449 UGTH01000001.1 GCA900454665_00446 CDS open 411422-412678 _na     418_aa lysA diaminopimelate decarboxylase
450 UGTH01000001.1 GCA900454665_00447 CDS open 412761-412991 _na     76_aa nrdH Glutaredoxin-like protein NrdH
451 UGTH01000001.1 GCA900454665_00448 CDS open 413045-413368 _na     107_aa czrA Metal transport repressor protein CzrA
452 UGTH01000001.1 GCA900454665_00449 CDS open 413378-414220 _na     280_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
453 UGTH01000001.1 GCA900454665_00450 CDS open 414227-414775 _na     182_aa rnmV ribonuclease M5
454 UGTH01000001.1 GCA900454665_00451 CDS open 414768-415541 _na     257_aa tatD TatD family hydrolase
455 UGTH01000001.1 GCA900454665_00452 CDS open 415541-417499 _na     652_aa metG methionine--tRNA ligase
456 UGTH01000001.1 GCA900454665_00453 CDS open 417619-418053 _na     144_aa Universal stress protein
457 UGTH01000001.1 GCA900454665_00454 CDS open 418142-418867 _na     241_aa DUF4367 domain-containing protein
458 UGTH01000001.1 GCA900454665_00455 CDS open 418857-419384 _na     175_aa sigX ECF family DNA-directed RNA polymerase sigma subunit SigX
459 UGTH01000001.1 GCA900454665_00456 CDS open 419467-420333 _na     288_aa yitT putative BCR%2C YitT family COG1284
460 UGTH01000001.1 GCA900454665_00457 CDS open 420493-421080 _na     195_aa Lipoprotein
461 UGTH01000001.1 GCA900454665_00458 CDS open 421145-421741 _na     198_aa Lipoprotein
462 UGTH01000001.1 GCA900454665_00459 CDS open 421785-422048 _na     87_aa DUF3343 domain-containing protein
463 UGTH01000001.1 GCA900454665_00460 CDS open 422060-423334 _na     424_aa double-cubane-cluster-containing anaerobic reductase
464 UGTH01000001.1 GCA900454665_00461 CDS open 423347-424114 _na     255_aa 2-hydroxyacyl-CoA dehydratase
465 UGTH01000001.1 GCA900454665_00462 CDS open 424111-424863 _na     250_aa (R)-2-hydroxyglutaryl-CoA dehydratase activator
466 UGTH01000001.1 GCA900454665_00463 CDS open 425017-425223 _na     68_aa Copper ion binding protein
467 UGTH01000001.1 GCA900454665_00464 CDS open 425225-427486 _na     753_aa P-type Cu(+) transporter
468 UGTH01000001.1 GCA900454665_00465 CDS open 427602-427985 _na     127_aa Transcriptional regulator
469 UGTH01000001.1 GCA900454665_00466 CDS open 428027-428998 _na     323_aa pta phosphate acetyltransferase
470 UGTH01000001.1 GCA900454665_00467 CDS open 429230-430498 _na     422_aa Parasporal protein
471 UGTH01000001.1 GCA900454665_00468 CDS open 430528-431235 _na     235_aa hypothetical protein
472 UGTH01000001.1 GCA900454665_00469 CDS open 431510-431617 _na     35_aa hypothetical protein
473 UGTH01000001.1 GCA900454665_00470 CDS open 431607-432218 _na     203_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
474 UGTH01000001.1 GCA900454665_00471 CDS open 432208-434532 _na     774_aa lon endopeptidase La
475 UGTH01000001.1 GCA900454665_00472 CDS open 434577-435815 _na     412_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
476 UGTH01000001.1 GCA900454665_00473 CDS open 435824-436408 _na     194_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
477 UGTH01000001.1 GCA900454665_00474 CDS open 436438-437766 _na     442_aa tig trigger factor
478 UGTH01000001.1 GCA900454665_00475 CDS open 437827-438042 _na     71_aa Transcriptional coactivator p15 (PC4) C-terminal domain-containing protein
479 UGTH01000001.1 GCA900454665_00476 CDS open 438049-439743 _na     564_aa proline--tRNA ligase
480 UGTH01000001.1 GCA900454665_00478 CDS open 440195-440830 _na     211_aa Haloacid dehalogenase-like hydrolase
481 UGTH01000001.1 GCA900454665_00479 CDS open 440833-441390 _na     185_aa vanZ VanZ like family protein
482 UGTH01000001.1 GCA900454665_00481 CDS open 442148-445393 _na     1081_aa putative protein involved in cytokinesis%2C contains TGc (Transglutaminase/protease-like) domain
483 UGTH01000001.1 GCA900454665_00482 CDS open 445938-446882 _na     314_aa Peptidase C39-like domain-containing protein
484 UGTH01000001.1 GCA900454665_00483 CDS open 446955-447491 _na     178_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
485 UGTH01000001.1 GCA900454665_00484 CDS open 447704-448609 _na     301_aa Integral membrane protein
486 UGTH01000001.1 GCA900454665_00485 CDS open 448599-450188 _na     529_aa hypothetical protein
487 UGTH01000001.1 GCA900454665_00486 CDS open 450166-451383 _na     405_aa histidine kinase
488 UGTH01000001.1 GCA900454665_00487 CDS open 451383-452075 _na     230_aa Response regulator
489 UGTH01000001.1 GCA900454665_00488 CDS open 452093-453103 _na     336_aa yihY YihY family protein
490 UGTH01000001.1 GCA900454665_00489 CDS open 453100-453708 _na     202_aa comF ComF protein
491 UGTH01000001.1 GCA900454665_00490 CDS open 453687-455900 _na     737_aa recD2 ATP-dependent RecD2 DNA helicase
492 UGTH01000001.1 GCA900454665_00491 CDS open 455930-457099 _na     389_aa metK methionine adenosyltransferase
493 UGTH01000001.1 GCA900454665_00492 CDS open 457155-458090 _na     311_aa Auxin efflux carrier
494 UGTH01000001.1 GCA900454665_00493 CDS open 458287-459552 _na     421_aa NAD-specific glutamate dehydrogenase
495 UGTH01000001.1 GCA900454665_00494 CDS open 459741-460520 _na     259_aa Formate/nitrite transporter
496 UGTH01000001.1 GCA900454665_00495 CDS open 460563-461435 _na     290_aa degV DegV family protein
497 UGTH01000001.1 GCA900454665_00496 CDS open 461444-462091 _na     215_aa Membrane protein
498 UGTH01000001.1 GCA900454665_00497 CDS open 462099-462743 _na     214_aa 5'-nucleotidase
499 UGTH01000001.1 GCA900454665_00498 CDS open 462847-463539 _na     230_aa hypothetical protein
500 UGTH01000001.1 GCA900454665_00499 CDS open 463551-464417 _na     288_aa Radical SAM domain protein